CN105349434B - The penicillium purpurogenum and its preparation method and application of one plant of intoxicating plant parasitical eelworm - Google Patents
The penicillium purpurogenum and its preparation method and application of one plant of intoxicating plant parasitical eelworm Download PDFInfo
- Publication number
- CN105349434B CN105349434B CN201510864461.8A CN201510864461A CN105349434B CN 105349434 B CN105349434 B CN 105349434B CN 201510864461 A CN201510864461 A CN 201510864461A CN 105349434 B CN105349434 B CN 105349434B
- Authority
- CN
- China
- Prior art keywords
- plant
- penicillium purpurogenum
- mhz111
- culture
- nematode
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention discloses the penicillium purpurogenums and its preparation method and application of one plant of intoxicating plant parasitical eelworm.The bacterial strain number of the penicillium purpurogenum of the intoxicating plant parasitical eelworm is MHZ111, is CGMCC No.11630 in the number of registering on the books of China Committee for Culture Collection of Microorganisms's common micro-organisms center.Active constituent is the plant nematode inhibitor for extracting the obtained substance for being dissolved in ethyl acetate from the culture of penicillium purpurogenum MHZ111 with ethyl acetate, when active component content is 1.5g/L and 1.0g/L, avermectin and fosthiazate are significantly higher than to the lethality of Meloidogyne incognita second instar larvae；When active component content is 1.5g/L, Meloidogyne incognita can hardly hatch, suitable with avermectin and fosthiazate to the inhibiting effect of Meloidogyne incognita egg capsule hatching when active component content is 1.0g/L and 1.5g/L.
Description
Technical field
The invention belongs to microbial pesticide technical fields, and in particular to a kind of penicillium purpurogenum of intoxicating plant parasitical eelworm and
Preparation method and application.
Background technique
Plant nematode refers to the various tissues that can parasitize plant, keeps development of plants bad, and in infection host
While can propagate other plant cause of disease, cause plant a kind of nematode of disease symptoms occur.It in the world it is many country and
Area occurs and causes harm, and type is varied.There are about more than 200 more than 5000 kinds of categories for the plant nematode recorded in the world at present
(Chen Lijie, the taxonomic identification China's parasitology and parasitic disease of section imperial jade seal .2006. plant nematode worm kind resource are miscellaneous
Will, 24:s29-33).It is estimated that the whole world is every year because plant nematode gives loss caused by agricultural, production of forestry to be up to 1,570
Hundred million dollars of (Abad P, et al.2008.Genome sequence of the metazoan plant-parasitic
Nematode Meloidogyne incognita.Nature Biotechnology, 26:909-915), and actual loss
Considerably beyond estimation, reason is that harm caused by many nematodes does not cause to infuse because not having field Visual symptoms or specialization feature
It anticipates in (Beijing Wang Shou China Pomology: Chinese agriculture Science Press, 1994.P.1-5), in addition, to line in world wide
The new discovery that worm is caused harm also is being continuously increased, and the agricultural cultivation system of some updates keeps nematode problem more prominent, furthermore,
Nematode and other biological interactions and direct or indirect influence also sharply increasing on what plant generated.From this meaning
It says, it is more hidden that more other biologies is endangered caused by nematode！At present to the nematode of plant pest there are about more than 3000 kinds, in China master
There are root-knot nematode, cyst nematode, Bursaphelenchus xylophilus, sweet potato stem nematode etc..Root-knot nematode is maximum a kind of line of agriculturally causing harm
Worm, after disease occurs, general underproduction 10%-15% or so, serious up to 75% or more, or even total crop failure
(A.G.Whitehead,1998.Plant Nematode Control.ISBN0851991882 CAB International)。
Root-knot nematode mainly has Meloidogyne incognita (Meloidogyne incognita), javanese root knot nematode (Meloidogyne
Javanica), peanut root-knot nematode (Meloidogyne arenaria) and M hapla (Meloidogyne
Hapla), wherein it is more universal with Meloidogyne incognita and two kinds of generations of javanese root knot nematode.Meloidogyne incognita host range is very
Extensively, several hundred kinds of plants can be endangered.But in recent years, nematocide is not only at high cost, but also control efficiency is undesirable, with stylish
The narrow range that the nematode killing agent of type is developed less, can be selected, the use of most of kinds can kill some predacious plant pathogenic nematodes
Carnivorous nematode and soil are dwelt brood, have very first mate's work to the natural enemy procreation of the activation of soil, the protection of ecology, parasitic nematode
With, or even the kind that has has teratogenesis, anxiety (Hou Jinli .2015. China plant nematode prevention and treatment that is carcinogenic or influencing fertility to people
Progress modern agriculture science and technology .7:136).21 century is known as environmentally friendly century, the applications of some effective nematocides by
Step is restricted, therefore becomes hot issue naturally to the biological control research of plant nematode.
