CN102250781A - Streptomyces strain for inhibiting harm of Phytophthora parasitica var. nicotianae and application thereof - Google Patents
Streptomyces strain for inhibiting harm of Phytophthora parasitica var. nicotianae and application thereof Download PDFInfo
- Publication number
- CN102250781A CN102250781A CN2010100011440A CN201010001144A CN102250781A CN 102250781 A CN102250781 A CN 102250781A CN 2010100011440 A CN2010100011440 A CN 2010100011440A CN 201010001144 A CN201010001144 A CN 201010001144A CN 102250781 A CN102250781 A CN 102250781A
- Authority
- CN
- China
- Prior art keywords
- tobacco
- bacterial strain
- black shank
- strain
- fermented liquid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
Aiming at the existing defects in preventing and controlling black shank of tobacco, the invention provides Streptomyces misawanensis D35 for inhibiting Phytophthora parasitica var. nicotianae. The strain was collected in China General Microbiological Culture Collection Centre (CGMCC) on August 27, 2009 with the collection number of CGMCC No: 3250. The invention also provides application of the strain in effectively inhibiting diffusion of Phytophthora parasitica var. nicotianae in tobacco, reducing disease incidence, improving the tobacco yield and quality, facilitating the development of biological prevention and control products and further promoting the safe control of Phytophthora parasitica var. nicotianae.
Description
Technical field
The present invention relates to a streptomycete and be used to suppress the purposes that tobacco black shank bacterium endangers, more particularly the invention provides the preservation strain that suppresses tobacco black shank bacterium harm, the harm that can alleviate black shank widely.The invention belongs to the technical field of control black shank harm tobacco.
Background technology
Black shank (Phytophthora parasitica var.nicotiane) is the class oomycetes disease that van Breda de Haan1896 finds on Indonesia Java tobacco, mainly infects tobacco root and basal part of stem.This disease is the destructive disease of tobacco, simultaneously also is to endanger one of severe diseases in the World tobacco production.Nineteen twenty-two just becomes the serious plant disease in Florida, US, Kansas State cigar district.After nineteen twenty-four, this disease has been dispersed throughout temperate zone, the whole world, subtropics and torrid areas vega.Present black shank is distributed widely in China and respectively produces the cigarette district.According to 2004～2005 years whole nation 15 provinces (city) tobacco infectious disease investigation results, there are Anhui, Chongqing, Sichuan, Guizhou, Hunan in the province that the balck shank disease is serious (city), secondly be Henan, Yunnan, Shandong, Fujian etc., and should disease how to mix generation, its hazardness is further increased the weight of with tobacco bacterial wilt.The black shank average attack rate is 10%～20%, and the field piece that sickness rate is high reaches 75%, and is serious even cause total crop failure.According to estimation, the disease that China tobacco in 2006 causes because of balck shank is with a toll of 27656.1 ten thousand yuan.Particularly generation is usually mixed in each cigarette district again with tobacco bacterial wilt on the south the Changjiang river, and is more serious to the harm that tobacco is caused.This disease is very huge to output and output value loss that tobacco planting causes, only is lower than tobacco flower leaf type virus disease (TMV, CMV and PVY) at present, occupies the 2nd.This disease shows as mainly that tobacco is downgraded, here withers, yellow leaf, root and basal part of stem necrosis, and average attack rate is 5% to 12%, and heavy person's loss reaches 75%, even total crop failure.Measures such as main at present employing breeding resistant variety, crop rotation and chemical control prevent and treat black shank.When using the chemical bactericide controlling plant diseases, not only correspondingly bring the safety problem of others, but also bring the influence of non-target organism and the development problem of this germ resistance etc.The 21st resolution of 1992 " world environments with development conference " point out " sale of inner control chemical pesticide and use in the world, at the beginning of 2010, the output of biological pesticide will account for the agricultural chemicals total amount 60% ".Wang Li etc. utilize the cell engineering breeding to succeed in the laboratory, but still fail to promote the use of on producing, and transgenic technology is used at the breeding for disease resistance of black shank and also do not appeared in the newspapers as yet.The chemical agent that is used for preventing and treating black shank in the production mostly is phenylamide and phosethyl Al is equal to several systemic fungicides a kind of or that mechanism of action is identical, is easy to produce resistance, thereby causes that drug effect descends, and dosing increases.In the practice of control black shank, the disease emergence period is mainly adopted the chemical agent control, though the chemical agent control has been brought into play vital role and obtained tangible result.But tobacco is a leaf uses crop, behind the applying pesticides, is easy to influence quality, and the residual serious harm HUMAN HEALTH of medicine.
