CN105284902B - A kind of preparation method for the biological and ecological methods to prevent plant disease, pests, and erosion fermented liquid for preventing and treating apple tree canker - Google Patents
A kind of preparation method for the biological and ecological methods to prevent plant disease, pests, and erosion fermented liquid for preventing and treating apple tree canker Download PDFInfo
- Publication number
- CN105284902B CN105284902B CN201510794468.7A CN201510794468A CN105284902B CN 105284902 B CN105284902 B CN 105284902B CN 201510794468 A CN201510794468 A CN 201510794468A CN 105284902 B CN105284902 B CN 105284902B
- Authority
- CN
- China
- Prior art keywords
- fermented liquid
- zymotic fluid
- apple
- preparation
- field control
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention discloses a kind of preparation method for the biological and ecological methods to prevent plant disease, pests, and erosion fermented liquid for preventing and treating apple tree canker, the present invention obtains 2 plants from separation screening on the branches of fruit trees in Shanxi Province apple producing region Linfen apple orchard and suppresses apple rot pathogen preferable bacterial strain LF17, LF18, and bacillus subtilis (B.subtilis) is accredited as through bacterial strain colony characteristicses, bacterial strain microscopic features and 16SrDNA sequence analyses.Biological and ecological methods to prevent plant disease, pests, and erosion fermented liquid is prepared by following steps：S1, culture medium preparation：S2, antagonistic strain activation：S3, antagonistic strain Liquid Culture：S4, filtering and concentrating zymotic fluid；S5, antagonism fermented liquid field control medicament preparation；S6, antagonism fermented liquid paste field control medicament preparation.Biological and ecological methods to prevent plant disease, pests, and erosion fermented liquid obtained by the present invention can effectively prevent and treat canker of apple fruit, comparatively safe to people and animals, environment compatibility is good, be not likely to produce the resistance to the action of a drug, wound healing fast, sick scar recurrence rate is low.
Description
Technical field
The present invention relates to the prevention and control field of apple tree canker, and in particular to a kind of biocontrol microorganisms for preventing and treating apple tree canker
The preparation method of zymotic fluid.
Background technology
Apple tree canker is that one of more serious disease is endangered in China's apple producing region.The disease causes apple tree bark rotten
Rotten, tree vigo(u)r is weak, apple production and quality decline；Cause mobile jib so that whole tree is withered, or even causes to ruin garden when serious.Currently,
Rot seriously governs the development of Apple Industry.Ministry of Agriculture's apple modern industry technical system investigation shows：Apple tree is rotted
Sick overall incidence is up to 52.7%.With the increase of the age of tree, rot diseased plant rate is improved, and the 4-10 fruit tree strain incidences of disease are
The fruit tree strain incidence of disease of 26.8%, the 11-17 age of tree is that 54.0%, the 18-24 fruit tree strain incidences of disease are 59.3%.Currently,
It is main in production to use Agro-chemicals control apple tree canker disease.However, long-term largely not only make orchard using chemical agent
The deterioration of the ecological environment simultaneously brings very big hidden danger, and be easily caused the appearance of rotten pathogenic bacteria drug-fast strain to food security.To the greatest extent
Pipe chemical agent is still occupied an leading position in agricultural production, but seek environmentally friendly and efficient prevention and controls turn into urgently solve
Certainly the problem of.
Biological prevention is increasingly paid close attention to as a kind of safely and effectively prophylactico-therapeutic measures by people.Domestic and foreign scholars
Successively report Trichoderma harzianum (Trichoderma harzianum), Trichoderma atroviride (Trichoderma atroviride), spiral
Hair shell (Chaetomium spirale), endogeny rayungus, streptomycete etc. have antagonism to apple rot pathogen.Mesh
Before, mainly there are bacillus (Bacillus), Pseudomonas alba (Pseudomonas), soil to put using more biocontrol bacteria
Penetrate bacillus (Agrobacterium radiobacter) etc..Wherein, bacillus subtilis (Bacillus subtilis) is one
Plant Gram-positive bacillus；Its scope of restraining fungi very wide (including tomato leaf disease, droop, cucumber fusarium axysporum, downy mildew, ash
Mildew, powdery mildew, rot etc.), it is a kind of preferable Biocontrol microorganism.Bacillus subtilis bactericide has relative to people and animals
Safety, environment compatibility are good, the advantages of be not likely to produce the resistance to the action of a drug, meet modern society agricultural production and harmful organism are integrated it is anti-
Control the requirement of (IPM).