Summary of the invention
The technical problem to be solved by the present invention is to how prevent and treat plant nematode.
In order to solve the above technical problems, the present invention provides one plant of penicillium purpurogenums.
Penicillium purpurogenum provided by the present invention, bacterial strain number are MHZ111, are entrusted in Chinese microorganism strain preservation management
The number of registering on the books of member's meeting common micro-organisms center is CGMCC No.11630.
Above-mentioned penicillium purpurogenum MHZ111 can be with conidium, mycelia or mycelial containing conidium and/or mycelia
Form exists.
The culture of above-mentioned penicillium purpurogenum MHZ111 also belongs to protection scope of the present invention.
The culture of penicillium purpurogenum MHZ111 provided by the present invention is by penicillium purpurogenum MHZ111 in microbiological culture media
The middle substance cultivated in obtained culture vessel, the substance includes the metabolin of the penicillium purpurogenum and the penicillium purpurogenum.
In the culture of above-mentioned penicillium purpurogenum MHZ111, the microbiological culture media can be solid medium or Liquid Culture
Base.
In the culture of above-mentioned penicillium purpurogenum MHZ111, the solid medium can be trained for the solid made of brown rice and water
Support base.The brown rice is that paddy sloughs the caryopsis after outer protection cortex rice husk, and interior protection cortex (pericarp, kind skin, megarchidium layer) is complete
Good Rice Kernel.
In order to solve the above technical problems, the present invention provides plant nematode inhibitor.
Plant nematode inhibitor provided by the present invention, its active constituent are penicillium purpurogenum MHZ111 and/or production
The metabolin of purple mould MHZ111.
The plant nematode inhibitor is concretely mentioned from the culture of penicillium purpurogenum MHZ111 with ethyl acetate
What is obtained is dissolved in the substance of ethyl acetate.
In above-mentioned plant nematode inhibitor, the plant nematode can be root-knot nematode.
In above-mentioned plant nematode inhibitor, the root-knot nematode can be Meloidogyne incognita.
The training of the metabolin and/or penicillium purpurogenum MHZ111 of above-mentioned penicillium purpurogenum MHZ111 and/or penicillium purpurogenum MHZ111
Support object inhibits plant nematode to endanger in tomato medicament in preparation plant nematode inhibitor using or preparation
Using also belonging to protection scope of the present invention.
The training of the metabolin and/or penicillium purpurogenum MHZ111 of above-mentioned penicillium purpurogenum MHZ111 and/or penicillium purpurogenum MHZ111
It supports the application that application or inhibition plant nematode of the object in inhibition plant nematode endanger in tomato and also belongs to the present invention
Protection scope.
In above-mentioned application, the plant nematode can be root-knot nematode.
In above-mentioned application, the root-knot nematode can be Meloidogyne incognita.
Above, in the plant nematode inhibitor, in addition to the active constituent, also contain carrier.The carrier
It commonly and can be biologically inert carrier for pesticide field.The carrier can be solid carrier or liquid-carrier；Institute
Stating solid carrier can be mineral material, vegetable material or high-molecular compound；The mineral material can be clay, talcum, kaolinite
At least one of soil, montmorillonite, white carbon, zeolite, silica and diatomite；The vegetable material can be corn flour, bean powder and shallow lake
At least one of powder；The high-molecular compound can be polyvinyl alcohol and/or polyglycols；The liquid-carrier can be organic molten
Agent, vegetable oil, mineral oil or water；The organic solvent can be decane and/or dodecane.
In the plant nematode inhibitor, above-mentioned penicillium purpurogenum MHZ111 can with conidium, mycelia or containing point
The mycelial form of raw spore and/or mycelia exists.
The dosage form of the plant nematode inhibitor can be a variety of dosage forms, such as liquor, emulsion, suspending agent, pulvis, particle
Agent, wettable powder or water dispersible granules.
As needed, surfactant (such as polysorbas20, Tween 80 can also be added in the plant nematode inhibitor
Deng), adhesive, stabilizer (such as antioxidant), pH adjusting agent.
It is demonstrated experimentally that active constituent is to extract being dissolved in of obtaining from the culture of penicillium purpurogenum MHZ111 with ethyl acetate
The plant nematode inhibitor of the substance of ethyl acetate, when active component content is 1.5g/L and 1.0g/L, to southern root
The lethality of tie lines worm second instar larvae is significantly higher than avermectin and fosthiazate；When active component content is 0.5g/L, to south
The lethality and fosthiazate of square root-knot nematode second instar larvae are suitable；When active component content is 0.3g/L, to Root Knot line
The lethality of worm second instar larvae is suitable with avermectin；When active component content is 1.5g/L, Meloidogyne incognita is hardly
Can hatching, active component content be 1.0g/L and 1.5g/L when, to Meloidogyne incognita egg capsule hatching inhibiting effect and Ah
It ties up rhzomorph and fosthiazate difference is not significant.Penicillium purpurogenum (Penicillium purpurogenum) MHZ111 solid fermentation culture
Object is under conditions of no any auxiliary agent is dosed, to tomato root-knot eelworm disease preventive effect up to 80% or more.Through penicillium purpurogenum MHZ111
And/or the culture of its metabolin or penicillium purpurogenum MHZ111 treated tomato seedling well developed root system, root knot is few, and plant strain growth is just
Often, to tomato safety.