Meta-bolites with microorganism comes controlling plant diseases, beginning sees states such as the U.S., Britain, Japan the earliest, waits controlling plant diseases with medical microbiotic such as Streptomycin sulphate (Streptomycin), terramycin (Oxytertracyline), sallow mould (Griseofulvin).The research of China's agricultural antibiotic is started late, and starts from early 1950s, and development has obtained very big achievement rapidly so far.
Actinomycetes are the extremely abundant Microbial resources of a class, wherein a lot, especially streptomyces can produce multiple antibiotics material, being used for control of plant disease has wide prospect.The anti-oomycetes natural radioactivity actinomyces strain of having reported mainly contains both at home and abroad: Zhou Chengping separates the actinomycetes WZ60 bacterial strain of acquisition 1 strain to the strong bacteriostatic activity of phytophthora blight of pepper tool from the soil sample that the Wuzhi Mountain, Hainan primitive area is gathered, the test-results of field control capsicum epidemic disease shows that WZ60 has 90% good prevention effect to capsicum epidemic disease; Lin Birun, Xie Dashuan etc. are separated to 1 streptomycete (Streptomyces spp.), and the microbiotic 2507 (bandung mycin) of its generation has good antibiosis to the cucumber parasitica (Phytophthora melonis Kat.sura) in seedling stage; Samac DA etc. discovers that the antibiotic streptomycete bacterial strain of great majority generation has restraining effect to the growth of 3 different strains of clover phytophthora.Wherein two bacterial strains reduce by the fungus-caused fallen leaves of clover phytophthora; Gil-Jae Joo separation in 2005 obtains a streptomycete EF-76 and produces geldanamycin.Discover that its recombinant bacterial strain FP-54 has stronger antagonism to bacillus cereus ATCC 14579 and phytophthora root rot bacterium; Give birth to actinomycetes strain gCLA4 in this grade of Ali's agate was separated in 2007 from plant roots, stem and blade, the bacteria-free filtrate of this bacterial strain can the sporangial formation of strongly inhibited germ and the release of zoospore, and its mycelial growth is also had the obvious suppression effect.Dredge elegant woods, An Derong discovers that by cucumber downy mildew spore germination test and excised leaf bacteriostatic test zuelaemycin produces bacterium S-5120 bacterial strain and zuelaemycin all has strong restraining effect to cucumber downy mildew.Liu Letao etc. filtered out the actinomycetes A10 that phytophthora blight of pepper (Phytophthora capsici) is had antagonistic action from the capsicum rhizosphere soil in 2008, the inhibiting rate that this bacterial strain is sprouted sporocyst reaches 89.3%.
Biocontrol microorganisms diseases prevention principle is direct antagonism black shank cause of disease, some biocontrol microorganisms can also produce resistance to balck shank by evoking tobacco, if biological agent is used in good time, can play a secular protection effect for the control of disease, though the application ground zero of biocontrol microorganisms in biological control, more existing good progress.Utilize biocontrol microorganisms control black shank, not only can protect environment, and also can not make developing immunity to drugs of black shank bacterium, also can not produce any harm to plant itself and cause harm.The biological control of black shank is an important technology that ensures the tobacco Sustainable development, selects that a small amount of low toxicity is efficient, the biological pesticide of noresidue kills or suppress pathogenic bacteria for use.For the research and development novel biopesticide provides resource, the biological control of black shank presents good prospect.
Summary of the invention
The present invention is directed to destructive disease-black shank of tobacco, provide a strain biological and ecological methods to prevent plant disease, pests, and erosion active preservation strain, by suppressing its growth of pathogenic bacteria, thereby effectively control the harm of this disease on tobacco, improve the yield and quality of tobacco.
Therefore, first goal of the invention of the present invention provided a streptomycete strain D35, and wherein said bacterial strain has been preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center, preserving number: CGMCCNo.3250 on 08 27th, 2009.
