CN104560735B - Grey green soy bean endogenetic fungus TPL35 and its application in controlling plant diseases - Google Patents
Grey green soy bean endogenetic fungus TPL35 and its application in controlling plant diseases Download PDFInfo
- Publication number
- CN104560735B CN104560735B CN201510006884.6A CN201510006884A CN104560735B CN 104560735 B CN104560735 B CN 104560735B CN 201510006884 A CN201510006884 A CN 201510006884A CN 104560735 B CN104560735 B CN 104560735B
- Authority
- CN
- China
- Prior art keywords
- extract
- tpl35
- aspergillus oryzae
- soy bean
- endogenetic fungus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/145—Fungal isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
- C12R2001/66—Aspergillus
- C12R2001/69—Aspergillus oryzae
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/30—Microbial fungi; Substances produced thereby or obtained therefrom
Abstract
The invention discloses one plant of grey green soy bean（Tephrosia purpurea）Endogenetic fungus aspergillus oryzae（Aspergillus oryzae）TPL35, it is preserved in China typical culture collection center, deposit number CCTCC NO：M 2014608, and application of its tunning in anti-plant pathogenic fungi.Fermented liquid and fermentation broth extract and hypha extract of the present invention to sclerotinia sclerotiorum Yan Cao the phytopathogen such as shin disease there is stronger mycelial growth inhibitory action, excellent bacterial strain is provided for the exploitation of microbial pesticide, the present invention is the research first in terms of grey green soy bean endogenetic fungus in addition.
Description
Technical field
The invention belongs to microbial technology field, is related to a kind of aspergillus oryzae（Aspergillus oryzae）TPL35 and its
Application in controlling plant diseases.
Background technology
Grey green soy bean（Tephrosia purpurea）It is pulse family（Leguminosae）Tephrosia（Tephrosia Pers.）Perennial woody plant, be distributed mainly on tropical and subtropical region, as India, Pakistan, Vietnam, Cambodia,
The ground such as Laos, the Guangdong of Burma and China, Guangxi, Yunnan, Fujian and Hunan.Grey green soy bean branches and leaves can make green manure, mash throwing water
In can malicious fish, and good solid sand and embankment soil-keeping plants.The research to grey green soy bean is concentrated mainly on Phytochemistry at this stage
In terms of pharmacology, also it is rarely reported in terms of endogenetic fungus.
One of an important factor for plant disease is always restriction crops good quality and high output, and in plant disease, 70%-
80% disease is infected by disease fungus to be triggered.Fungal diseases of plants not only directly contributes crop yield decline and product
Matter reduces, and fraction of pathogens fungi is during infection crops, can secrete produce a variety of toxin that people and animals are harmful to
Metabolin, great threat is formed to the security of agricultural product.
Chemical prevention is to control the effective ways of corps diseases, but chemical pesticide pollution environment, induction germ produce anti-
The property of medicine, the ecological balance is destroyed, the problems such as causing residual hazard is also following, and therefore, the biological control research of plant disease is increasingly
It is taken seriously.And one of the means of endogenetic fungus as biological control, have that fermentation costs are cheap, technological means is simple, is not easy
The features such as allowing pathogen to develop immunity to drugs, potentiality are very huge.Because antibacterial substance has very in research endogenetic fungus
Important theory significance and application prospect, endogenetic fungus generally existing antibacterial activity in addition, so entering in this respect in recent years
Exhibition is very rapid.
The content of the invention
The technical problems to be solved by the invention are：One plant of endogenetic fungus aspergillus oryzae for being isolated from grey green soy bean blade is provided
（Aspergillus oryzae）TPL35, the zymotic fluid and fermentation broth extract and mycelia extract of the bacterial strain are all to rape
The pathogens such as sclerotium bacteria have higher biological and ecological methods to prevent plant disease, pests, and erosion activity, therefore it is true to be applied to corresponding cause of disease using TPL35 as biocontrol microorganisms
In microbial plant disease, it can also continue with the endogenetic fungus resource and obtain natural active matter, be biogenic pesticide
Exploitation provides foundation.