Preservation explanation
Strain name: penicillium purpurogenum (Penicillium purpurogenum)
Strain number: MHZ111
Preservation mechanism: China Committee for Culture Collection of Microorganisms's common micro-organisms center
Preservation mechanism abbreviation: CGMCC
Address: Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3
Preservation date: on November 6th, 2015
Collection is registered on the books number: CGMCC No.11630
Detailed description of the invention
Fig. 1 is colonial morphology of the bacterial strain MHZ111 on Martin's plate.
Fig. 2 is bacterial strain MHZ111 conidiophore form under 40X optical microscopy.
Fig. 3 is the ITS sequence pcr amplification product electrophoretogram of bacterial strain MHZ111.
Fig. 4 is the 18SrDNA sequence pcr amplification product electrophoretogram of bacterial strain MHZ111.
Fig. 5 is Tomato Root System photo after the processing of plant nematode inhibitor.
Fig. 6 is Tomato Root System photo after CK1 processing.
Specific embodiment
The present invention is further described in detail With reference to embodiment, and the embodiment provided is only for explaining
The bright present invention, the range being not intended to be limiting of the invention.Experimental method in following embodiments is unless otherwise specified
Conventional method.The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
20% Fosthiazate aqueous emulsion in following embodiments is limited liability company of Zhong Xunnong section product, 10% fosthiazate
Granula is Japanese Ishihara Sangyo Kaisha, Ltd.'s product, in 20% Fosthiazate aqueous emulsion fosthiazate for trying final concentration of 10mg/L,
10% fosthiazate granule dosage is 50kg/hm2。
1.8% abamectin emulsifiable concentrate in following embodiments is Guilin Jiqi Biochemical Co., Ltd.'s product, 1.8% Avermectin
Abamectin emulsifiable concentrate for trying final concentration of 10mg/L in plain missible oil.
The separation and identification of embodiment 1, penicillium purpurogenum (Penicillium purpurogenum) MHZ111
1.1 strain isolation
Bacterial strain MHZ111 is isolated from Chinese Heilungkiang Mo River permafrost soil using dilution plate method.Weigh Mo River
Permafrost soil 10g is put into 90ml sterile water, draws 1ml 10 with 1ml Sterile pipette-1The bacterium solution of concentration is in a pipe 9ml sterile water
In, it shakes up as 10-2The bacterium solution of concentration, same method are successively diluted to 10-4.By above-mentioned 10-2、10-3With 10-4Soil bacterium solution
It is respectively coated on PDA plate, is inverted in 25 DEG C of incubators and cultivates 3-5 days after drying, the fungi being separated to is transferred to PDA
It is cultivated on inclined-plane, after length is good, is placed in refrigerator and saves.The bacterial strain that number is MHZ111 is taken to carry out following identifications.
The identification of 1.2 bacterial strains
1.2.1 strain morphology is observed
Bacterial strain is chosen with transfer needle to Martin's culture medium (culture medium prescription: glucose 1g, peptone 0.5g, KH2PO4·
3H2O 0.1g、MgSO4·7H2O 0.05g, 0.1% rose-bengal solution 0.33ml, 1.5~2g of agar, distilled water 100ml, from
Right pH, 2% deoxycholic aicd sodium solution 2ml (sterilizing in advance is added before use), Streptomycin Solution (10000u/ml) 0.33ml (faces
With preceding addition)) plate center, cultivate in 25 DEG C of incubators, take a picture after 72h, and in microscopically observation conidiophore and point
Sporogenic form.Bacterial strain MHZ111 is grown rapidly on Martin's culture medium as can see from Figure 1, and bacterium colony is rounded, just exists
Edge generates white hypha, fades to green, sporulation quantity is big.It can be seen that MHZ111 mycelia has tabula under Fig. 2 microscope, point
Raw sporophore top generates the stigma of several wheels symmetrically or non-symmetrically, and shaped like broom, conidium is spherical or oval.In view of mitogenetic
The representative configurations feature such as sporophore and bacterium colony, Preliminary Identification MHZ111 are Penicillium fungi.