In a specific embodiments, the physiologic character of described streptomyces strain D35 is:
(1) this bacterial strain is at Gause I substratum (Zulkovsky starch 20g, K
2HPO
40.5g, KNO
31g, FeSO
47H
2O0.01g, NaCl 0.5g, MgSO
40.5g, agar 20g, distilled water 1000mL, PH7.2.) go up growth, bacterium colony closely, many wrinkles, rugged, the cot shape, puce, aerial hyphae and substrate mycelium are all very abundant, aerial mycelium forms spore chain, spore is purplish grey;
(2) at Gause I liquid nutrient medium (Zulkovsky starch 20g, K
2HPO
40.5g, KNO
31g, FeSO
47H
2O0.01g, NaCl 0.5g, MgSO
40.5g, distilled water 1000mL, PH7.2.) in growth produce the pigment of brown;
(3) the D35 bacterial strain can utilize L-arabinose, D-pectinose, glucose, fructose, sucrose, rhamnosyl, raffinose and seminose, maltose;
(4) bacterial strain can not make gelatine liquefication, starch hydrolysis, can not decomposition of cellulose, but can produce hydrogen sulfide;
(5) 28 ℃ is the optimum growth temperature that bacterial strain produces antimicrobial substance, and antagonistic strain all can produce antimicrobial substance in pH value 5.0～9.0.
Because the fermented liquid that is obtained by above-mentioned streptomyces strain D35 has the effect of good inhibition black shank, so its bacterial strain fermentation liquor also is another specific embodiments.
In another embodiment, the method for screening described bacterial strain D35 comprises:
(1) collects 72 parts of pedotheques from Nature Reserve such as tall bottle with spout mountain, Hunan, the Huashan, Jiu Zhaigous, separated 428 actinomycetes strains;
(2) be indicator with tobacco black shank bacterium (oomycetes), adopt dull and stereotyped face-off growth method that each bacterial strain antagonistic activity is screened, obtain an actinomycetes strain D35 that anti-microbial activity is high;
(3) bacterial strain fermentation liquor adds 3mL filtrate (diluting 5 times) at each culture dish after biofilter filters;
(4) choose the bacterial strain high to the tobacco black shank bacterium percentage mycelial inhibition, wherein preferred inhibiting rate is 80.3% bacterial strain.
Second goal of the invention of the present invention provides a kind of method of utilizing above-mentioned bacterial strains to be used to prevent and treat black shank.
In one embodiment, described method comprises:
(1) cultivates above-mentioned bacterial strains D35, obtain bacterial strain fermentation liquor;
(2), use above-mentioned fermented liquid directly to sparge tobacco, with the generation of control black shank at the their early stage of black shank.
In a specific embodiments, the preferred fermented liquid of 25 or 50 times of dilutions that uses is sprayed in the step 2.
In another embodiment, described method comprises:
(1) cultivates above-mentioned bacterial strains D35, obtain bacterial strain fermentation liquor;
(2) behind the tobacco transplant survival, use the above-mentioned bacterial strains fermented liquid, tobacco is irritated root, with the generation of prevention black shank.
In another embodiment, the preferred fermented liquid of 2,5,10 times of dilutions that uses is irritated root in the step 2.
The 3rd goal of the invention of the present invention is that protection utilizes above-mentioned bacterial strains to be used to improve the purposes of tobacco production and quality.
In a specific embodiments, utilize above-mentioned bacterial strains to prepare fermented liquid, or directly utilize bacterial strain fermentation liquor, by aforesaid direct spray method or root-pouring method, suppress tobacco black shank bacterium in the intravital diffusion of tobacco, thereby reduce the tobacco sickness rate, to realize improving the purposes of tobacco production and quality.
Technique effect
1. streptomycete bacterial strain of the present invention can effectively suppress its growth of pathogenic bacteria, thereby effectively controls the harm of this disease on tobacco, improves the yield and quality of tobacco;
2. streptomycete bacterial strain of the present invention, select 5 times of fermented liquid dilutions and substratum mixing for use after, to the inhibiting rate 80.3% of tobacco black shank bacterium;
3. streptomycete bacterial strain of the present invention when selecting 25,50 times of sprayings of fermented liquid dilution for use, is respectively 86.8% and 65.8% to the preventive effect effect of black shank;
4. streptomycete bacterial strain of the present invention when selecting for use 2,5,10 times of fermented liquid dilutions to irritate roots, is respectively 57.5%, 55% and 47.5% to the preventive effect effect of black shank.