Technical scheme provided by the invention is：One plant of grey green soy bean（Tephrosia purpurea）Endogenetic fungus aspergillus oryzae
（Aspergillus oryzae）TPL35, it was preserved in China typical culture collection center on November 27th, 2014（Ground
Location：China, Wuhan, Wuhan University）, deposit number CCTCC NO：M 2014608, survives after testing.
Grey green soy bean of the present invention（Tephrosia purpurea）Endogenetic fungus system is big from Chinese Hunan Province's Agriculture in Hunan
In grey green soy bean plant living body in school garden, through separating, cultivating, fermenting and the step such as active testing is obtained and preserved.
Aspergillus oryzae TPL35 solid culture is characterized as：In PDA culture medium, 28 DEG C are incubated, and bacterium colony is just white,
Later stage is changed into faint yellow or white, dense fine granularity spore ball.Microscope morphological feature：Conidium is colourless, in oval.
Aspergillus oryzae TPL35 molecular biological characteristics：Using round pcr, determined dna sequence analysis, TPL35 bacterial strains
ITSrDNA genomes are by 597 base compositions.In American National Biotechnology Information center（NCBI）Carry out sequence analysis point
Analyse and phylogenetic tree construction, display bacterial strain withAspergillus oryzaeGU120193.1 gathers on one, and sequence is similar
Property is 99%, it may be determined that the bacterial strain is aspergillus oryzae.
The specific preparation manipulation step of the grey green soy bean endogenetic fungus anti-plant pathogenic fungi zymotic fluid of the present invention is as follows：
（1）The activation of strain.The endogenetic fungus TPL35 for being stored in inclined-plane is transferred with transfer needle and put down in the PDA that sterilized
On plate, 28 DEG C incubated 4-5 days, obtains activated spawn.
（2）Fermented and cultured.At purified endogenetic fungus TPL35 PDA plates edge, broken into directly with sterile card punch
Footpath 6mm bacteria cake, 2 ferfas cakes of inoculation are in the 250mL conical flasks equipped with 100mLPDB, at 28 DEG C ± 1 DEG C,
200r·min-1Concussion and cultivate 6-7 days on shaking table, that is, obtain gray wool beans endogenetic fungus TPL35 zymotic fluid.Crossed and filtered out with filter paper
Mycelium is removed, bacterium solution obtains the fermentation of gray wool beans endogenetic fungus TPL35 disease-resistant fungal pathogens after 0.22um syringe-driven filters
Liquid.
Culture medium needed for fermentation：Potato dextrose broth（PDB）, specific practice is：Weigh fresh potato
200 grams, peeling is cut into pieces, adds ultra-pure water to boil 30 minutes, four layers of filtered through gauze, and filtrate adds 20 grams of mixings of glucose, adds
Water is settled to 1 liter, and pH is natural.121 DEG C, sterilizing in 35 minutes is standby.Solid medium needed for activated spawn：Add in above-mentioned culture medium
Enter 20 grams of agar, i.e. PDA culture medium.
The phytopathogenic fungi includes：Sclerotinia sclerotiorum, Rhizoctonia solani, Botrytis cinerea bacterium, cucumber phytophthora, tobacco
shin bacterium, citrus anthrax-bacilus.Above-mentioned plant pathogenic fungi uses PDA culture medium culture.
Primary dcreening operation is carried out using flat board face-off method, endogenetic fungal bacterial strain TPL35 and disease fungus are used into beating for 6mm respectively
Bacteria cake is made in hole device, is respectively placed at the 1/3 of PDA flat boards, is cultivated at 28 DEG C, observes endophytic bacterial controlled effect and for examination disease fungus
Whether antagonism is had.
Bacterial strain TPL35 zymotic fluids suppress to determine to pathogen mycelial growth.The without fermented liquid of measured amounts (use by control
Blank run liquid) mixed with the PDA culture medium (40-50 DEG C, the volume ratio of without fermented liquid and culture medium be 1 ︰ 9) under melting state
, plate (per ware about 10mL) is down flat, to be solidified to be followed by plant pathogenic fungi (bacteria cake diameter 6mm), processing, control are respectively repeated 3 times.