1.2.2 molecular biology identification
The genomic DNA of MHZ111 bacterial strain is extracted, -20 DEG C save backup.Using fungi rDNA-ITS universal primer ITS1
PCR amplification is carried out to strain gene group DNA with ITS2 and 18SrDNA universal primer NS1 and FR1, primer sequence is as follows:
ITS1:TCCGTAGGTGAACCTGCGG
ITS2:GCTGCGTTCTTCATCGATGC
NS1:CCA GTA GTC ATA TGC TTG TCT C
FR1:AIC CAT TCA ATC GGT AIT
The reaction system of rDNA-ITS PCR amplification: 10 × PCR Buffer is that 2.5 μ L, dNTPs are 1.5 μ L, TaqDNA
Polymerase is 0.7 μ L, and primer is 1.5 μ L, and template DNA is that 1.5 μ L, ddH2O are 17.3 μ L, and total volume is 25 μ L.rDNA-ITS
The condition of pcr amplification reaction are as follows: 94 DEG C of initial denaturation 2min, 94 DEG C of denaturation 45S, 37 DEG C of annealing 1min, 72 DEG C of extension 2min, 35
Circulation, 72 DEG C of extension 10min.The reaction system of 18SrDNA PCR amplification: 2.5ul 10*Ex Taq buffer, 0.3ul Ex
Taq, 2ul dNTP, 1ul NS1 (10uM), 1ul FR1 (10uM), template 1ul, aseptic deionized water supplement volume to 25ul.
PCR reaction condition: 95 DEG C of 5min, 94 DEG C of 30s, 61 DEG C of 1min, 72 DEG C of 1.5min 2 circulations, 94 DEG C of 30s, 60 DEG C of 1min, 72
DEG C of 1.5min 2 circulations, 94 DEG C of 30s, 59 DEG C of 1min, 72 DEG C of 1.5min 2 circulations, 94 DEG C of 30s, 58 DEG C of 1min, 72 DEG C
1.5min2 circulation, 94 DEG C of 30s, 57 DEG C of 1min, 72 DEG C of 1.5min 5 circulations, 94 DEG C of 30s, 56 DEG C of 1min, 72 DEG C
1.5min2 circulation, 94 DEG C of 30s, 55 DEG C of 1min, 72 DEG C of 1.5min 10 circulations, 94 DEG C of 30s, 54 DEG C of 1min, 72 DEG C
1.5min 2 circulations, 94 DEG C of 30s, 53 DEG C of 1min, 72 DEG C of 1.5min 5 circulations, 72 DEG C of 10min.
Amplified production is detected through 1% agarose gel electrophoresis, and primer synthesis and the purifying of PCR product and sequencing are entrusted
Shanghai Sangon Biological Engineering Technology And Service Co., Ltd completes.
RDNA-ITS and 18SrDNA sequence results using American National Biotechnology Information center (NCBI, http:
Www.ncbi.nlm.nih.gov/BLAST the sequence of Relative Fungi bacterial strain in BLAST network tool and GenBank database)
Highest homology comparison is carried out, the type of Penicillium is determined from DNA level.
PCR amplification is carried out using rDNA-ITS and 18SrDNA universal primer, it is left to obtain 250bp or so and 1800bp respectively
Right segment (Fig. 3, Fig. 4), then sequencing obtains rDNA-ITS sequence (sequence 1 in sequence table) and 18SrDNA sequence (sequence
Sequence 2 in table).It will obtain the known Penicillium in the two sequences and GenBank database and carry out homology search BLAST
It compares (table 1), the ITS sequence of MHZ111 is reached with Penicillium purpurogenum homology with 18SrDNA sequence
100%.Therefore, determine that MHZ111 bacterial strain is penicillium purpurogenum (Penicillium in terms of DNA hereditary information
purpurogenum)。
1 bacterial strain MHZ111rDNA-ITS and 18SrDNA gene sequencing result of table compares analysis
It is micro- that penicillium purpurogenum (Penicillium purpurogenum) MHZ111 has been preserved in China on November 6th, 2015
Biological inoculum preservation administration committee common micro-organisms center, deposit number are CGMCC No.11630.
Embodiment 2, plant nematode inhibitor and its eelworm-killing activity
The culture of penicillium purpurogenum 1. (Penicillium purpurogenum) MHZ111
1.1 test tube species cultures
Penicillium purpurogenum (Penicillium purpurogenum) MHZ111 is accessed into PDA culture medium, in 25 DEG C of culture 7d,
Obtain test tube species.
Wherein, potato dextrose agar (PDA) culture medium: peeling potatoes, 200g are cut into small pieces, and boiling is added to boil
30min, 4 layers of filtered through gauze add 20g glucose, agar 17g, distilled water constant volume to 1000mL, boil mixing, under the conditions of 121 DEG C
Sterilizing 20 minutes, obtains PDA culture medium.
1.2 penicillium purpurogenums (Penicillium purpurogenum) MHZ111 liquid fermentation and culture
1.1 test tube species are inoculated into the 500mL triangular flask equipped with 125mL PD fluid nutrient medium, 25 DEG C~28 DEG C
Under, shaking speed is with 200rmin-1~220rmin-1, fermentation 72h, obtain penicillium purpurogenum (Penicillium
Purpurogenum) MHZ111 fermentation liquid.