Specific embodiments
Embodiment 1: the screening of streptomyces strain D35
72 parts of pedotheques have been collected from Nature Reserve such as tall bottle with spout mountain, Hunan, the Huashan, Jiu Zhaigous; adopt the Gause I substratum to screen, screen 428 bacterial strains, carry out dull and stereotyped antagonistic experiment one by one; obtain black shank bacterium and suppress bacterial strain, give birth to and survey experiment.The bacterial strain D35 of separation and purification is inoculated in the Gause I liquid nutrient medium.28 ℃ of following shake flask fermentation 60h use the biofilter filtering fermentating liquid.In each sterile petri dish, add filtered liquid 3mL, pour PDA substratum (about 55 ℃) into, shake up, make flat board, treat the substratum cooling after, will cultivate the small bacteria block that pathogenic bacteria on PDA breaks into 4～5mm with aseptic punch tool, be inverted and move that to be put into flat board central.Repeat 3 times.Put into incubator after leaving standstill 1h, cultivate 5d down for 28 ℃.Measure bacterium piece diameter with the right-angled intersection method, and observe inhibition zone transparency and neat in edge degree.
Embodiment 2: the physiological and biochemical property of streptomyces strain D35 and preservation thereof
The bacterial strain of screening was preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center, preserving number: CGMCCNo.3250 on 08 27th, 2009.
The physiologic character of this bacterial strain:
The D35 bacterial strain has the feature of typical streptomyces, grows tight, the many wrinkle of bacterium colony, rugged, cot shape, puce on the Gause I substratum.Aerial hyphae and substrate mycelium are all very abundant, and aerial mycelium forms spore chain, and spore is purplish grey, and growth produces the pigment of brown in the Gause I liquid nutrient medium.The D35 bacterial strain can utilize L-arabinose, D-pectinose, glucose, fructose, sucrose, rhamnosyl, raffinose and seminose, maltose.Bacterial strain can not make gelatine liquefication, starch hydrolysis, can not decomposition of cellulose, but can produce hydrogen sulfide.28 ℃ is the optimum growth temperature that bacterial strain produces antimicrobial substance, and antagonistic strain all can produce antimicrobial substance in pH value 5.0～9.0.
The evaluation of this bacterial strain: according to constructional feature and the conserved regions design special primer thereof of actinomycetes 16S rDNA, forward primer 16sF:AGAGTTTGATCCTGGCTCAG; Reverse primer 16sR:AAGGAGGTGATCCAGCCGCA.Synthetic by Shanghai bio-engineering corporation.With the genomic dna is template, adopts PCR method 25 μ L reaction systems amplification 16S rDNA, and the pcr amplification condition is: 94 ℃ of pre-sex change 5min; 94 ℃ of sex change 1min, 56 ℃ of renaturation 1min, 72 ℃ are extended 2min, 25 circulations; 72 ℃ are extended 8min.The agarose of employing 1.0% is to the pcr amplification product electrophoresis detection.Adopt match Parkson, Beijing silica gel model TMPCR of gene engineering company limited product purification test kit, carry out the recovery of pcr amplification product.The pGM-T of TIANGEN Biotech (Beijing) Co., Ltd. clone test kit carries out the connection of pcr amplification product and the conversion that connects product.To transform good thalline liquid culture, serve the Hai Shenggong order-checking.Obtain bacterial strain 16S rDNA sequence through order-checking, by the internet, submit sequence to ncbi database, existing actinomycetes 16S rDNA sequence is carried out the similarity comparative analysis in application BLAST and the database.
The 16S rDNA nucleotide sequence of bacterial strain D35 is long to be 1440bp, with its with blast search to close bacterial strain carry out 16S rDNA sequence relatively, with MEGA software with close sequence construct phylogenetic tree.The result shows that the 16S rDNA sequence homology of the 16S rDNA sequence of D35 and three damp streptomycetes (Streptomyces misawanensis) is very high, reaches 99%.Combining form is learned feature, cultural characteristic and analysis of physio biochemical characteristics, and it is accredited as three damp streptomycetes of streptomyces.
Embodiment 3: streptomyces strain D35 preparation of fermentation liquid
(1) cultivation of bacterial strain
Preparation Gause I slant medium, inoculation is put into 28 ℃ of incubators and was cultivated 72 hours, preserves standby.
(2) preparation fermented liquid: preparation shake-flask culture base (being the Gause I nutrient solution), packing triangular flask before the sterilization (500mL bottle, dress 100mL liquid), conventional sterilization, the cooling back is on Bechtop, the method that washes with water directly washes the inclined-plane thalline and inserts in the fermentation triangular flask, shake-flask culture, 28 ℃, 200r/min cultivates 48h.Change ferment tank over to, with reference to the preparation (prescription: Zulkovsky starch 30g, K of fermentation tank culture medium at once
2HPO
40.5g, KNO
31g, FeSO
47H
2O 0.01g, NaCl 0.5g, MgSO
40.5g, peptone 10g, distilled water 1000mL, PH7.2.), sterilization, inoculation of cooling back and fermentation, 28 ℃, 200r/min cultivates the 60h stuck fermentation, at once with canned plastic bag packaging fermented liquid.
Embodiment 4: streptomyces strain D35 thalline and fermented liquid thereof are used for suppressing the technology of tobacco black shank bacterium on indoor cultivation base flat board
The D35 thalline suppresses the technology of tobacco black shank bacterium: with punch tool tobacco black shank bacterium is broken into the 5mm small bacteria block, tobacco black shank bacterium bacterium piece is placed by dull and stereotyped central authorities at oat medium, the thalline of equidistant inoculating strain D35 on the distance circumference of central 3.5cm.Putting into 25 ℃ of incubators cultivated 3～5 days.Observation inhibition zone size, transparency and neat in edge degree.
Wherein, the technology that suppresses tobacco black shank bacterium behind the fermented liquid of usefulness bacterial strain D35 and the substratum mixing: cultivated 60 hours at 28 ℃ of bottom fermentations.Cultured fermented liquid is at first used the packing of 10mL centrifuge tube, and 15000rpm is centrifugal 10 minutes in refrigerated centrifuge, filters with biofilter then and obtains culturing filtrate.When measuring anti-microbial activity, in each sterile petri dish, add 3mL culturing filtrate and oat medium mixing, make flat board, after the plate culture medium cooling, with the bacterium cake of the diameter 5mm that cuts in advance be inverted move into dull and stereotyped central.Leave standstill and put into 28 ℃ of incubators behind the 1h and cultivate, each repeats 3 times.Wait to contrast and all cover with, measure bacterium cake diameter with the right-angled intersection method, and observe transparency and neat in edge degree, the record result also is calculated as follows inhibiting rate:
Mean value-bacterium cake the diameter of two diameters of colony diameter=perpendicular
The fermented liquid of inhibiting rate (%)=(contrast colony diameter-processing colony diameter)/(contrast colony diameter-bacterium cake diameter) * 100% actinomycetes D35 bacterial strain has high inhibitory to the growth of tobacco black shank bacterium, reaches 80.3%.
Embodiment 5: streptomyces strain D35 fermented liquid is used to prevent and treat black shank
At the their early stage of black shank, adopt the dilution of D35 fermented liquid directly to sparge tobacco for 25 times, can suppress tobacco black shank bacterium in the intravital diffusion of tobacco, the preventive effect effect can reach 86.8%.Or behind the tobacco transplant survival, use above-mentioned fermented liquid dilution to irritate root for 5 times, and can effectively prevent the generation of black shank, the preventive effect effect can reach 55%.
Table 1 utilizes spray method and root-pouring method to prevent and treat black shank
Wherein, disease index=∑ (strain numbers at different levels * this disease level value)/(investigating total strain number * superlative degree value) * 100
Prevention effect=(the contrast disease refers to-handle that disease refers to)/contrast disease to refer to * 100%
Black shank severity graded index
0 grade: complete stool is anosis;
1 grade: stem's scab is no more than below 1/2 or 1/2 of stem girth, and leaf is slightly wilting, or scab appears in bottom minority blade;
2 grades: stem's scab surpasses the 1/2 or 1/2 wilting with blade of stem girth;
3 grades: stem's scab is around stem girth or 2/3 wilting with blade;
4 grades: the full leaf of diseased plant is wilting or withered.
Claims (10)
1. one kind has the three damp streptomycete D35 (Streptomyces misawanensis) that suppress tobacco black shank bacterium, wherein said bacterial strain has been preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center, preserving number: CGMCC No.3250 on 08 27th, 2009.
2. the described streptomyces strain D35 of claim 1, its physiologic character is:
(1) this bacterial strain is grown on the Gause I substratum, tight, the many wrinkle of bacterium colony, rugged, and the cot shape, puce, aerial hyphae and substrate mycelium are all very abundant, and aerial mycelium forms spore chain, and spore is purplish grey;
(2) pigment of growth generation brown in the Gause I liquid nutrient medium;
(3) the D35 bacterial strain can utilize L-arabinose, D-pectinose, glucose, fructose, sucrose, rhamnosyl, raffinose and seminose, maltose;
(4) bacterial strain can not make gelatine liquefication, starch hydrolysis, can not decomposition of cellulose, but can produce hydrogen sulfide;
(5) 28 ℃ is the optimum growth temperature that bacterial strain produces antimicrobial substance, and antagonistic strain all can produce antimicrobial substance in pH value 5.0～9.0.
3. a bacterial strain fermentation liquor and preparation thereof that obtains by claim 1 or 2 described three damp streptomycete D35.
4. method that is used to screen claim 1 or 2 described streptomyces strain D35 mainly comprises:
With tobacco black shank bacterium (oomycetes) is indicator, adopts dull and stereotyped face-off growth method that each bacterial strain antagonistic activity is screened, and obtains an actinomycetes strain D35 that anti-microbial activity is high.
5. the method for a bacterial strain control black shank that utilizes claim 1 or 2 comprises:
(1) cultivates above-mentioned bacterial strains D35, obtain bacterial strain fermentation liquor;
(2), use above-mentioned fermented liquid directly to sparge tobacco, with the generation of control black shank at the their early stage of black shank.
6. the method for claim 5 wherein preferably uses the fermented liquid of 25 or 50 times of dilutions to spray in the step 2.
7. the method for a bacterial strain control black shank that utilizes claim 5 also comprises:
(1) behind the tobacco transplant survival, use the above-mentioned bacterial strains fermented liquid, tobacco is irritated root, with the generation of prevention black shank.
8. the method for claim 7 preferably uses the fermented liquid of 2,5,10 times of dilutions to irritate root.
9. bacterial strain or the bacterial strain fermentation liquor of claim 3 and purposes that preparation is used to improve tobacco production and quality thereof of utilizing claim 1 or 2.
10. the purposes of claim 9, also comprise and wherein utilize above-mentioned bacterial strains to prepare fermented liquid or directly utilize bacterial strain fermentation liquor, by aforesaid direct spray method or root-pouring method, suppress tobacco black shank bacterium in the intravital diffusion of tobacco, thereby reduce the method for tobacco sickness rate.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010100011440A CN102250781A (en) | 2010-01-13 | 2010-01-13 | Streptomyces strain for inhibiting harm of Phytophthora parasitica var. nicotianae and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010100011440A CN102250781A (en) | 2010-01-13 | 2010-01-13 | Streptomyces strain for inhibiting harm of Phytophthora parasitica var. nicotianae and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102250781A true CN102250781A (en) | 2011-11-23 |
Family
ID=44978353
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010100011440A Pending CN102250781A (en) | 2010-01-13 | 2010-01-13 | Streptomyces strain for inhibiting harm of Phytophthora parasitica var. nicotianae and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102250781A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102533566A (en) * | 2011-12-06 | 2012-07-04 | 郑州大学 | (Aspergillus fumigates)Ty-1 and application of (Aspergillus fumigates)Ty-1 |
| CN103305563A (en) * | 2013-06-14 | 2013-09-18 | 湖南农业大学 | Method for extracting alisamycin from streptomyces |
| CN107858316A (en) * | 2017-12-23 | 2018-03-30 | 湖南农业大学 | Stenotrophomonas maltophilia, screening technique and the application of antagonism tobacco black shank bacterium |
| CN110229868A (en) * | 2019-06-19 | 2019-09-13 | 河南省农业科学院烟草研究所 | A kind of test method inhibiting Phytophthora nicotianae Breda |
| CN115232777A (en) * | 2022-09-23 | 2022-10-25 | 云南省微生物发酵工程研究中心有限公司 | Streptomyces pseudolightyellow bacterial agent for preventing and treating tobacco black shank and application thereof |
-
2010
- 2010-01-13 CN CN2010100011440A patent/CN102250781A/en active Pending
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102533566A (en) * | 2011-12-06 | 2012-07-04 | 郑州大学 | (Aspergillus fumigates)Ty-1 and application of (Aspergillus fumigates)Ty-1 |
| CN102533566B (en) * | 2011-12-06 | 2013-08-28 | 郑州大学 | (Aspergillus fumigates)Ty-1 and application of (Aspergillus fumigates)Ty-1 |
| CN103305563A (en) * | 2013-06-14 | 2013-09-18 | 湖南农业大学 | Method for extracting alisamycin from streptomyces |
| CN103305563B (en) * | 2013-06-14 | 2014-12-03 | 湖南农业大学 | Method for extracting alisamycin from streptomyces |
| CN107858316A (en) * | 2017-12-23 | 2018-03-30 | 湖南农业大学 | Stenotrophomonas maltophilia, screening technique and the application of antagonism tobacco black shank bacterium |
| CN110229868A (en) * | 2019-06-19 | 2019-09-13 | 河南省农业科学院烟草研究所 | A kind of test method inhibiting Phytophthora nicotianae Breda |
| CN115232777A (en) * | 2022-09-23 | 2022-10-25 | 云南省微生物发酵工程研究中心有限公司 | Streptomyces pseudolightyellow bacterial agent for preventing and treating tobacco black shank and application thereof |
| CN115232777B (en) * | 2022-09-23 | 2022-12-23 | 云南省微生物发酵工程研究中心有限公司 | Streptomyces pseudolightyellow bacterial agent for preventing and treating tobacco black shank and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105886428B (en) | One plant of Streptomycesalbidoflhaving and its application in microbial manure | |
| CN109055281A (en) | Bei Laisi bacillus ZF2 and its application in control of plant disease | |
| CN101575574B (en) | Trichoderma harzianum composite bacteria culture and application of trichoderma harzianum composite bacteria culture in aspect of plant protection | |
| CN104531559B (en) | Bacillus amyloliquefaciens Lh 1 and its application | |
| CN102776130B (en) | Metarhizium anisopliae and application thereof | |
| CN109097295A (en) | Bei Laisi Bacillus strain HN03 and its application | |
| CN109207412B (en) | Bacterial wilt-resistant biocontrol strain and application thereof | |
| CN105441366B (en) | Methylotrophic bacillus ZBL-1 is applied in preventing cotton verticillium wilt | |
| CN104560827B (en) | A kind of biocontrol actinomycetes bacterial strain for preventing and treating tobacco bacterial wilt and its application | |
| CN106399178B (en) | Bacillus amyloliquefaciens and its application with degradation Phos and bacteriostasis | |
| CN106399177B (en) | Bacillus amyloliquefaciens and its microbial inoculum with degradation Phos and bacteriostasis | |
| CN111073825B (en) | Bacterium with plant soil-borne disease resistance effect and application thereof | |
| CN105543132A (en) | Bacillus methylotrophicus YB-F7 and application thereof in preventing plant diseases | |
| CN102839131A (en) | Trichoderma viride and application thereof | |
| CN106399152A (en) | Streptomyces having inhibitory effect on phytophthorasojae root rot fungi, biocontrol preparation and preparation method of biocontrol preparation | |
| CN110358710A (en) | One plant of bacillus laterosporus and preparing the application in disease-resistant saline-alkali tolerant functional microorganism preparation | |
| CN102787084A (en) | Bacillus methylotrophicus 4-L-16 for prevention and control of banana vascular wilt and its application | |
| CN102250781A (en) | Streptomyces strain for inhibiting harm of Phytophthora parasitica var. nicotianae and application thereof | |
| CN103451111B (en) | Saline-alkali tolerant trichoderma harzianum and application thereof | |
| CN103451112B (en) | Saline-alkali tolerant trichoderma longibrachiatum and application thereof | |
| CN101518264B (en) | Microbial preparation for preventing and controlling plant silborne fungal diseases, and application thereof | |
| CN102851245A (en) | Tobacco endophyte strain inhibiting tobacco bacterial wilt, and microbial agent thereof | |
| CN103146609B (en) | Pseudomonas fluorescens and method for preventing phytophthora capsici thereby | |
| CN104531571A (en) | Pseudomonas fluorescens and biological preparation and application in preventing and controlling sugarcane smut | |
| CN101961013A (en) | Application of toyocamycin to controlling tomato gray mold |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20111123 |