But the subtilin, many produced during the bacillus subtilis of separate sources (B.subtilis) strain growth
Colistin, nystatin, gramicidins isoreactivity content of material differ greatly, and cause separate sources bacillus subtilis strain to exist
The significance difference opposite sex is shown in terms of fungistatic effect.In addition, simple biological and ecological methods to prevent plant disease, pests, and erosion fermented liquid, which prevents and treats apple tree canker, has preventing and treating effect
How useful effect is in problems such as pathogens for really unstable, Antagonistic Fungi bateriostatics.
The content of the invention
To solve the above problems, the invention provides a kind of preparation side for the biological and ecological methods to prevent plant disease, pests, and erosion fermented liquid for preventing and treating apple tree canker
Method, the biological and ecological methods to prevent plant disease, pests, and erosion fermented liquid of gained can effectively prevent and treat canker of apple fruit, it is comparatively safe to people and animals, environment compatibility is good, be difficult production
The sick resistance to the action of a drug, wound healing are fast, scar recurrence rate is low.
The present invention obtains 2 plants of suppression apples from separation screening on the branches of fruit trees in Shanxi Province apple producing region Linfen apple orchard
Rotten pathogenic bacteria preferable bacterial strain LF17, LF18 are set, is reflected through bacterial strain colony characteristicses, bacterial strain microscopic features and 16SrDNA sequence analyses
It is set to bacillus subtilis (B.subtilis), the bacterial strain is stored in Inst. of Plant Protection, Shanxi Prov. Academy of Agricaultural Sciences's strain
Storehouse, bacillus subtilis LF17 preserving number is NO：SAASIPPLF17；Bacillus subtilis LF18 preserving number is NO：
SAASIPPLF18
To achieve the above object, the technical scheme taken of the present invention is：
A kind of preparation method for the biological and ecological methods to prevent plant disease, pests, and erosion fermented liquid for preventing and treating apple tree canker, comprises the following steps：
S1, culture medium preparation：
NA culture mediums：Weigh yeast extract 10.0g, beef extract 15.0g, MgSO4·7H2O 0.5g, FeSO4·7H2O
After 0.009g, agar powder 8.5g, glucose 30g mixing, measured with acidity, plus NaOH or HCl adjusts pH to 6.5, add water constant volume
To 1L, it is sub-packed in 250mL triangular flasks, bottling amount is 80mL, 121 DEG C of high pressure steam sterilization 20min；
NB culture mediums：Weigh yeast extract 10.0g, beef extract 15.0g, MgSO4·7H2O 0.5g, FeSO4·7H2O
After 0.009g, glucose 30g mixing, measured with acidity, plus NaOH or HCl adjusts pH to 6.5, adds water and is settled to 1L, is sub-packed in
In 250mL triangular flasks, bottling amount is 80mL, 121 DEG C of high pressure steam sterilization 20min；
S2, antagonistic strain activation：
By bacterial strain LF17, LF18 inoculation on NA culture mediums, 25 DEG C of incubated 2d, wherein, bacillus subtilis
Bacterium LF17 preserving number is NO：SAASIPPLF17；Bacillus subtilis LF18 preserving number is NO：SAASIPPLF18；
S3, antagonistic strain Liquid Culture：
Bacterial strain LF17, the LF18 activated in picking step S2 is inoculated in the NB culture mediums that bottling amount is 80mL/250mL；
150r·min-1, 25 DEG C of constant-temperature shaking culture 5d obtain zymotic fluid.
S4, filtering and concentrating zymotic fluid：
The zymotic fluid that will be prepared in step S3, after being filtered through filter paper, is concentrated as 1.5 times of original fermentation liquor concentration and 3.0 times
Original fermentation liquor concentration concentrated broth, save backup under the conditions of 4 DEG C；
S5, antagonism fermented liquid field control medicament preparation：
By the concentrated broth of 1.5 times of original fermentation liquor concentration obtained by step S4 and Benzylpenicillin sodium salt 0.001gmL-1, it is molten
The Tween 80 that mineral oil that liquid quality is 3%-5%, solution quality are 2%-3% is mixed evenly, and bottles standby；
S6, antagonism fermented liquid paste field control medicament preparation：
By the concentrated broth of 1.5 times of original fermentation liquor concentration obtained by step S4 and Benzylpenicillin sodium salt 0.001gmL-1, it is molten
The xanthans mixing that Tween 80 that mineral oil that liquid quality is 3%-5%, solution quality are 2%-3%, solution quality are 0.5%
Stir and paste is made, bottle standby.