Wherein, potato glucose (PD) fluid nutrient medium: peeling potatoes, 200g are cut into small pieces, and boiling is added to boil
30min, 4 layers of filtered through gauze add 20g glucose, and distilled water constant volume to 1000mL boils mixing, sterilizes 20 points under the conditions of 121 DEG C
Clock obtains PD fluid nutrient medium.
1.3 solid fermentation cultures
Penicillium purpurogenum (Penicillium purpurogenum) MHZ111 fermentation liquid of step 1.2 is inoculated into equipped with rough
In the 500mL triangular flask of rice culture medium (brown rice 80g and water 125mL), every bottle of inoculation 5mL fermentation liquid, 25 DEG C of culture 40d are obtained
Penicillium purpurogenum (Penicillium purpurogenum) MHZ111 solid fermentation culture.
Wherein, solid fermentation culture medium: brown rice 80g, water 125mL sterilize 20 minutes under the conditions of 121 DEG C, obtain solid hair
Ferment culture medium.Brown rice is that paddy sloughs the caryopsis after outer protection cortex rice husk, and interior protection cortex (pericarp, kind skin, megarchidium layer) is complete
Good Rice Kernel.
2. the preparation of plant nematode inhibitor
By 1.3 penicillium purpurogenum (Penicillium purpurogenum) MHZ111 solid fermentation culture, glass is used
Stick is blended, every bottle of addition 300mL ethyl acetate, is set dynamic extraction on 20 DEG C of 150rpm/min shaking tables and for 24 hours, is extracted 3 times, takes out
Ethyl acetate phase is filtered to obtain, removes acetic acid in ethyl acetate phase with Rotary Evaporators (temperature: 30 DEG C, revolution: 70 turns) rotary evaporation
Ethyl ester obtains acetic acid ethyl ester extract, which is the active constituent of plant nematode inhibitor.
By acetic acid ethyl ester extract (solute) with methanol (solvent) dissolve, be configured to respectively concentration be respectively 1.5g/L,
The solution of 5 kinds of concentration of 1.0g/L, 0.5g/L, 0.3g/L and 0.1g/L, the solution of this 5 kinds of concentration are 5 kinds of phytotrophy lines
It is (dense to be referred to as plant nematode inhibitor 1.5 (concentration 1.5g/L), plant nematode inhibitor 1.0 for worm inhibitor
Degree is 1.0g/L), plant nematode inhibitor 0.5 (concentration 0.5g/L), (concentration is plant nematode inhibitor 0.3
0.3g/L), plant nematode inhibitor 0.1 (concentration 0.1g/L).
3, the eelworm-killing activity of plant nematode inhibitor
The acquisition of 3.1 Meloidogyne incognita ovum, egg capsule and second instar larvae
Meloidogyne incognita is saved with No. 15 indoor pot vaccination ways of the good powder of susceptible tomato variety.Be inoculated with 40d after, kind
Eggplant root system has a large amount of egg capsules to occur, and root system is gently rinsed with water, egg capsule is carefully removed, is placed in 0.5% liquor natrii hypochloritis
3min is sterilized, then with aseptic water washing 3 times, is placed in the culture dish for filling a small amount of sterile water, 4 DEG C save backup.
Separately part egg capsule is taken to be placed in the culture dish for filling a small amount of sterile water, 25 DEG C of culture 4d are primary new every collecting for 24 hours
The Meloidogyne incognita second instar larvae of hatching, room temperature preservation are spare.
Old complaint is cleaned, the segment of 0.5-1cm is cut into, is put into 500mL triangular flask, 1% liquor natrii hypochloritis is added
200mL acutely shakes 5min, is collected with 200 mesh and 500 mesh mesh screen repeated flushing, is collected into pure south by 500 mesh mesh screens
Square root-knot nematode egg, 4 DEG C save backup.
Inhibiting effect of the 3.2 plant nematode inhibitor to Meloidogyne incognita second instar larvae
By plant nematode inhibitor 1.5 (concentration 1.5g/L), plant nematode inhibitor 1.0, (concentration is
1.0g/L), plant nematode inhibitor 0.5 (concentration 0.5g/L), (the concentration 0.3g/ of plant nematode inhibitor 0.3
L), plant nematode inhibitor 0.1 (concentration 0.1g/L), sterile water, (fosthiazate is final concentration of for 20% Fosthiazate aqueous emulsion
10mg/L)；1.8% abamectin emulsifiable concentrate (the final concentration of 10mg/L of avermectin), methanol are separately added into 40 sterilized hole groups
Culture plate, every 100 μ L of hole are knitted, every kind of plant nematode inhibitor sets 4 holes.Wherein methanol is control, and other is processing.Ventilation
It is dried up in cupboard, 100 μ L nematode suspension are then added into every hole respectively, and (content of Meloidogyne incognita second instar larvae is
20.1 ± 2.1/100 μ L), it is put into 25 DEG C of incubators, records nemic death rate afterwards for 24 hours, calculating corrected mortality is to kill
Nematode drug effect.Every processing is repeated 4 times.The experimental implementation carries out in an aseptic environment.
Influence of the 1. plant nematode inhibitor of table to 2 instar larvae of Meloidogyne incognita
Note: CK1: sterile water process；The processing of CK2:20% Fosthiazate aqueous emulsion；The processing of CK3:1.8% abamectin emulsifiable concentrate
There is significant difference between the different processing of 2nd column letter.
The result shows that significant difference between the plant nematode inhibitor and sterile water of each concentration, plant nematode
Inhibitor 1.5 (concentration 1.5g/L) and plant nematode inhibitor 1.0 (concentration 1.0g/L) and avermectin and thiazole
Phosphine significant difference, and plant nematode inhibitor 0.5 (concentration 0.5g/L) and 20% Fosthiazate aqueous emulsion are suitable, plant is posted
Raw nematode inhibitor 0.3 (concentration 0.3g/L) is suitable with avermectin, and difference is not significant.
The inhibiting effect that 3.3 plant nematode inhibitor hatch Meloidogyne incognita egg capsule
The more consistent egg capsule of the development of 3 surface sterilizations is put into the plastic culture dish that each sterile diameter is 6cm,
It is separately added into 3mL plant nematode inhibitor 1.5 (concentration 1.5g/L), (concentration is plant nematode inhibitor 1.0
1.0g/L), plant nematode inhibitor 0.5 (concentration 0.5g/L), (the concentration 0.3g/ of plant nematode inhibitor 0.3
L), plant nematode inhibitor 0.1 (concentration 0.1g/L), sterile water, (fosthiazate is final concentration of for 20% Fosthiazate aqueous emulsion
10mg/L)；1.8% abamectin emulsifiable concentrate (the final concentration of 10mg/L of avermectin), methanol.Wherein methanol is control, Qi Tashi
Processing.Test carries out at 25 DEG C, and each processing plastic culture dish is obturaged with sealed membrane, to reduce pollution and liquid evaporation.
Microscopy respectively handles egg capsule hatching situation after 7d.Calculate the relative inhibition of egg capsule hatching nematode number and egg capsule hatching.Every processing weight
It is 4 times multiple.The experimental implementation carries out in an aseptic environment.
The influence that 2. plant nematode inhibitor of table hatches Meloidogyne incognita egg capsule
| Processing | Egg capsule average percentage hatch nematode (item) | Relative inhibition (%) |
| Plant nematode inhibitor 0.1 | 61.3bB | 49.9 |
| Plant nematode inhibitor 0.3 | 53.3cC | 56.4 |
| Plant nematode inhibitor 0.5 | 20.0dD | 83.7 |
| Plant nematode inhibitor 1.0 | 4.0eE | 96.7 |
| Plant nematode inhibitor 1.5 | 1.3fE | 98.9 |
| CK1 | 122.3aA | —— |
| CK2 | 2.3efE | 98.1 |
| CK3 | 2.7efE | 97.8 |
Note: CK1: sterile water process；CK2:20% Fosthiazate aqueous emulsion；The processing of CK3:1.8% abamectin emulsifiable concentrate.2nd
There is significant difference between the different processing of column letter.
The result shows that hatching between the plant nematode inhibitor of each concentration and the egg capsule of sterile water process to nematode
Influencing significant difference, especially plant nematode inhibitor 1.5 (concentration 1.5g/L) can hardly hatch, phytotrophy line
Worm inhibitor 1.0 (concentration 1.0g/L) and plant nematode inhibitor 1.5 (concentration 1.5g/L) and avermectin and thiophene
Azoles phosphine difference is not significant.
The inhibiting effect test result that Meloidogyne incognita vigor and egg capsule are hatched is shown to produce by both the above purple green
Mould (Penicillium purpurogenum) MHZ111 is one plant of great fungi for having application value, especially to Root Knot
The nematocidal effect of nematode and the inhibiting effect hatched to its egg capsule, show its good application and development prospect.
3.4 greenhouse pot cultures prevent and treat tomato Meloidogyne incognita (Meloidogyne incognita), and effect is as follows:
Material to be tested and method:
Tomato: kind L402
Nematode: Meloidogyne incognita Meloidogyne incognita
Tomato seedling in diameter 13cm, high 10cm nutritive cube in, nursery soil be through processed no nematode garden mould and sand
Soil is mixed in 1:4 ratio.By 1.3 penicillium purpurogenum (Penicillium purpurogenum) MHZ111 solid fermentation culture
Object is blended with glass bar, obtains plant nematode inhibitor.Equal tomato seedlings are inoculated with root knot line after growing 4-5 piece true leaf
Cultured nematode: being configured to the nematode suspension of 100/mL by worm, 3 apertures is uniformly inserted around plant root, by line
Worm suspension instills in aperture, and every basin is inoculated with 1500 nematodes.The same day carries out chemicals treatment, plant nematode inhibitor
100kg/hm2, 10% fosthiazate granule 50kg/hm2(CK2), 500 times of 1.8% abamectin emulsifiable concentrate (CK3), setting inoculation line
Worm but do not have to chemicals treatment tomato seedling as blank control (CK1), only pour the clear water of equivalent, 3 repetitions of each processing.Medicine
Agent processing method are as follows: plant nematode inhibitor and granule are uniformly spread fertilizer over the fields after mixing soil, and every basin pours the water of equivalent after application, with
Subject to impermeable；Missible oil is made into medical fluid and waters 200mL, is then placed in greenhouse and is cultivated.Normal field management, exists respectively
45d and 80d investigates root knot number after application.Control efficiency is determined according to root knot number.
It the results are shown in Table 3, field efficacy is shown in Fig. 1,2.
The test of 3 penicillium purpurogenum of table (Penicillium purpurogenum) MHZ111 solid fermentation culture greenhouse pot culture
As a result
| Processing | 45d root knot number | 45d control efficiency (%) | 80d root knot number | 80d control efficiency (%) |
| Plant nematode inhibitor | 13cB | 87.3 | 42dD | 86.0 |
| CK1 | 102aA | -- | 301aA | -- |
| CK2 | 15bcB | 85.2 | 51cC | 83.1 |
| CK3 | 19bB | 81.3 | 57bB | 81.1 |
Note: CK1: clear water processing；CK2:10% fosthiazate granule；The processing of CK3:1.8% abamectin emulsifiable concentrate.2nd column
There is significant difference between the processing different with the 4th column letter.
The result shows that penicillium purpurogenum (Penicillium purpurogenum) MHZ111 solid fermentation culture is not having
Under conditions of any auxiliary agent is dosed, to tomato root-knot eelworm disease preventive effect up to 80% or more.Through MHZ111 treated tomato seedling root
System is flourishing, and root knot is few, and plant strain growth is normal, does not find apparent phytotoxicity, to tomato safety, has good application value, should
Concentration has reached the concentration requirement that industrialization development utilizes.
Claims (4)
1. penicillium purpurogenum (Penicillium purpurogenum), bacterial strain number is MHZ111, in Chinese microorganism strain
The number of registering on the books of preservation administration committee common micro-organisms center is CGMCC No.11630.
2. the culture of penicillium purpurogenum described in claim 1 is by penicillium purpurogenum described in claim 1 in microbiological culture media
The middle substance cultivated in obtained culture vessel, the substance includes the metabolin of the penicillium purpurogenum and the penicillium purpurogenum.
3. following any purposes of penicillium purpurogenum described in claim 1 and/or culture as claimed in claim 2:
A1) application in Meloidogyne incognita inhibitor is being prepared；
A2) Meloidogyne incognita is inhibited to endanger the application in tomato medicament in preparation.
4. following any purposes of penicillium purpurogenum described in claim 1 and/or culture as claimed in claim 2:
B1) inhibiting the application in Meloidogyne incognita；
B2) Meloidogyne incognita is being inhibited to endanger the application in tomato.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510864461.8A CN105349434B (en) | 2015-12-01 | 2015-12-01 | The penicillium purpurogenum and its preparation method and application of one plant of intoxicating plant parasitical eelworm |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510864461.8A CN105349434B (en) | 2015-12-01 | 2015-12-01 | The penicillium purpurogenum and its preparation method and application of one plant of intoxicating plant parasitical eelworm |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105349434A CN105349434A (en) | 2016-02-24 |
| CN105349434B true CN105349434B (en) | 2019-01-15 |
Family
ID=55325499
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510864461.8A Active CN105349434B (en) | 2015-12-01 | 2015-12-01 | The penicillium purpurogenum and its preparation method and application of one plant of intoxicating plant parasitical eelworm |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105349434B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105695346B (en) * | 2016-04-25 | 2019-02-01 | 北京市农林科学院 | The sclerotium mould and its preparation method and application of one plant of intoxicating plant parasitical eelworm |
| CN106047729B (en) * | 2016-08-19 | 2019-05-24 | 云南大学 | One plant of pythium spp strain and its application |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103320327A (en) * | 2012-03-20 | 2013-09-25 | 华中农业大学 | Paecilomyces lilacinus and cultivating method thereof and applications thereof |
| CN103773697A (en) * | 2013-12-05 | 2014-05-07 | 江西天人生态股份有限公司 | paecilomyces lilacinus and application thereof |
| CN104212722A (en) * | 2013-12-12 | 2014-12-17 | 谢明 | Paecilomyces lilacinus, culture method of paecilomyces lilacinus and use of paecilomyces lilacinus in prevention and control of diseases and pests of crops |
| WO2015069708A1 (en) * | 2013-11-08 | 2015-05-14 | Novozymes Bioag A/S | Compositions and methods for treating pests |
| CN104694396A (en) * | 2013-12-09 | 2015-06-10 | 中国科学院兰州化学物理研究所 | Penicillium chrysogenum producing fungi having plant poison activity, preparation method and applications thereof |
-
2015
- 2015-12-01 CN CN201510864461.8A patent/CN105349434B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103320327A (en) * | 2012-03-20 | 2013-09-25 | 华中农业大学 | Paecilomyces lilacinus and cultivating method thereof and applications thereof |
| WO2015069708A1 (en) * | 2013-11-08 | 2015-05-14 | Novozymes Bioag A/S | Compositions and methods for treating pests |
| CN103773697A (en) * | 2013-12-05 | 2014-05-07 | 江西天人生态股份有限公司 | paecilomyces lilacinus and application thereof |
| CN104694396A (en) * | 2013-12-09 | 2015-06-10 | 中国科学院兰州化学物理研究所 | Penicillium chrysogenum producing fungi having plant poison activity, preparation method and applications thereof |
| CN104212722A (en) * | 2013-12-12 | 2014-12-17 | 谢明 | Paecilomyces lilacinus, culture method of paecilomyces lilacinus and use of paecilomyces lilacinus in prevention and control of diseases and pests of crops |
Non-Patent Citations (2)
| Title |
|---|
| Nitric Oxide Inhibitory Meroterpenoids from the Fungus Penicillium purpurogenum MHZ111;Sun J et al.;《J Nat Prod》;20160427;第79卷(第5期);1415-1422 * |
| 定殖烟草根结线虫卵和雌虫机会真菌的多样性;林森 等;《中国生态农业学报》;20121031;第20卷(第10期);摘要、第1356页左栏倒数第2段、第1357页左栏第1-2段、表1 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105349434A (en) | 2016-02-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112899201B (en) | Bacillus belgii, application thereof and method for preventing and treating banana wilt | |
| CN102876622B (en) | Biocontrol bacterium and application of biocontrol bacterium to preventing and controlling cotton blight and cotton greensickness | |
| CN104877943A (en) | Antagonistic bacterium for controlling radix rehmannia root rot and application of antagonistic bacterium | |
| CN103131646B (en) | A kind of microbiobacterial agent and its preparation method and application | |
| CN102533617A (en) | Bacillus subtilis strain and application thereof | |
| CN112899171A (en) | Rapex leucocytochys LL210, application thereof and biocontrol microbial inoculum | |
| CN109207412A (en) | A kind of resistance to bacterial wilt biocontrol bacterial strain and its application | |
| CN106591157A (en) | Aspergillus tubingensis with disease prevention and growth promoting functions as well as preparation and application of aspergillus tubingensis metabolites | |
| CN105695346B (en) | The sclerotium mould and its preparation method and application of one plant of intoxicating plant parasitical eelworm | |
| CN105238709A (en) | Marine actinomycete strain with meloidogyne insecticidal activity and application of marine actinomycete strain | |
| CN105838642A (en) | Actinomycetes for preventing and treating peanut diseases and application of actinomycetes | |
| CN113862156B (en) | Fusarium oxysporum (Fusarium oxysporum) K2018-1418 and application thereof | |
| CN105462858A (en) | Short and dense trichoderma brevicompactum and application thereof in cucumber fusarium wilt prevention and control | |
| CN103451111B (en) | Saline-alkali tolerant trichoderma harzianum and application thereof | |
| CN105349434B (en) | The penicillium purpurogenum and its preparation method and application of one plant of intoxicating plant parasitical eelworm | |
| CN104560735B (en) | Grey green soy bean endogenetic fungus TPL35 and its application in controlling plant diseases | |
| CN111334458B (en) | Biocontrol actinomycetes and application thereof in prevention and control of ginger stem basal rot or soybean epidemic disease | |
| CN104531543B (en) | Grey green soy bean endogenetic fungus TPL25 and its application in controlling plant diseases | |
| CN105695376B (en) | One plant of simple bacillus for killing plant root-knot nematode and its application | |
| CN106148221A (en) | The stenotrophomonas antibacterial of one strain induction Semen arachidis hypogaeae root-knot nematode resistant | |
| CN102250781A (en) | Streptomyces strain for inhibiting harm of Phytophthora parasitica var. nicotianae and application thereof | |
| CN100489083C (en) | Penicillium fungus with nematocidal activity and its preparing method and use | |
| CN105524871A (en) | Method for separating and screening out antagonistic bacterium from lycoris aurea bulb | |
| CN110218671A (en) | One plant of production water streptomycete and its application in biological control | |
| CN109207381A (en) | It is a kind of prevent and treat nematodiasis biocontrol bacterial strain SFC-3 and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |