CN104560735A - Tephrosia purpurea endophytic fungus TPL35 and application thereof in prevention and control of plant diseases - Google Patents
Tephrosia purpurea endophytic fungus TPL35 and application thereof in prevention and control of plant diseases Download PDFInfo
- Publication number
- CN104560735A CN104560735A CN201510006884.6A CN201510006884A CN104560735A CN 104560735 A CN104560735 A CN 104560735A CN 201510006884 A CN201510006884 A CN 201510006884A CN 104560735 A CN104560735 A CN 104560735A
- Authority
- CN
- China
- Prior art keywords
- extract
- tpl35
- aspergillus oryzae
- zymotic fluid
- hypha
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/145—Fungal isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
- C12R2001/66—Aspergillus
- C12R2001/69—Aspergillus oryzae
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/30—Microbial fungi; Substances produced thereby or obtained therefrom
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Chemical & Material Sciences (AREA)
- Microbiology (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Mycology (AREA)
- Virology (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Environmental Sciences (AREA)
- Dentistry (AREA)
- Plant Pathology (AREA)
- Pest Control & Pesticides (AREA)
- Agronomy & Crop Science (AREA)
- Botany (AREA)
- Medicinal Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Biomedical Technology (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
- Medicines Containing Plant Substances (AREA)
Abstract
The invention discloses a tephrosia purpurea endophytic fungus aspergillus oryzae TPL35 collected in China Center for Type Culture Collection (CCTCC) with the collection number CCTCC NO: M 2014608, and application of a fermentation product thereof in plant pathogenic fungus resistance. Fungal fermentation liquid as well as a fermentation liquid extract and a mycelium extract have a strong hypha growth inhibiting effect on plant pathogenic fungi such as sclerotinia rot of colza and tobacco black shank disease, an excellent strain is provided for development of microbial pesticides, and the invention is a first research in the aspect of tephrosia purpurea endophytic fungi.
Description
Technical field
The invention belongs to microbial technology field, relate to a kind of aspergillus oryzae (
aspergillus oryzae) application in TPL35 and controlling plant diseases thereof.
Background technology
Ash green soy bean (
tephrosia purpurea) be pulse family (Leguminosae) Tephrosia (
tephrosia Pers.) perennial woody plant, be mainly distributed in tropical and subtropical region, as Guangdong of India, Pakistan, Vietnam, Cambodia, Laos, Burma and China, Guangxi, Yunnan, the ground such as Fujian and Hunan.Ash green soy bean branches and leaves can make green manure, mash that throw in water can malicious fish, are also good solid sand and embankment soil-keeping plants.Present stage mainly concentrates on Phytochemistry and pharmacology aspect to the research of grey green soy bean, in endogenetic fungus, also rarely have report.
Plant disease is one of key factor of restriction crops good quality and high output always, and in plant disease, the disease of 70%-80% is infected by disease fungus and caused.Fungal diseases of plants not only directly causes crop yield to decline to reduce with quality, and fraction of pathogens fungi is in infection crops process, can secrete and produce the multiple toxin that is harmful to people and animals and metabolite, to the safety formation great threat of agricultural product.
Chemical control is the effective ways controlling corps diseases, but chemical pesticide contaminated environment, induction germ develops immunity to drugs, and destroys the ecological balance, causes the problems such as residual hazard also following, and therefore, the biological control research of plant disease more and more comes into one's own.And endogenetic fungus is as one of the means of biological control, have fermentation costs cheap, technological means is simple, the feature such as not easily allow that pathogen develops immunity to drugs, and potentiality are very huge.Because in research endogenetic fungus, antibacterial substance has very important theory significance and application prospect, endogenetic fungus ubiquity antibacterial activity in addition, so progress is in this respect very rapid in recent years.
Summary of the invention
Technical problem to be solved by this invention is: provide a strain be separated from the endogenetic fungus aspergillus oryzae of grey green soy bean blade (
aspergillus oryzae) TPL35, it is active that the zymotic fluid of this bacterial strain and fermentation broth extract and mycelia extract all have higher biological and ecological methods to prevent plant disease, pests, and erosion to pathogens such as Sclerotinia sclerotiorums, therefore can TPL35 be applied in the plant disease that corresponding disease fungus causes as biocontrol microorganisms, also can continue to utilize this endogenetic fungus resource to obtain natural active matter, for the exploitation of biogenic pesticide provides foundation.
Technical scheme provided by the invention is: a strain ash green soy bean (
tephrosia purpurea) endogenetic fungus aspergillus oryzae (
aspergillus oryzae) TPL35, it is preserved in China typical culture collection center (address: China, Wuhan, Wuhan University) on November 27th, 2014, and deposit number CCTCC NO:M 2014608, survives after testing.
Grey green soy bean of the present invention (
tephrosia purpurea) endogenetic fungus system is from the grey green soy bean plant living body in Agricultural University Of Hunan of Chinese Hunan Province campus, through being separated, cultivating, fermentation and the step such as active testing obtain and preserve.
The solid culture of aspergillus oryzae TPL35 is characterized as: on PDA medium, 28 DEG C of constant temperature culture, and bacterium colony is just white, and the later stage becomes faint yellow or white, close raw fine granularity spore ball.Microscope morphological feature: conidium is colourless, in oval.
The molecular biological characteristics of aspergillus oryzae TPL35: adopt round pcr, determined dna sequence analysis, TPL35 bacterial strain ITSrDNA genome is by 597 base compositions.Carry out sequence analysis analysis and phylogenetic tree construction in American National Biotechnology Information center (NCBI), display bacterial strain with
aspergillus oryzaegU120193.1 gathers on one, and sequence similarity is 99%, can determine that this bacterial strain is aspergillus oryzae.
The concrete preparation manipulation step of the present invention's ash green soy bean endogenetic fungus anti-plant pathogenic fungi zymotic fluid is as follows:
(1) activation of bacterial classification.The endogenetic fungus TPL35 being stored in inclined-plane transferred in sterilizing PDA with transfer needle and put down
On plate, 28 DEG C of constant temperature culture 4-5 days, obtain activated spawn.
(2) fermented and cultured.At the endogenetic fungus TPL35 PDA plate edge of purifying, break into directly with aseptic card punch
The bacterium cake of footpath 6mm, inoculates 2 ferfas cakes in the 250mL conical flask that 100mLPDB is housed, at 28 DEG C ± 1 DEG C, and 200rmin
-1on shaking table, 6-7 days is cultivated in concussion, namely obtains the zymotic fluid of grey green soy bean endogenetic fungus TPL35.Remove mycelium with Filter paper filtering, bacterium liquid, after 0.22um syringe-driven filter, namely obtains the zymotic fluid of the disease-resistant fungal pathogens of grey green soy bean endogenetic fungus TPL35.
The required medium of fermentation: potato dextrose broth (PDB), specific practice is: take fresh potato 200 grams, peeling is cut into pieces, add ultra-pure water and boil 30 minutes, four layers of filtered through gauze, filtrate adds glucose 20 grams mixing, add water and be settled to 1 liter, pH nature.121 DEG C, sterilizing in 35 minutes is for subsequent use.Solid culture medium needed for activated spawn: add 20 grams of agar in above-mentioned medium, i.e. PDA medium.
Described phytopathogenic fungi comprises: Sclerotinia sclerotiorum, Rhizoctonia solani, Botrytis cinerea bacterium, cucumber phytophthora, Yan Cao ?shin bacterium, oranges and tangerines anthrax-bacilus.Above-mentioned plant pathogenic fungi all adopts PDA medium culture.
Dull and stereotyped face-off method is adopted to carry out primary dcreening operation, endogenetic fungal bacterial strain TPL35 and disease fungus are made bacterium cake with the card punch of 6mm respectively, be placed in 1/3 place of PDA flat board respectively, cultivate at 28 DEG C, observe endophytic bacterial controlled effect and whether have antagonism for examination disease fungus.
Bacterial strain TPL35 zymotic fluid suppresses to measure to pathogen mycelial growth.Measured amounts without the PDA medium (40-50 DEG C under fermented liquid (contrast use blank run liquid) and melting state, volume ratio without fermented liquid and medium is 1 ︰ 9) be mixed, be down flat plate (every ware is about 10mL), connect plant pathogenic fungi (bacterium cake diameter 6mm) after to be solidified, process, contrast each repetition 3 times.Be placed in 28 ± 1 DEG C of incubators and cultivate after 3-5 days, measure pathogen fungus colony diameter by right-angled intersection method, calculate inhibiting rate according to the following formula.
Mycelial growth inhibition rate (℅)=(contrast colony diameter-process colony diameter)/(contrast colony diameter-6) × 100
Measurement result shows: the zymotic fluid of aspergillus oryzae TPL35 has good bacteriostatic activity to Sclerotinia sclerotiorum and tobacco black shin bacterium, and bacteriostasis rate is respectively 84.26% and 60.29%, all more than 50%.This metabolite can be applicable to the control of fungal diseases of plants, and the exploitation for disinfectant use in agriculture adds new approach.
Bacterial strain TPL35 fermentation broth extract and hypha extract are to the determination of activity of disease fungus.With 8 layers of gauze by mycelium and separation of fermentative broth, zymotic fluid, respectively with isopyknic benzinum, ethyl acetate, extracting n-butyl alcohol 2-4 time, concentratedly obtains each extract layer medicinal extract, and mycelia is extracted 2-4 time with 100 mL methyl alcohol, and reduced pressure concentration is hypha extract.The activity of each extract of TPL35 is measured again with filter paper enzyme.Result shows: the active metabolite of bacterial strain TPL35 mainly concentrates on zymotic fluid extraction into ethyl acetate layer, especially has obvious inhibitory action to Sclerotinia sclerotiorum.
Meanwhile, the present invention also provides the application of described grey green soy bean endogenetic fungus aspergillus oryzae TPL35 in plant disease caused by control plant pathogenic fungi, and it utilizes the zymotic fluid of described fungi, fermentation broth extract or hypha extract to apply.
Described plant disease be sclerotinia rot of colza, Yan Cao ?shin sick.
The present invention also provides a kind of disinfectant use in agriculture, and it comprises described zymotic fluid, or its fermentation broth extract, or its hypha extract.
Described bactericide, described fermentation broth extract is respectively with isopyknic benzinum, ethyl acetate, extracting n-butyl alcohol 2-4 time, concentratedly obtains each extract layer medicinal extract; Described hypha extract extracts 2-4 time with methyl alcohol, and reduced pressure concentration is hypha extract.
Advantage of the present invention: be separated endogenetic fungus first from grey green soy bean, and obtain active bacterial strain aspergillus oryzae (
aspergillus oryzae) TPL35, the zymotic fluid of this bacterial strain and fermentation broth extract and mycelia extract all to Sclerotinia sclerotiorum and Yan Cao ?the pathogen such as shin bacterium to have higher biological and ecological methods to prevent plant disease, pests, and erosion active, bacteriostasis rate is respectively 84.26% and 60.29%, all more than 50%.Therefore TPL35 can be applied in the plant disease that corresponding disease fungus causes as biocontrol microorganisms, also can continue to utilize this endogenetic fungus resource to obtain natural active matter, for the exploitation of biogenic pesticide provides foundation.
figure of description
Fig. 1 be aspergillus oryzae (
aspergillus oryzae) colonial morphology of TPL35, wherein A is front, and B is the back side.
Fig. 2 be aspergillus oryzae (
aspergillus oryzae) conidiophore of TPL35 and conidium (40X).
Fig. 3 be aspergillus oryzae (
aspergillus oryzae) the systematic growth tree graph that builds based on ITS sequence of TPL35.
Fig. 4 be aspergillus oryzae (
aspergillus oryzae) TPL35 and fraction of pathogens fungi stand facing each other design sketch, wherein A, B, C, D be respectively Sclerotinia sclerotiorum, cucumber phytophthora, oranges and tangerines anthrax-bacilus and Yan Cao ?shin bacterium.
Fig. 5 be aspergillus oryzae (
aspergillus oryzae) TPL35 zymotic fluid extraction into ethyl acetate layer is to the inhibition figure of Sclerotinia sclerotiorum.Wherein, CK is solvent blank contrast, and A represents zymotic fluid acetic acid ethyl ester extract.
Embodiment
Detailed description below by embodiment illustrates the present invention further, but is not limitation of the present invention, only does example explanation.
embodiment 1: aspergillus oryzae (
aspergillus oryzae) separation and purification of TPL35
The aspergillus oryzae that the present invention relates to (
aspergillus oryzae) TPL35 comes from grey green soy bean blade in Agricultural University Of Hunan of Hunan China province campus.Separating method: tissue surface is sterilized: with sterile water, grey green soy bean blade is rinsed well, be cut into the fritter of 0.5cm × 0.5cm.Above material is carried out surface sterilization in super-clean bench, and program is: volume fraction 75% alcohol rinsing 3-5min → 1gL
-1mercuric chloride rinsing 30s-1min → aseptic water washing 5 times.Be separated: the organization material after sterilization is inoculated on good PDA plating medium, every ware 3-4 block, be positioned over 28 ± 1 DEG C of lucifuges and cultivate 3-7 days.Treat that material outer incision grows mycelia (bacterium colony), adopt Tip Splitting picking method, mycelia is transferred on purifying PDA culture medium flat plate, until obtain single bacterial strain.
embodiment 2: aspergillus oryzae (
aspergillus oryzae) qualification of TPL35 bacterial classification
Combining form and molecular biological method are identified bacterial classification.Aspergillus oryzae TPL35 can grow on PDA medium, 28 ± 1 DEG C of constant temperature culture, and bacterium colony is just white, and the later stage becomes faint yellow or white, close raw fine granularity spore ball (as Fig. 1).Microscope morphological feature: conidium is colourless, in oval (as Fig. 2).Utilize ITS sequence universal primer ITS4 and ITS5(ITS4:TCCTCCGCTTATTGATATGC; ITS5:GGAAGTAAAAGTCGTAACAAGG) pcr amplification is carried out to bacterial strain TPL35.With TPL35 STb gene for template, PCR reaction condition is: 95 DEG C of denaturation 5min; 95 DEG C of sex change 30s, 56 DEG C of annealing 30s, 72 DEG C extend 45s, 30 circulations; 72 DEG C extend 10min; 4 DEG C of preservations.Amplification gene sequence send biotech firm to check order, and namely obtains the ITS sequence of bacterial strain TPL35, (, by 597 base compositions, sequence is as shown in SEQ ID No.1 for the ITS rDNA genome of TPL35).Sequence is carried out sequence analysis analysis and phylogenetic tree construction at American National Biotechnology Information center (NCBI), display bacterial strain with
aspergillus oryzaegU120193.1 gathers (refer to Fig. 3) on one, and sequence similarity is 99%, can determine that this bacterial strain is aspergillus oryzae.
embodiment 3: aspergillus oryzae (
aspergillus oryzae) the active primary dcreening operation of the disease-resistant fungal pathogens of TPL35.
Aseptically, adopt dull and stereotyped face-off method primary dcreening operation (as Fig. 4), endogenetic fungal bacterial strain TPL35 and disease fungus are made bacterium cake with the card punch of 6mm respectively, be put in 1/3 place of PDA flat board respectively, cultivate at 28 DEG C, observe endophytic bacterial controlled effect and whether have antagonism for examination disease fungus, and measure the width of antibacterial band, contrast the active size of each endogenetic fungal bacterial strain.
embodiment 4: aspergillus oryzae (
aspergillus oryzae) TPL35 has the preparation method of disease-resistant fungal pathogens active-fermented broth and antibacterial activity sieves again.
Aspergillus oryzae TPL35 has the preparation of disease-resistant fungal pathogens active-fermented broth:
(1) activation of bacterial classification.The endogenetic fungus TPL35 being stored in inclined-plane transferred in sterilizing PDA with transfer needle and put down
On plate, 28 DEG C of constant temperature culture 4-5 days, obtain activated spawn.
(2) fermented and cultured.At the endogenetic fungus TPL35 PDA plate edge of purifying, break into directly with aseptic card punch
The bacterium cake of footpath 6mm, inoculates 2 ferfas cakes in the 250mL conical flask that 100mL PDB is housed, at 28 DEG C ± 1 DEG C, and 200rmin
-1on shaking table, 6-7 days is cultivated in concussion, namely obtains the zymotic fluid of grey green soy bean endogenetic fungus TPL35.Remove mycelium with Filter paper filtering, bacterium liquid, after 0.22um syringe-driven filter, namely obtains the zymotic fluid of the disease-resistant fungal pathogens of grey green soy bean endogenetic fungus TPL35.
Adopt and sieve again containing toxic medium method:
The preparation of toxic medium: aseptically, PDA medium is cooled to 40-50 DEG C, to mix with 1:9 without fermented liquid and PDA medium, obtain corresponding toxic medium, in the culture dish of the rear diameter of the falling people 7.5cm of abundant vibration mixing, after solidifying, the disease fungus card punch activated is broken into the bacterium cake of 6mm, be placed on respectively above toxic medium and control medium.Arrange 3 repetitions, equivalent blank zymotic fluid is added in contrast.Observe the growing state of bacterium colony, and measure colony diameter, fungistatic effect bacteriostasis rate represents.
Mycelial growth inhibition rate (℅)=(contrast colony diameter-process colony diameter)/(contrast colony diameter-6) × 100
Table 1: the zymotic fluid of grey green soy bean endogenetic fungus TPL35 is to the anti-bacterial result of six Plants disease funguses
| Plant pathogenic fungi | Bacteriostasis rate (%) |
| Sclerotinia sclerotiorum | 84.26 |
| Rhizoctonia solani Kuhn | - |
| Citrus anthracnose bacterium | 8.00 |
| Cucumber phytophthora root rot bacterium | 34.85 |
| Yan Cao ?shin germ | 60.29 |
| Botrytis cinerea germ | 48.67 |
Measurement result shows: the zymotic fluid of aspergillus oryzae TPL35 has good bacteriostatic activity to Sclerotinia sclerotiorum and tobacco black shin bacterium, and bacteriostasis rate is respectively 84.26% and 60.29%, all more than 50%.This metabolite can be applicable to the control of fungal diseases of plants, and the exploitation for disinfectant use in agriculture adds new approach.
embodiment 5: aspergillus oryzae (
aspergillus oryzae) TPL35 fermentation broth extract and hypha extract be to the determination of activity of disease fungus.
With 8 layers of gauze by the mycelium of bacterial strain TPL35 and separation of fermentative broth, zymotic fluid is respectively with isopyknic benzinum, ethyl acetate, extracting n-butyl alcohol 3 times, concentrate and obtain each extract layer medicinal extract, mycelia extracts 3 times with 100 mL methyl alcohol, and reduced pressure concentration is hypha extract.Except petroleum ether layer is configured to 40 mg/ml chloroformic solutions, above-mentioned gained metabolite crude product is made into the methanol solution of 40 mg/ml respectively.Then get filter paper (Φ=6mm, sterilizing) to be immersed in each crude product solution, make it fully saturated, after slightly air-dry, for subsequent use.The disease fungus bacterium cake of the 6mm accomplished fluently is placed on the dull and stereotyped central authorities of PDA, again the aseptic filter paper sheet prepared is placed with and is about 3cm place at distance pathogen bacterium cake, each flat board puts four, a slice is solvent blank contrast (being respectively pure chloroformic solution and methanol solution), and other 3 is each extract filter paper leaching sheet (the metabolite crude product of each endogenetic fungus does 3 repetitions respectively to test bacterium).Measure endogenetic fungus primary extract filter paper to the antagonism bandwidth of disease fungus, using antagonism bandwidth mean value as the index of endogenetic fungus antagonistic activity power.
Result shows: the active metabolite of bacterial strain TPL35 mainly concentrates on zymotic fluid extraction into ethyl acetate layer, especially has obvious inhibitory action (as Fig. 5) to Sclerotinia sclerotiorum.
<110> Agricultural University Of Hunan
<120> ash green soy bean endogenetic fungus TPL35 and the application in controlling plant diseases thereof
<160> 1
<210> 1
<211> 597
<212> DNA
<400> 1
TTGGGACTTGGGCAACCTACTGATCCGAGGTCACCTGGAAAAGATTGATTTGCGTTCGGCAAGCGCCGGCCGGGCCTACAGAGCGGGTGACAAAGCCCCATACGCTCGAGGATCGGACGCGGTGCCGCCGCTGCCTTTGGGGCCCGTCCCCCCCGGAGAGGGGACGACGACCCAACACACAAGCCGTGCTTGATGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACGGAATTCTGCAATTCACACTAGTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAGTTTTAACTGATTGCGATACAATCAACTCAGACTTCACTAGATCAGACAGAGTTCGTGGTGTCTCCGGCGGGCGCGGGCCCGGGGCTGAGAGCCCCCGGCGGCCATGAATGGCGGGCCCGCCGAAGCAACTAAGGTACAGTAAACACGGGTGGGAGGTTGGGCTCGCTAGGAACCCTACACTCGGTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTTACTTCCACA
Claims (6)
1. one strain ash green soy bean (
tephrosia purpurea) endogenetic fungus aspergillus oryzae (
aspergillus oryzae) TPL35, it is preserved in China typical culture collection center, deposit number CCTCC NO:M 2014608.
2. the application of grey green soy bean endogenetic fungus aspergillus oryzae TPL35 in plant disease caused by control plant pathogenic fungi as claimed in claim 1.
3. apply as claimed in claim 2, it is characterized in that: it utilizes the zymotic fluid of described fungi, fermentation broth extract or hypha extract to apply.
4. apply as claimed in claim 2 or claim 3, it is characterized in that: described plant disease be sclerotinia rot of colza, Yan Cao ?shin sick.
5. a disinfectant use in agriculture, is characterized in that: it comprises zymotic fluid as claimed in claim 1, or its fermentation broth extract, or its hypha extract.
6. bactericide as claimed in claim 5, is characterized in that: described fermentation broth extract is respectively with isopyknic benzinum, ethyl acetate, extracting n-butyl alcohol 2-4 time, concentratedly obtains each extract layer medicinal extract; Described hypha extract extracts mycelium 2-4 time with methyl alcohol, and reduced pressure concentration is hypha extract.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510006884.6A CN104560735B (en) | 2015-01-07 | 2015-01-07 | Grey green soy bean endogenetic fungus TPL35 and its application in controlling plant diseases |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510006884.6A CN104560735B (en) | 2015-01-07 | 2015-01-07 | Grey green soy bean endogenetic fungus TPL35 and its application in controlling plant diseases |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104560735A true CN104560735A (en) | 2015-04-29 |
| CN104560735B CN104560735B (en) | 2017-12-12 |
Family
ID=53077817
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510006884.6A Active CN104560735B (en) | 2015-01-07 | 2015-01-07 | Grey green soy bean endogenetic fungus TPL35 and its application in controlling plant diseases |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104560735B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105875660A (en) * | 2016-05-17 | 2016-08-24 | 梁文荣 | Pesticide preparation for killing scale insects |
| CN105875659A (en) * | 2016-05-17 | 2016-08-24 | 梁文荣 | Pesticide preparation for killing spider mite |
| CN105961443A (en) * | 2016-05-17 | 2016-09-28 | 梁文荣 | Pesticide preparation for killing aphids |
| CN114717119A (en) * | 2022-02-23 | 2022-07-08 | 广西师范大学 | Sarcandra glabra endophytic fungus and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102533566A (en) * | 2011-12-06 | 2012-07-04 | 郑州大学 | (Aspergillus fumigates)Ty-1 and application of (Aspergillus fumigates)Ty-1 |
| CN102732430A (en) * | 2011-09-05 | 2012-10-17 | 郑州大学 | Aspergillus niger strain and application thereof |
| CN102838389A (en) * | 2012-08-27 | 2012-12-26 | 湖北省农业科学院植保土肥研究所 | Fertilizer-and-drug double-effect bio-organic fertilizer for preventing and treating crop soil-borne diseases and manufacturing method of bio-organic fertilizer |
-
2015
- 2015-01-07 CN CN201510006884.6A patent/CN104560735B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102732430A (en) * | 2011-09-05 | 2012-10-17 | 郑州大学 | Aspergillus niger strain and application thereof |
| CN102533566A (en) * | 2011-12-06 | 2012-07-04 | 郑州大学 | (Aspergillus fumigates)Ty-1 and application of (Aspergillus fumigates)Ty-1 |
| CN102838389A (en) * | 2012-08-27 | 2012-12-26 | 湖北省农业科学院植保土肥研究所 | Fertilizer-and-drug double-effect bio-organic fertilizer for preventing and treating crop soil-borne diseases and manufacturing method of bio-organic fertilizer |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105875660A (en) * | 2016-05-17 | 2016-08-24 | 梁文荣 | Pesticide preparation for killing scale insects |
| CN105875659A (en) * | 2016-05-17 | 2016-08-24 | 梁文荣 | Pesticide preparation for killing spider mite |
| CN105961443A (en) * | 2016-05-17 | 2016-09-28 | 梁文荣 | Pesticide preparation for killing aphids |
| CN114717119A (en) * | 2022-02-23 | 2022-07-08 | 广西师范大学 | Sarcandra glabra endophytic fungus and application thereof |
| CN114717119B (en) * | 2022-02-23 | 2023-06-02 | 广西师范大学 | Sarcandra glabra endophytic fungus and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104560735B (en) | 2017-12-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101575574B (en) | Trichoderma harzianum composite bacteria culture and application of trichoderma harzianum composite bacteria culture in aspect of plant protection | |
| CN105219681B (en) | A kind of bacillus amyloliquefaciens Bacillus amyloliquefaciens D2WM and preparation method and application | |
| CN102776130B (en) | Metarhizium anisopliae and application thereof | |
| CN102204570B (en) | Application of alternaria alternate metabolic products in cucumber rhizoctonia solani prevention and control | |
| CN103642725A (en) | Biocontrol strain for antagonistic phytopathogen and use thereof | |
| CN102217656B (en) | Application of alternaria alternata metabolite to controlling Botrytis cirerea | |
| CN104531559A (en) | Bacillusamyloliquefaciens subsp Lh-1 and application thereof | |
| CN102177921B (en) | Compound biological control agent as well as preparation method and application thereof | |
| CN103952362A (en) | Citrus endophytic actinomycetes with antibacterial activity on various plant pathogens | |
| CN105820981A (en) | Preparation and application of bacillus altitudinis bacterial agent | |
| CN104560735B (en) | Grey green soy bean endogenetic fungus TPL35 and its application in controlling plant diseases | |
| CN102191184B (en) | Biocontrol endophytic fungi-Alternaria alternata | |
| CN106591157A (en) | Aspergillus tubingensis with disease prevention and growth promoting functions as well as preparation and application of aspergillus tubingensis metabolites | |
| CN102204571B (en) | Application of Alternaria alternata metabolic product in controlling watermelon fusarium oxysporum | |
| CN104531543B (en) | Grey green soy bean endogenetic fungus TPL25 and its application in controlling plant diseases | |
| CN106942301A (en) | A kind of botanical pesticide preparation of prevention and control rice blast and preparation method thereof | |
| CN109486687A (en) | It is a kind of inhibit banana blight penicillium oxalicum bacterial strain and its application | |
| CN104342388A (en) | Streptomyces strain and combined application thereof in prevention and treatment of tomato blight | |
| CN105695346B (en) | The sclerotium mould and its preparation method and application of one plant of intoxicating plant parasitical eelworm | |
| CN104560740B (en) | Metarhizium anisopliae and its application of one plant of preventing and treating oil tea as larva | |
| CN105695334B (en) | A kind of new trichoderma asperellum and application thereof | |
| CN106434360A (en) | Coprinelllus radians and application thereof in preventing and curing cereal cyst nematode | |
| CN105519582A (en) | Preparation for prevention and treatment of tobacco and tomato meloidogyne spp. and application thereof | |
| CN105018354A (en) | Trichoderma pleuroticola and application thereof | |
| CN107858315A (en) | One plant of bacillus amyloliquefaciens for preventing and treating sub- lotus rot and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20210608 Address after: Room 414, property management building, Hunan Agricultural University, No.1 Nongda Road, Furong district, Changsha City, Hunan Province, 410011 Patentee after: HUNAN NONGJIE TECHNOLOGY DEVELOPMENT Co.,Ltd. Address before: 410128, No. 1, Nongda Road, Furong district, Hunan, Changsha Patentee before: Hunan Agricultural University |