It is placed in 28 ± 1 DEG C of incubators after cultivating 3-5 days, measures pathogen fungus colony diameter with crossing method, count according to the following formula
Calculate inhibiting rate.
Mycelial growth inhibition rate (℅)=(control colony diameter-processing colony diameter)/(control colony diameter -6) ×
100
Measurement result shows：Aspergillus oryzae TPL35 zymotic fluid has antibacterial well to Sclerotinia sclerotiorum and the black shin bacterium of tobacco
Activity, bacteriostasis rate is respectively 84.26% and 60.29%, all more than 50%.The metabolite can be applied to fungal diseases of plants
Preventing and treating, new approach is added for the exploitation of disinfectant use in agriculture.
The determination of activity of bacterial strain TPL35 fermentation broth extracts and hypha extract to disease fungus.With 8 layers of gauze by bacterium
Filament and separation of fermentative broth, zymotic fluid with isometric petroleum ether, ethyl acetate, extracting n-butyl alcohol 2-4 times, are concentrated to give respectively
To each extract layer medicinal extract, mycelia is extracted 2-4 times with 100 mL methanol, is concentrated under reduced pressure as hypha extract.Again with filter paper
Method determines the activity of each extracts of TPL35.As a result show：Bacterial strain TPL35 active metabolite is concentrated mainly on zymotic fluid second
Acetoacetic ester extract layer, especially there is obvious inhibitory action to Sclerotinia sclerotiorum.
Meanwhile the present invention also provides the grey green soy bean endogenetic fungus aspergillus oryzae TPL35 caused by plant pathogenic fungi is prevented and treated
Application in plant disease, it is applied using the zymotic fluid, fermentation broth extract or hypha extract of the fungi.
Described plant disease be sclerotinia sclerotiorum, Yan Cao shin disease.
The present invention also provides a kind of disinfectant use in agriculture, and it includes described zymotic fluid, or its fermentation broth extract, or its bacterium
Filament extract.
The bactericide, the fermentation broth extract are respectively with isometric petroleum ether, ethyl acetate, extracting n-butyl alcohol
2-4 times, it is concentrated to give each extract layer medicinal extract；The hypha extract is extracted 2-4 times with methanol, is concentrated under reduced pressure i.e.
For hypha extract.
Advantages of the present invention：Endogenetic fungus is separated from grey green soy bean first, and obtains active bacterial strain aspergillus oryzae
（Aspergillus oryzae）TPL35, the zymotic fluid and fermentation broth extract and mycelia extract of the bacterial strain are all to rape
Sclerotium bacteria and Yan Cao the pathogen such as shin bacterium there is higher biological and ecological methods to prevent plant disease, pests, and erosion activity, bacteriostasis rate is respectively 84.26% and 60.29%, is all existed
More than 50%.Therefore can using TPL35 as biocontrol microorganisms applied in plant disease caused by corresponding disease fungus, also can be after
It is continuous to obtain natural active matter using the endogenetic fungus resource, provide foundation for the exploitation of biogenic pesticide.
Figure of description
Fig. 1 is aspergillus oryzae（Aspergillus oryzae）TPL35 colonial morphology, wherein A are front, and B is the back side.
Fig. 2 is aspergillus oryzae（Aspergillus oryzae）TPL35 conidiophore and conidium（40X）.
Fig. 3 is aspergillus oryzae（Aspergillus oryzae）The systematic growth tree graph that TPL35 is built based on ITS sequence.
Fig. 4 is aspergillus oryzae（Aspergillus oryzae）TPL35 and fraction of pathogens fungi face-off design sketch, wherein A, B,
C, D be respectively Sclerotinia sclerotiorum, cucumber phytophthora, citrus anthrax-bacilus and Yan Cao shin bacterium.
Fig. 5 is aspergillus oryzae（Aspergillus oryzae）TPL35 zymotic fluid ethyl acetate extract layers are to Sclerotinia sclerotiorum
Inhibition figure.Wherein, CK compares for solvent blank, and A represents zymotic fluid acetic acid ethyl ester extract.
Embodiment
Below by embodiment detailed description come the present invention is furture elucidated, but be not to the present invention limit
System, is only illustrated.
Embodiment 1：Aspergillus oryzae（Aspergillus oryzae）TPL35's isolates and purifies
Aspergillus oryzae of the present invention（Aspergillus oryzae）It is big that TPL35 comes from Hunan China province Agriculture in Hunan
Grey green soy bean blade in school garden.Separation method：Tissue surface is sterilized：Grey green soy bean blade is rinsed well with sterilized water, cut
Into 0.5cm × 0.5cm fritter.Above material is subjected to surface sterilization in super-clean bench, program is：The wine of volume fraction 75%
Essence rinsing 3-5min → 1gL-1Mercuric chloride rinsing 30s-1min → aseptic water washing 5 times.Separation：By the tissue material after sterilization
Material is inoculated on good PDA plating mediums, per ware 3-4 blocks, is positioned over 28 ± 1 DEG C of lucifuge cultures 3-7 days.Treat
Material outer incision grows mycelia (bacterium colony), using Tip Splitting picking method, mycelia is transferred into purifying PDA culture medium and put down
On plate, until obtaining single bacterial strain.
Embodiment 2：Aspergillus oryzae（Aspergillus oryzae）The identification of TPL35 strains
Combining form and the method for molecular biology are identified strain.Aspergillus oryzae TPL35 is in PDA culture medium
It can grow, 28 ± 1 DEG C incubated, and bacterium colony is just changed into faint yellow or white for white, later stage, dense fine granularity spore ball
（Such as Fig. 1）.Microscope morphological feature：Conidium is colourless, in oval（Such as Fig. 2）.Using ITS sequence universal primer ITS4 and
ITS5（ITS4：TCCTCCGCTTATTGATATGC；ITS5：GGAAGTAAAAGTCGTAACAAGG）Performing PCR is entered to bacterial strain TPL35
Amplification.Using TPL35 STb genes as template, PCR reaction conditions are：95 DEG C of pre-degeneration 5min；95 DEG C of denaturation 30s, 56 DEG C of annealing 30s,
72 DEG C of extension 45s, 30 circulations；72 DEG C of extension 10min；4 DEG C of preservations.Amplification gene sequence send biotech firm to be sequenced, that is, obtains
Bacterial strain TPL35 ITS sequence,（TPL35 ITS rDNA genomes are by 597 base compositions, sequence such as SEQ ID No.1 institutes
Show）.By sequence in American National Biotechnology Information center（NCBI）Sequence analysis analysis and phylogenetic tree construction are carried out,
Show bacterial strain withAspergillus oryzaeGU120193.1 gathers on one（Refer to Fig. 3）, sequence similarity 99%,
Can determine that the bacterial strain is aspergillus oryzae.
Embodiment 3：Aspergillus oryzae（Aspergillus oryzae）TPL35 disease-resistant fungal pathogen activity primary dcreening operations.
Aseptically, using flat board face-off method primary dcreening operation（Such as Fig. 4）, endogenetic fungal bacterial strain TPL35 and cause of disease is true
Bacteria cake is made with 6mm card punch respectively in bacterium, is put in respectively at the 1/3 of PDA flat boards, is cultivated at 28 DEG C, observes endophyte
Strain and whether there is antagonism for examination disease fungus, and measure the width of antibacterial band, the activity for contrasting each endogenetic fungal bacterial strain is big
It is small.
Embodiment 4：Aspergillus oryzae（Aspergillus oryzae）TPL35 has the preparation of disease-resistant fungal pathogen active-fermented broth
Method and its antibacterial activity secondary screening.
Aspergillus oryzae TPL35 has the preparation of disease-resistant fungal pathogen active-fermented broth：
（1）The activation of strain.The endogenetic fungus TPL35 for being stored in inclined-plane is transferred with transfer needle and put down in the PDA that sterilized
On plate, 28 DEG C incubated 4-5 days, obtains activated spawn.
（2）Fermented and cultured.At purified endogenetic fungus TPL35 PDA plates edge, broken into directly with sterile card punch
Footpath 6mm bacteria cake, 2 ferfas cakes of inoculation are in the 250mL conical flasks equipped with 100mL PDB, at 28 DEG C ± 1 DEG C,
200r·min-1Concussion and cultivate 6-7 days on shaking table, that is, obtain gray wool beans endogenetic fungus TPL35 zymotic fluid.Crossed and filtered out with filter paper
Mycelium is removed, bacterium solution obtains the fermentation of gray wool beans endogenetic fungus TPL35 disease-resistant fungal pathogens after 0.22um syringe-driven filters
Liquid.
Using secondary screening containing toxic medium method：
The preparation of toxic culture medium：Aseptically, PDA culture mediums are cooled to 40-50 DEG C, by without fermented liquid and
PDA culture mediums are with 1:9 mixing, corresponding toxic culture medium is obtained, the diameter of falling people 7.5cm culture fully after vibration mixing
In ware, after solidification, the disease fungus activated is broken into 6mm bacteria cake with card punch, is individually placed to toxic culture medium and control
Above culture medium.3 repetitions, control addition equivalent blank zymotic fluid are set.The growing state of bacterium colony is observed, and measures bacterium colony
Diameter, fungistatic effect are represented with bacteriostasis rate.
Mycelial growth inhibition rate (℅)=(control colony diameter-processing colony diameter)/(control colony diameter -6) ×
100
Table 1：The anti-bacterial result of the grey green soy bean endogenetic fungus TPL35 zymotic fluid to six kinds of plant pathogenic fungis
| Plant pathogenic fungi | Bacteriostasis rate（%） |
| Sclerotinia sclerotiorum | 84.26 |
| Rhizoctonia solani Kuhn | - |
| Citrus anthracnose bacterium | 8.00 |
| Cucumber phytophthora root rot bacterium | 34.85 |
| Yan Cao shin germ | 60.29 |
| Botrytis cinerea germ | 48.67 |
Measurement result shows：Aspergillus oryzae TPL35 zymotic fluid has antibacterial well to Sclerotinia sclerotiorum and the black shin bacterium of tobacco
Activity, bacteriostasis rate is respectively 84.26% and 60.29%, all more than 50%.The metabolite can be applied to fungal diseases of plants
Preventing and treating, new approach is added for the exploitation of disinfectant use in agriculture.
Embodiment 5：Aspergillus oryzae（Aspergillus oryzae）TPL35 fermentation broth extracts and hypha extract are to disease
The determination of activity of fungal pathogenses.
With 8 layers of gauze by bacterial strain TPL35 mycelium and separation of fermentative broth, zymotic fluid respectively with isometric petroleum ether,
Ethyl acetate, extracting n-butyl alcohol 3 times, are concentrated to give each extract layer medicinal extract, and mycelia is extracted 3 times with 100 mL methanol, subtracted
Pressure concentration is hypha extract.In addition to petroleum ether layer is configured to 40 mg/ml chloroformic solutions, above-mentioned gained metabolin crude product point
40 mg/ml methanol solution is not made into.Then filter paper is taken（Φ=6mm, sterilize）It is immersed in each crude product solution, makes it
Abundant saturation, it is standby after slightly air-drying.The 6mm accomplished fluently disease fungus bacteria cake is placed on PDA plate center, then will be prepared
Aseptic filter paper piece be placed with apart from pathogen bacteria cake about at 3cm, each flat board puts four, a piece of to be compareed for solvent blank（Point
Wei not pure chloroformic solution and methanol solution）, other 3 are that each extract filter paper soaks piece（The metabolin crude product pair of each endogenetic fungus
Test bacterium makees 3 repetitions respectively）.Antagonism bandwidth of the endogenetic fungus primary extract filter paper to disease fungus is determined, with antagonism
The bandwidth average value index strong and weak as endogenetic fungus antagonistic activity.
As a result show：Bacterial strain TPL35 active metabolite is concentrated mainly on zymotic fluid ethyl acetate extract layer, especially
There is obvious inhibitory action to Sclerotinia sclerotiorum（Such as Fig. 5）.
<110>Agricultural University Of Hunan
<120>Grey green soy bean endogenetic fungus TPL35 and its application in controlling plant diseases
<160> 1
<210> 1
<211> 597
<212> DNA
<400> 1
TTGGGACTTGGGCAACCTACTGATCCGAGGTCACCTGGAAAAGATTGATTTGCGTTCGGCAAGCGCCGG
CCGGGCCTACAGAGCGGGTGACAAAGCCCCATACGCTCGAGGATCGGACGCGGTGCCGCCGCTGCCTTTGGGGCCCG
TCCCCCCCGGAGAGGGGACGACGACCCAACACACAAGCCGTGCTTGATGGGCAGCAATGACGCTCGGACAGGCATGC
CCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACGGAATTCTGCAATTCACACTAGTTAT
CGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAGTTTTAACTGATTGCGATACAAT
CAACTCAGACTTCACTAGATCAGACAGAGTTCGTGGTGTCTCCGGCGGGCGCGGGCCCGGGGCTGAGAGCCCCCGGC
GGCCATGAATGGCGGGCCCGCCGAAGCAACTAAGGTACAGTAAACACGGGTGGGAGGTTGGGCTCGCTAGGAACCCT
ACACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTTACTTCCACA
Claims (5)
1. one plant of grey green soy bean（Tephrosia purpurea）Endogenetic fungus aspergillus oryzae（Aspergillus oryzae）TPL35,
It is preserved in China typical culture collection center, deposit number CCTCC NO：M 2014608.
2. grey green soy bean endogenetic fungus aspergillus oryzae TPL35 as claimed in claim 1 is in preventing and treating selected from sclerotinia sclerotiorum, cigarette grass shins disease
Plant disease in application.
3. application as claimed in claim 2, it is characterised in that：Its using the zymotic fluid of the fungi, fermentation broth extract or
Hypha extract is applied.
A kind of 4. disinfectant use in agriculture, it is characterised in that：It includes the zymotic fluid of fungi as claimed in claim 1, or its zymotic fluid
Extract, or its hypha extract.
5. bactericide as claimed in claim 4, it is characterised in that：The fermentation broth extract is respectively with isometric oil
Ether, ethyl acetate, extracting n-butyl alcohol 2-4 times, it is concentrated to give each extract layer medicinal extract；The hypha extract is to use first
Alcohol extracting mycelium 2-4 times, is concentrated under reduced pressure as hypha extract.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510006884.6A CN104560735B (en) | 2015-01-07 | 2015-01-07 | Grey green soy bean endogenetic fungus TPL35 and its application in controlling plant diseases |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510006884.6A CN104560735B (en) | 2015-01-07 | 2015-01-07 | Grey green soy bean endogenetic fungus TPL35 and its application in controlling plant diseases |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104560735A CN104560735A (en) | 2015-04-29 |
| CN104560735B true CN104560735B (en) | 2017-12-12 |
Family
ID=53077817
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510006884.6A Active CN104560735B (en) | 2015-01-07 | 2015-01-07 | Grey green soy bean endogenetic fungus TPL35 and its application in controlling plant diseases |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104560735B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105961443A (en) * | 2016-05-17 | 2016-09-28 | 梁文荣 | Pesticide preparation for killing aphids |
| CN105875660A (en) * | 2016-05-17 | 2016-08-24 | 梁文荣 | Pesticide preparation for killing scale insects |
| CN105875659A (en) * | 2016-05-17 | 2016-08-24 | 梁文荣 | Pesticide preparation for killing spider mite |
| CN114717119B (en) * | 2022-02-23 | 2023-06-02 | 广西师范大学 | Sarcandra glabra endophytic fungus and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102533566A (en) * | 2011-12-06 | 2012-07-04 | 郑州大学 | (Aspergillus fumigates)Ty-1 and application of (Aspergillus fumigates)Ty-1 |
| CN102732430A (en) * | 2011-09-05 | 2012-10-17 | 郑州大学 | Aspergillus niger strain and application thereof |
| CN102838389A (en) * | 2012-08-27 | 2012-12-26 | 湖北省农业科学院植保土肥研究所 | Fertilizer-and-drug double-effect bio-organic fertilizer for preventing and treating crop soil-borne diseases and manufacturing method of bio-organic fertilizer |
-
2015
- 2015-01-07 CN CN201510006884.6A patent/CN104560735B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102732430A (en) * | 2011-09-05 | 2012-10-17 | 郑州大学 | Aspergillus niger strain and application thereof |
| CN102533566A (en) * | 2011-12-06 | 2012-07-04 | 郑州大学 | (Aspergillus fumigates)Ty-1 and application of (Aspergillus fumigates)Ty-1 |
| CN102838389A (en) * | 2012-08-27 | 2012-12-26 | 湖北省农业科学院植保土肥研究所 | Fertilizer-and-drug double-effect bio-organic fertilizer for preventing and treating crop soil-borne diseases and manufacturing method of bio-organic fertilizer |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104560735A (en) | 2015-04-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105219681B (en) | A kind of bacillus amyloliquefaciens Bacillus amyloliquefaciens D2WM and preparation method and application | |
| CN102776130B (en) | Metarhizium anisopliae and application thereof | |
| CN102533617B (en) | Bacillus subtilis strain and application thereof | |
| CN104480046B (en) | One plant of Brevibacillus laterosporus and its application | |
| CN103160442B (en) | Paecilomyceslilacinus strain having strong pathogenicity for diaphorina citri | |
| CN102676398A (en) | Separation and purification method of endophytic fungi from ginkgo biloba | |
| CN105820981A (en) | Preparation and application of bacillus altitudinis bacterial agent | |
| CN106942301B (en) | A kind of botanical pesticide preparation of prevention and control rice blast and preparation method thereof | |
| CN104560735B (en) | Grey green soy bean endogenetic fungus TPL35 and its application in controlling plant diseases | |
| CN102204570A (en) | Application of alternaria alternate metabolic products in cucumber rhizoctonia solani prevention and control | |
| CN102217656A (en) | Application of alternaria alternata metabolite to controlling Botrytis cirerea | |
| CN106676049A (en) | Bacillus amyloliquefaciens strain and application thereof | |
| CN104531543B (en) | Grey green soy bean endogenetic fungus TPL25 and its application in controlling plant diseases | |
| CN106591157A (en) | Aspergillus tubingensis with disease prevention and growth promoting functions as well as preparation and application of aspergillus tubingensis metabolites | |
| CN102191184B (en) | Biocontrol endophytic fungi-Alternaria alternata | |
| CN102204571A (en) | Application of Alternaria alternata metabolic product in controlling watermelon fusarium oxysporum | |
| CN113862160B (en) | Trichoderma pseudokoningii Tk905 strain with biocontrol and induced disease resistance effects and application thereof | |
| CN108085259B (en) | Biocontrol endophytic fungi and application thereof in preventing and controlling gray mold of economic crops | |
| CN111363691B (en) | Paenibacillus polymyxa and application thereof | |
| CN104560740B (en) | Metarhizium anisopliae and its application of one plant of preventing and treating oil tea as larva | |
| CN1327774C (en) | Tobacco rust resisting microbial prepn and its prepn process and application | |
| CN107858315A (en) | One plant of bacillus amyloliquefaciens for preventing and treating sub- lotus rot and its application | |
| CN105349434B (en) | The penicillium purpurogenum and its preparation method and application of one plant of intoxicating plant parasitical eelworm | |
| CN103087949B (en) | Biocontrol endophytic actinomycetes- streptomyces sioyaensis | |
| CN107881128B (en) | Strain BZJN1 for preventing and treating root rot of bighead atractylodes rhizome and preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20210608 Address after: Room 414, property management building, Hunan Agricultural University, No.1 Nongda Road, Furong district, Changsha City, Hunan Province, 410011 Patentee after: HUNAN NONGJIE TECHNOLOGY DEVELOPMENT Co.,Ltd. Address before: 410128, No. 1, Nongda Road, Furong district, Hunan, Changsha Patentee before: Hunan Agricultural University |
|
| TR01 | Transfer of patent right |