The application method of above-mentioned gained antagonism fermented liquid field control medicament is：
Dormant stage of fruit tree carries out field control experiment, extends at 0.5cm and to be cut with knife as deep as wooden around the sick scar of apple tree
The guard circle in portion, then thoroughly strikes off the sick skin and strong skin in circle, makes shape of wound lengthwise, horizontal stroke narrow as far as possible, and periphery is round and smooth,
The diseased tissues wiped off, which is concentrated, burns；
Strike off after diseased tissues, apply the good zymotic fluid pesticide control of a small amount of above-mentioned configuration in exposed xylem, wait 2-3
Minute, after after medicament infiltration, the scab brown stain tissue of xylem residual is struck off with knife, until brown stain tissue has been scraped completely.Scraping
The good zymotic fluid pesticide control of above-mentioned configuration is smeared at good scab, makes medicament that the sick extension 1.5cm of scab is completely covered, after processing
1 zymotic fluid paste (xanthans) or zymotic fluid are applied after 10 days again (containing compositions such as bleeding agents).
The invention has the advantages that：
1), bacillus subtilis (B.subtilis) bacterial strain LF17, LF18 zymotic fluid of the present invention is to apple rot pathogen
There is significant inhibitory action, cause that rotten pathogenic bacteria mycelia color is substantially deepened, top is significantly expanded, substantially deformity, mycelia thickness
Mycelia branch that is uneven, having increases, the extravasation of part hyphal cell matter.The research of embodiment shows that zymotic fluid is rotten to apple tree
The suppression of rotten germ can reach 99.9%, and fungistatic effect is higher than chemical agent methyl sulfur bacterium (94.2%), Difenoconazole
(81.3%).In indoor Apple in Vitro branch controlling experiment, zymotic fluid is 80.04% to the preventive effect of apple tree canker, with change
Learn medicament Difenoconazole, thiophanate-methyl preventive effect suitable.
2), the present invention is mixed in proportion with Benzylpenicillin sodium salt by zymotic fluid, improves the stability of zymotic fluid pesticide control.It is real
Test research to show, contain 0.001gmL-1Benzylpenicillin sodium salt PDA culture medium reaches to the inhibiting rate of apple rot pathogen
78.6%, containing 0.001gmL-1On the fermentation liquid culture medium of Benzylpenicillin sodium salt, the inhibiting rate of apple rot pathogen is reached
96%.The present invention improves stability, prevention effect of the zymotic fluid in field by the way that zymotic fluid is mixed with both Benzylpenicillin sodium salts
Significantly improve, improved from 71.76% (zymotic fluid stoste) to 80.04% (zymotic fluid is containing materials such as penicillin).
3), the present invention is mixed in proportion with Benzylpenicillin sodium salt by antagonism fermented liquid, while adding the things such as mineral oil, tween
Matter, improves the permeability of zymotic fluid, makes it effectively to penetrate into bark, suppresses pathogen, improves preventive effect.Embodiment
Research shows, zymotic fluid, Benzylpenicillin sodium salt, mineral oil, tween are mixed in proportion, can be sick with effectively preventing and treating apple-tree rot,
Cure rate about 80%, wound healing mean breadth is 9.46cm2, scab recurrence rate is 4.21%.
4), the present invention is a kind of environment-friendly and efficiently anti-based on bacillus subtilis fermentation liquor and Benzylpenicillin sodium salt
Control method.The research of embodiment shows that bacillus subtilis fermentation liquor has facilitation to wound healing, and wound healing is fast, more
Conjunction injured tissue is generous, sick scar recurrence rate is low.Report in bacillus subtilis fermentation liquor containing production auxin, gibberellin, cell
The materials such as mitogen, and plant growth can be promoted.Containing the thing for promoting fruit tree wound healing in bacterial strain LF17, LF18 zymotic fluid
Matter, wound xylem is completely enclosed by callus, can effectively prevent rotten palindromia.
5), the present invention is based on antagonism fermented liquid, by zymotic fluid, Benzylpenicillin sodium salt, mineral oil, tween, xanthans etc.
Material is mixed in proportion, prepares 2 kinds of formulations of paste and aqua.In dormant stage of fruit tree, scab and smearing Antagonistic Fungi are controlled with reference to scraping
2 kinds of methods of zymotic fluid, can effectively prevent and treat rot.
6), bacillus subtilis (B.subtilis) bacterial strain LF17, LF18 zymotic fluid prevention effect provided by the present invention
It is stable, environment-friendly, simple production process, low production cost.
Brief description of the drawings
Fig. 1 is the phylogenetic tree of bacterial strain LF17, LF18 in the embodiment of the present invention.
Embodiment
In order that objects and advantages of the present invention are more clearly understood, the present invention is carried out with reference to embodiments further
Describe in detail.It should be appreciated that the specific embodiments described herein are merely illustrative of the present invention, it is not used to limit this hair
It is bright.
Embodiment 1
Screen apple rot pathogen Antagonistic Fungi
In the Yuncheng of Shanxi Province the major apple production area, Linfen apple garden collect specimen, it is separated to from apple tree bark
12 plants of antagonistic bacteriums, primary dcreening operation is carried out using traditional flat board opposite culture method, and screening obtains the preferable Antagonistic Fungi of antagonistic effect.Again
Obtained primary dcreening operation bacterial strain is subjected to liquid fermentation in NB culture mediums, secondary screening is carried out using ferment filtrate, finally obtains to apple
Tree rotten pathogenic bacteria has bacterial strain LF17, LF18 (being shown in Table 1) of notable antagonism.
The antagonism fermented liquid of table 1 is to rotten pathogenic bacteria inhibition
The identification of apple tree rotten pathogenic bacteria Antagonistic Fungi
Morphological feature：LF17, LF18 bacterial strain bacterium colony on NA culture mediums are irregular, initial stage is white, the later stage be yellowish-brown, in
Centre slightly projection, opaque, microscopy are shaft-like.
16S rDNA sequence analyses：Bacterial genomes DNA is extracted, it is general with bacterial 16 S rDNA
Primer 2 7F (5`AGAGTTTGATCATGGCTCAG3`) and
1492R (5`GGTTACCTTGTTACGACTT3`) enters performing PCR amplification to DNA profiling.Pcr amplification product is through cutting glue
After recovery, sequencing is carried out.Gained sequence is compared in using ncbi database and homologous sequence is downloaded, then used
The software building such as BLAST, PAPU phylogenetic tree (Fig. 1).
Analyzed with reference to colonial morphology feature, phylogenetic tree, specify bacterial strain LF17, LF18 for bacillus bacillus subtilis
(B.subtilis)。
Embodiment 2
Prepare antagonism fermented liquid
The Antagonistic Fungi that activation screening is obtained：Bacterial strain LF17, LF18 will first be preserved to be seeded on NA culture mediums, 25 DEG C of constant temperature trainings
Support 2d.
Bacterial strain LF17, LF18 of picking activation, are inoculated in the NB culture mediums that bottling amount is 80mL/250mL；150r·min-1, 25 DEG C of constant-temperature shaking culture 5d, obtain bacillus subtilis fermentation liquor.
Filtering fermentating liquid：Zymotic fluid prepared by previous step, filter paper filtering, obtains zymotic fluid stoste.
Zymotic fluid stoste is concentrated
Collect the zymotic fluid concentration prepared in previous step, respectively concentration for 1.5 times original fermentation liquor concentration, 3.0 times
Original fermentation liquor concentration, is saved backup under the conditions of 4 DEG C.
Embodiment 3
Antagonism fermented liquid suppresses apple rot pathogen experiment
Fluoxastrobin, octyl trichlamide, Difenoconazole, 4 kinds of active compounds of thiophanate-methyl are made into 1000 μ g/mL mother liquors with acetone,
Mother liquor is stored in standby in 4 DEG C of refrigerators.Series concentration is diluted to sterilized water respectively when using.In an aseptic environment, it will prepare
Good series concentration is mixed with being cooled to 40 DEG C or so of PDA culture medium in 1: 9 ratio and fully shaken up, and is made containing 4 kinds of active compounds
PDA plate.
The ferment filtrate of preparation is concentrated, is 1.5 times of original fermentation liquor concentration, 3.0 times of original fermentation liquor concentration, addition
8.5g/L agar powders, mixing shakes up, 121 DEG C of high pressure steam sterilization 20min.It is eventually fabricated the flat board containing zymotic fluid.
The strain of preservation is connected in 90mm culture dishes in PDA trainings base, 28 DEG C of incubators and cultivates 3d, in bacterium colony from culture dish side
At edge 10mm bacteria cake is beaten with 5mm sterilization punchers.By pure culture biscuits involvng inoculation in containing Fluoxastrobin, octyl trichlamide, Difenoconazole, methyl sulfur bacterium
In spirit, the PDA plate of zymotic fluid, each processing is repeated 3 times, and is placed in 25 DEG C of constant incubator culture 3d, observation, record.Using
Crossing method measures colony diameter, each 3 repetitions of processing.Measurement diameter is compared with control group, obtains what is each handled
Bacteriostasis rate.
Experiment shows：Zymotic fluid (stoste), fermentation concentrated liquor bacteriostasis rate are more than 93.8%, as concentration increases, hair
The bacteriostasis rate increase (table 1) of zymotic fluid.
Zymotic fluid of the present invention is compared with Fluoxastrobin, octyl trichlamide, Difenoconazole, 4 kinds of medicaments of thiophanate-methyl, bacteriostasis
Significantly, bacteriostasis rate is more than 93%, and as zymotic fluid concentration is raised, bacteriostasis rate is improved.Zymotic fluid and thiophanate-methyl of the present invention
Bacteriostasis is compared, and bacteriostasis rate is quite (table 1).The fermentation concentrated liquor of 1.5 times of original content and 3.0 times of fermentation of original content
Concentrated liquor bacteriostasis is suitable；To be cost-effective, original content is selected during subsequent fermentation liquid field control medicament configuration
1.5 times of fermentation concentrated liquor.
In addition, zymotic fluid of the present invention is after 121 DEG C of high pressure steam sterilization 20min, bacteriostatic activity is not lost.
Embodiment 4
Antagonistic Fungi is to apple rot pathogen inhibitory action
The influence of bacterial strain LF17, LF18 to rotten pathogenic bacteria hypha form：Control group rotten pathogenic bacteria colony colour is white；Disease
Bacterium mycelia even thickness, branch are less, and top mycelial growth is straight and thin.
After rotten pathogenic bacteria bacterial strain and Antagonistic Fungi LF17, LF18 bacterial strain opposite culture 3-5d, pathogen colony colour is changed into deep
Brown；Mycelia color is substantially deepened, top is significantly expanded, substantially deformity, mycelia thickness is uneven, the mycelia branch that has increases,
Part hyphal cell matter extravasation.
Embodiment 5
Prevention effect of the antagonism fermented liquid to Apple in Vitro branch rot
Gather apple tree back branch 1-2 and give birth to branch.Remove blade, length for 100-120cm as inoculation material.Choose
The apple branch being collected, is rinsed 2 times, 75% alcohol rinse 1 time, aseptic water washing 1 time with running water.By the branch rinsed
It is positioned in the pallet of sterilization, scalds mouth on branch with the diameter 5mm head of a nail, wound is at a distance of 10cm.
The 5mm pure culture biscuits involvng inoculations of preparation are scalded into position in branch, each branch scalds 5 wounds, 4 connect bacterium, 1 is done pair
According to.Parcel uses sterile white Hupeh anemone root and leaf at 2cm above inoculum, finally scalds position with preservative film wrapping.
Finally by the apple branch cuttage after inoculation in the flowerpot equipped with fine sand, culturing room's moisturizing culture will be positioned over,
25 DEG C of temperature, relative humidity 35%-40%, holding sand moistening of watering daily.Start Spot expansion after morbidity, 5d after inoculation 3d
Come.
The antibacterial examination of isolated shoot rotten pathogenic bacteria is carried out after after wound extension, selecting the branch that Spot expansion length is 1.0cm
Test.With pocket knife in scab groove, xylem is deep to.It is crisscross, distance about 0.5cm.Wound has been carved after line, applied at scab
Zymotic fluid stoste, Fluoxastrobin, octyl trichlamide, 4 kinds of medicaments of Difenoconazole (manufacturer's recommended dosage) are smeared, sterilized water are smeared as right
According to.Spot expansion degree, measurement Lesion size are observed after 15d, prevention effect is calculated.
Suppress experiment in vitro apple tree branch rotten pathogenic bacteria by different agents to show, Antagonistic Fungi LF17, LF18 are to hair
Zymotic fluid stoste, zymotic fluid paste (xanthans), zymotic fluid (containing compositions such as bleeding agents) have good inhibiting effect to rot, prevent
Effect is more than 70% (table 2).The materials such as Benzylpenicillin sodium salt, mineral oil, tween, xanthans are added in zymotic fluid and are favorably improved hair
The bacteriostasis of zymotic fluid.Mineral oil, tween, which belong to, contributes to antagonism fermented liquid to penetrate under bark, is effectively connect with pathogen
Touch, so as to reach bacteriostasis.Xanthans serve emulsification, stably, gel thickening etc., make zymotic fluid formation paste be not easy steaming
The advantages of hair, rain-out, volatilization.
The different agents of table 2 are to apple tree isolated shoot rotten pathogenic bacteria inhibition
Embodiment 6
Field control of the antagonism fermented liquid to apple tree canker
By the zymotic fluid stoste of gained, concentrated broth (1.5 times of original fermentation liquor concentration) and Benzylpenicillin sodium salt 0.001g
mL-1, solution quality 3%-5% mineral oil, solution quality be that 2%-3% Tween 80s, 0.5% xanthans stir and cream are made
Agent, bottles standby.
Dormant stage of fruit tree carries out field control experiment, extends at 0.5cm and to be cut with knife as deep as wooden around the sick scar of apple tree
The guard circle in portion, then thoroughly strikes off the sick skin and strong skin in circle, makes shape of wound lengthwise, horizontal stroke narrow as far as possible, and periphery is round and smooth.
The diseased tissues wiped off, which is concentrated, burns.
Strike off after diseased tissues, apply the good zymotic fluid pesticide control of a small amount of above-mentioned configuration in exposed xylem, wait 2-3
Minute, after after medicament infiltration, the scab brown stain tissue of xylem residual is struck off with knife, until brown stain tissue has been scraped completely.Scraping
The good zymotic fluid pesticide control of above-mentioned configuration is smeared at good scab, is that the sick extension 1.5cm of scab is completely covered in medicament, after processing
Every 10 days, then apply 2 zymotic fluid paste (xanthans) or zymotic fluid (containing compositions such as bleeding agents).Using Fluoxastrobin, octyl trichlamide,
4 kinds of medicaments of Difenoconazole (manufacturer's recommended dosage) smear sterilized water and are used as control as processing.Each cell, each processing
20 sick scars.Dormant stage of fruit tree carries out field control experiment, and wound healing area is measured after 30 days.
Apple tree canker field controling test is shown by different agents, Antagonistic Fungi LF17, LF18 zymotic fluid stoste,
Zymotic fluid paste (xanthans), zymotic fluid (containing compositions such as bleeding agents) have facilitation, wound healing to apple tree wound healing
Area is 9.46cm2, it is significantly higher than other contrast agents (table 3).Antagonistic Fungi LF17, LF18 belong to bacillus subtilis, have reported
Containing materials such as production auxin, gibberellin, the basic elements of cell division in road bacillus subtilis fermentation liquor, and plant growth can be promoted.
Containing that can promote the material of fruit tree wound healing in zymotic fluid, wound xylem is completely enclosed by callus, can effectively be prevented
Rotten palindromia.Therefore, in dormant stage of fruit tree, the method controlled with reference to daubing medicament is scraped using wound, corruption can be effectively prevented and treated
Rotten disease.
The different agents of table 3 are to apple tree canker field control effect
| Medicament | Heal area (cm2) | Sick scar recurrence rate (%) |
| Sterilized water (CK) | 3.56d | 88.91c |
| Pyraclostrobin | 4.96c | 27.92b |
| Octyl trichlamide | 6.38b | 21.31b |
| Difenoconazole | 5.26c | 17.96b |
| Thiophanate-methyl | 6.63b | 8.83a |
| Zymotic fluid paste | 9.79a | 4.56a |
| Zymotic fluid (stoste) | 9.23a | 4.26a |
| Zymotic fluid (aqua) | 9.37a | 3.82a |
Described above is only the preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art
For member, under the premise without departing from the principles of the invention, some improvements and modifications can also be made, these improvements and modifications also should
It is considered as protection scope of the present invention.
Claims (2)
1. a kind of preparation method for the biological and ecological methods to prevent plant disease, pests, and erosion fermented liquid for preventing and treating apple tree canker, it is characterised in that comprise the following steps：
S1, culture medium preparation：
NA culture mediums：Weigh yeast extract 10.0g, beef extract 15.0g, MgSO4·7H2O 0.5g, FeSO4·7H2O
After 0.009g, agar powder 8.5g, glucose 30g mixing, measured with acidity, plus NaOH or HCl adjusts pH to 6.5, add water constant volume
To 1L, it is sub-packed in 250mL triangular flasks, bottling amount is 80mL, 121 DEG C of high pressure steam sterilization 20min；
NB culture mediums：Weigh yeast extract 10.0g, beef extract 15.0g, MgSO4·7H2O 0.5g, FeSO4-7H2O
After 0.009g, glucose 30g mixing, measured with acidity, plus NaOH or HCl adjusts pH to 6.5, adds water and is settled to 1L, is sub-packed in
In 250mL triangular flasks, bottling amount is 80mL, 121 DEG C of high pressure steam sterilization 20min；
S2, antagonistic strain activation：
By bacterial strain LF17, LF18 inoculation on NA culture mediums, 25 DEG C of incubated 2d, wherein, bacillus subtilis
LF17 preserving number is NO：SAASIPPLF17；Bacillus subtilis LF18 preserving number is NO：SAASIPPLF18；
S3, antagonistic strain Liquid Culture：
Bacterial strain LF17, the LF18 activated in picking step S2 is inoculated in the NB culture mediums that bottling amount is 80mL/250mL；150r·
min-1, 25 DEG C of constant-temperature shaking culture 5d obtain zymotic fluid；
S4, filtering and concentrating zymotic fluid
The zymotic fluid that will be prepared in step S3, after being filtered through filter paper, is concentrated as 1.5 times of original fermentation liquor concentration and 3.0 times of original
The concentrated broth of zymotic fluid concentration, is saved backup under the conditions of 4 DEG C；
S5, antagonism fermented liquid field control medicament preparation
By the concentrated broth of 1.5 times of original fermentation liquor concentration obtained by step S4 and Benzylpenicillin sodium salt 0.001gmL-1, solution matter
The Tween 80 that mineral oil that amount is 3%-5%, solution quality are 2%-3% is mixed evenly, and bottles standby；
S6, antagonism fermented liquid paste field control medicament preparation
By the concentrated broth of 1.5 times of original fermentation liquor concentration obtained by step S4 and Benzylpenicillin sodium salt 0.001gmL-1, solution matter
The xanthans that Tween 80 that mineral oil that amount is 3%-5%, solution quality are 2%-3%, solution quality are 0.5% is mixed
It is uniform that paste is made, bottle standby.
2. the antagonism fermented liquid field control medicament and antagonism fermented liquid paste field control medicament obtained by claim 1 should
With, it is characterised in that comprise the following steps：
Dormant stage of fruit tree carries out field control experiment, extends at 0.5cm and to be cut with knife as deep as xylem around the sick scar of apple tree
Guard circle, then thoroughly strikes off the sick skin and strong skin in circle, makes shape of wound lengthwise, horizontal stroke narrow, and periphery is round and smooth, the disease wiped off
Burnt in set of organizations；
Strike off after diseased tissues, the good antagonism fermented liquid pesticide control of above-mentioned configuration, 2-3 minutes are applied in exposed xylem
Afterwards, after after medicament infiltration, the scab brown stain tissue of xylem residual is struck off with knife, until brown stain tissue has been scraped completely；Scraping
Scab at smear the good antagonism fermented liquid pesticide control of above-mentioned configuration, make medicament that the sick extension 1.5cm of scab, place is completely covered
Apply 1 antagonism fermented liquid paste field control medicament or zymotic fluid pesticide control after reason after 10 days again.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510794468.7A CN105284902B (en) | 2015-11-16 | 2015-11-16 | A kind of preparation method for the biological and ecological methods to prevent plant disease, pests, and erosion fermented liquid for preventing and treating apple tree canker |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510794468.7A CN105284902B (en) | 2015-11-16 | 2015-11-16 | A kind of preparation method for the biological and ecological methods to prevent plant disease, pests, and erosion fermented liquid for preventing and treating apple tree canker |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105284902A CN105284902A (en) | 2016-02-03 |
| CN105284902B true CN105284902B (en) | 2017-10-27 |
Family
ID=55183416
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510794468.7A Active CN105284902B (en) | 2015-11-16 | 2015-11-16 | A kind of preparation method for the biological and ecological methods to prevent plant disease, pests, and erosion fermented liquid for preventing and treating apple tree canker |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105284902B (en) |
Families Citing this family (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106031349B (en) * | 2015-03-18 | 2019-03-12 | 李保华 | The method that a set of evaluation and test fungicide roots out effect to limb surface layer rotten pathogenic bacteria |
| CN108218549A (en) * | 2016-12-22 | 2018-06-29 | 天津绿格瑞科技发展有限公司 | A kind of drug for being used to prevent pear tree yellowtop |
| CN108208012A (en) * | 2016-12-22 | 2018-06-29 | 天津绿格瑞科技发展有限公司 | A kind of drug and its application method for being used to treat Chlorotic disorder of peach tree |
| CN108208013A (en) * | 2016-12-22 | 2018-06-29 | 天津绿格瑞科技发展有限公司 | A kind of drug and its application method for being used to treat fruit tree yellowtop |
| CN108218550A (en) * | 2016-12-22 | 2018-06-29 | 天津西青区瑞博生物科技有限公司 | A kind of drug for being used to prevent apple tree canker, yellowtop |
| CN109161479A (en) * | 2018-08-15 | 2019-01-08 | 延安大学 | A kind of drug and preparation method thereof for preventing and treating apple tree canker |
| CN111197016A (en) * | 2020-01-10 | 2020-05-26 | 渭南职业技术学院 | Screening method of kiwifruit canker antagonistic strain |
| CN111887056B (en) * | 2020-06-30 | 2022-11-01 | 阿克苏优能农业科技股份有限公司 | Sugar core promoting and insect pest preventing apple tree regulating agent and application |
| CN112625966A (en) * | 2020-12-30 | 2021-04-09 | 天津开发区坤禾生物技术有限公司 | Microbial fertilizer for effectively preventing and treating pear tree rot and prevention and treatment method |
| CN113755345A (en) * | 2021-10-13 | 2021-12-07 | 中国农业科学院郑州果树研究所 | Method for preventing and treating rot by using endophyte |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1350541A (en) * | 1999-04-08 | 2002-05-22 | 佐佐木康晴 | Plant activator, process for producing the same, actwation method, activity promoter and method for applying the promoter |
| EP2427062A2 (en) * | 2009-05-06 | 2012-03-14 | Basf Se | A method for increasing the vigor and/or crop yield of agricultural plants under essentially non-existent pathogen pressure |
-
2015
- 2015-11-16 CN CN201510794468.7A patent/CN105284902B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1350541A (en) * | 1999-04-08 | 2002-05-22 | 佐佐木康晴 | Plant activator, process for producing the same, actwation method, activity promoter and method for applying the promoter |
| EP2427062A2 (en) * | 2009-05-06 | 2012-03-14 | Basf Se | A method for increasing the vigor and/or crop yield of agricultural plants under essentially non-existent pathogen pressure |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105284902A (en) | 2016-02-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105284902B (en) | A kind of preparation method for the biological and ecological methods to prevent plant disease, pests, and erosion fermented liquid for preventing and treating apple tree canker | |
| CN103621621B (en) | Compound biological preservative and application method thereof | |
| CN106615085A (en) | Microorganism and plant derived composite fresh keeping agent for fruits and vegetables | |
| CN101967455B (en) | Bacillus amyloliquefaciens EA19 for controlling wheat root diseases and preparation thereof | |
| CN106867934B (en) | One plant of Siam bacillus and its application in prevention and treatment plant powdery mildew | |
| CN104694397A (en) | Chaetomium globosum and application thereof | |
| CN106282067B (en) | Multifunctional agricultural complex micro organism fungicide and probiotics and application | |
| CN106942301B (en) | A kind of botanical pesticide preparation of prevention and control rice blast and preparation method thereof | |
| CN101946805A (en) | Biological prevention and control bacterial agent | |
| CN104630075A (en) | Beauveria bassiana with high pathogenicity to anoplophora chinensis larva and applications thereof | |
| CN106942279A (en) | A kind of apple tree canker biocontrol agent and its application | |
| CN112322560A (en) | Bacillus belgii and application thereof in prevention and control of pear diseases | |
| CN103518750A (en) | High-efficiency compound biological bactericide and application thereof | |
| CN105176831A (en) | Penicillum oxalicum, and applications thereof | |
| CN106070576A (en) | The method of postharvest diseases of fruit and preparation used is suppressed by induction of resistance | |
| CN104531543B (en) | Grey green soy bean endogenetic fungus TPL25 and its application in controlling plant diseases | |
| CN104560735B (en) | Grey green soy bean endogenetic fungus TPL35 and its application in controlling plant diseases | |
| CN102994419A (en) | Bacillus pumilus LNXM12 and application thereof | |
| CN100539854C (en) | The fruit and vegetable preserving antistaling agent that contains recombinant chitinase | |
| CN105385606A (en) | Penicillium griseofulvum for preventing and treating fungal disease and application thereof | |
| CN106615071B (en) | Application of pterostilbene in prevention and treatment of grape gray mold and downy mildew of litchi | |
| CN102648713B (en) | Technology for improving biological disease-prevention activity of trichoderma preparation by utilizing fungi activator protein | |
| CN102626091B (en) | Application of isothiazolinone compounds in control of gray mold and sclerotinia rot of cucumber | |
| Hamza et al. | New trends for biological and non-biological control of tomato root rot, caused by Fusarium solani, under greenhouse conditions. | |
| CN106906171A (en) | A kind of preparation method of apple tree canker biocontrol agent |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |