CN104673915B - Rapid detection kit for gene single-nucleotide polymorphism site and method for rapid detection kit - Google Patents
Rapid detection kit for gene single-nucleotide polymorphism site and method for rapid detection kit Download PDFInfo
- Publication number
- CN104673915B CN104673915B CN201510079092.1A CN201510079092A CN104673915B CN 104673915 B CN104673915 B CN 104673915B CN 201510079092 A CN201510079092 A CN 201510079092A CN 104673915 B CN104673915 B CN 104673915B
- Authority
- CN
- China
- Prior art keywords
- detection kit
- wild type
- beacon
- molecular beacon
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a rapid detection kit for a gene single-nucleotide polymorphism site. The rapid detection kit comprises a PCR reaction mixed liquid, wherein the PCR reaction mixed liquid is prepared from the following raw materials: DNA polymerase, dNTPs, an upstream primer, a downstream prime, a mutant type molecular beacon, a wild type molecular beacon, MgCl2, a PCR buffer solution and a cell lysis solution. The invention provides a rapid detection kit, which is high in monitoring efficiency, convenient for clinical medication and rapid in diagnosis, for the gene single-nucleotide polymorphism site, and a detection method for the rapid detection kit.
Description
Technical field
The invention belongs to biology field, be specifically related to a kind of gene mononucleotide polymorphism site and quickly detect examination
Agent box and method thereof.
Background technology
Single nucleotide polymorphism (Single Nucleotide Polymorphism, SNP) refer to due to conversion, transversion,
The reasons such as insertion, disappearance, make Different Individual there is the polymorphic of variety classes base on genomic DNA specific nucleotide position
Property.SNP is the most likely in gene order, it is also possible on the non-coding sequence beyond gene.It is positioned at the SNP of coding region
(coding SNP, cSNP) is fewer, but it is significant in hereditary research, and therefore the research of cSNP is more
Concerned.From the impact on biological hereditary character, cSNP can be divided into again 2 kinds: one is synonym cSNP
(synonymous cSNP), i.e. the change of the coded sequence caused by SNP has no effect on the aminoacid sequence of its protein translated
Row, mutating alkali yl is identical with the implication of unmutated base；Another kind is non-synonym cSNP (non-synonymous cSNP), refers to
The change of base sequence can make to change with it for the protein sequence of template translation, thus have impact on the function of protein.
This change is often the immediate cause causing biological character to change.Can be by studying the character of SNP, it is determined that the type of disease.
Research finds, SNP is relevant to numerous disease, determines the susceptibility of human diseases and the diversity of drug reaction.
The research that population genetics, pharmacy industry, prudence, cancer and hereditary are even evolved by SNP all will produce inestimable
Impact.By research SNP collection of illustrative plates, can more profoundly recognize cancer, diabetes, vascular conditions and some psychotic disorder
Mechanism Deng the much higher genopathy of sickness rate.
Molecular beacon (molecular beacon) is a kind of about 5 ' and 3 ' ends self, one 8 base of formation
The stem ring double labelling oligonucleotide probe of hairpin structure, the nucleic acid array complementation pairing at two ends, therefore it is marked at the fluorescence of one end
Group be marked at the quenching group of the other end immediately adjacent to.Under this configuration, the photon produced after fluorophor is excited
It is quenched agent cancellation, so fluorescence will not be produced.During high-temperature denatured or anneal afterwards, this structure is broken
Bad, cause fluorophor away from quenching group, fluorescence just can be excited and detect.
At present the detection method main restrictive fragment length polymorphism (RFLP) of SNP, single-strand conformation polymorphism (SSCP),
Allele specific oligonucleotide oligonucleotide (ASO) hybridization, gene chip, sonde method, conversion, direct sequencing etc..These skills
The sample of art detection is desirable that the DNA of extraction purification, as template, and can not be directly added into cell and react, extraction purification
DNA, adds extraction blood and extracts the step of blood DNA.4 hours are at least needed to extraction purification DNA from blood drawing；And
Restriction fragment length polymorphism, single-strand conformation polymorphism, allele specific oligonucleotide oligonucleotide hybridization, gene chip, pyrophosphoric acid
Needing multiple step, operation complexity during the technical operation such as method, direct sequencing, take time and effort, the detection cycle at least needs one week
Time.
It is currently used for the multiplex sonde method of method of Clinical detection SNP, utilizes the DNA of molecular beacon labelling extraction purification, inspection
Survey the character of SNP, thus judge the type of disease, but, the DNA of extraction purification wants 8 the most at the soonest as template, detection
Hour, the efficiency of detection is low, it is difficult to meet the quick diagnosis instructing clinical application.
Summary of the invention
The technical problem to be solved in the present invention is to provide a kind of monitors the quick diagnosis gene that efficiency is high, facilitate clinical application
Mononucleotide polymorphism site quick detection kit and detection method thereof.
In order to solve above-mentioned technical problem, the present invention provides following technical scheme: gene mononucleotide polymorphism site is fast
Speed detection kit, including PCR reaction mixture, PCR reaction mixture raw material include archaeal dna polymerase, dNTPs, forward primer,
Downstream primer, mutant molecules beacon, wild type molecular beacon, MgCl2, PCR buffer and cell pyrolysis liquid.
Use the gene mononucleotide polymorphism site quick detection kit of technical solution of the present invention, this PCR mixed liquor
In PCR buffer contribute to stablizing of enzyme, be to polymerase provide an optimal catalytic reaction condition；
DNTP is the abbreviation of deoxy-ribonucleoside triphosphate (dideoxyribonucleotide triphosphate),
DNTPs is then to be mixed in the same scale by four kinds of Deoxydization nucleotides (dATP, dGTP, dTTP, dCTP), is DNA replication dna
Raw material；
MgCl2Effect be to provide Mg2+Formation complex, only this species complex is combined just with dNTP and DNA profiling
Can be by archaeal dna polymerase identification；
Archaeal dna polymerase, with DNA for replicating template, copies to the enzyme of 3' end by 5' end points from DNA.
Forward primer, downstream primer are as the starting point of DNA replication dna, owing in synthesizing at DNA, archaeal dna polymerase is the most permissible
New nucleotide is added on existing DNA, it is impossible to specify starting point, therefore, when nucleic acid synthetic reaction, forward primer,
Downstream primer carries out, as each polynucleotide chain, the starting point that extends and works.
The effect of cell pyrolysis liquid is to dissolve Cytoplasm and cell membrane, and between saboteur, many faint chemical bonds, decompose
Some protease, reduce the impact that PCR is reacted by the impurity produced after cell cracking.Accordingly, because above-mentioned PCR reaction mixing
Containing cell pyrolysis liquid in liquid, so adding Stomatocyte to achieve that the detection to genotype as template.Forward primer and
Downstream primer is the specific primer in the design of two ends, gene test site, and mutant molecules beacon is expressly tied with mutant nucleotide sequence
Close, and wild type molecular beacon is combined with normal gene specific.
The Cleaning Principle of the present invention is: design pair of primers at gene mutation site both sides conservative region, and in sudden change position
Designing two molecular beacons at point sequence, mutant molecules beacon, wild type molecular beacon, wild type molecular beacon is with unmutated
Sequence combines, and mutant molecules beacon is combined with mutational site sequence.Two molecular beacons are respectively with the fluorescent base of different colours
Group's labelling, utilizes the principle of base pair complementarity, and at PCR annealing stage, wild type molecular beacon is combined with unmutated sequence,
And mutant molecules beacon is combined with the sequence having mutational site, after bonding, fluorophor, away from quenching group, now sends
Fluorescence recorded by real time fluorescent quantitative detector, judged the gene of detected gene by fluorescent value growth curve
Type.The method can also be added several to detect primer and probe to multiple SNP site simultaneously.PCR reaction in test kit
Mixture includes cell pyrolysis liquid, generally, PCR reaction be all the DNA of extraction purification in cell as template, if directly
Connect addition cell and provide template, then during PCR, cell cracking is thorough, and cell debris after cell cracking and
PCR reaction can be caused obstruction by some protease, easily causes the failure of an experiment.And inventor is by test of many times, cell
The composition of lysate mixes in certain proportion and is added in PCR reaction mixture, it is achieved that directly enter with Stomatocyte for template
Performing PCR reacts, thus can omit the step purifying DNA during PCR reacts, and avoids contaminated samples, thus when saving
Between.The effect of cell pyrolysis liquid is to dissolve Cytoplasm and cell membrane, and between saboteur, many faint chemical bonds, decompose some eggs
White enzyme, reduces the impact that PCR is reacted by the impurity produced after cell cracking, therefore, when detection, can directly obtain oral cavity thin
Born of the same parents detect as template, and cell pyrolysis liquid is by after the cell membrane of Stomatocyte and endolysis, and decomposition of protein enzyme also breaks
Bad chemical bond, obtains required DNA, and this process only needs about 1h, can quickly detect that result is analyzed, and then is clinical
Quick diagnosis brings foundation, reduces patient disease Operative risk.
Further, the raw material of described cell pyrolysis liquid is made up of sodium lauryl sulphate, Triton X-100.
Triton X-100 is a kind of nonionic surfactant, and sodium lauryl sulphate is that one can make albumen qualitative change
The strong anion detergent of property.In Cytobiology and molecular biology field, sodium lauryl sulphate, is called for short SDS, is often used in core
Acid extraction procedure is destroyed cell wall and cracking nucleic acid and albumen composition, at relatively high temperatures, destroys the knot of protein and DNA
Close, make DNA discharge.Triton X-100 is called for short Triton X-100, is used for decomposition of protein enzyme, Polyethylene Glycol
Octyl phenyl ether is one of composition of buffer also serving as restricted enzyme in genetic engineering, in experimentation, and inventor
Find by SDS and Triton X-100 mixing composition, the problem that can quickly solve sample dissolution.
Further, described PCR buffer is 5x Colorless Reaction Buffer.5x Reaction
Buffer is referred to as the colourless reaction buffer of 5x.
Further, PCR reaction mixture raw material is final concentration of:
Archaeal dna polymerase 0.04-0.1U/ul dNTPs 0.1-0.5mM
Forward primer 0.2-0.5uM
Downstream primer 0.2-0.5uM
Mutant molecules beacon 0.2-0.5uM
Wild type molecular beacon 0.2-0.5uM
5x Colorless Reaction Buffer 0.5-1.5x
MgCl2 1-2.5mM
The raw material of cell pyrolysis liquid is final concentration of:
Sodium lauryl sulphate 0.005-0.015%w/v
Triton X-100 0.001-0.03%w/v.
When being above-mentioned scope by the raw material of PCR reaction mixture knowable to experiment, all can complete detection, and testing result is accurate
Really.
Further, described PCR reaction mixture raw material final concentration of:
Archaeal dna polymerase 0.08U/ul dNTPs 0.3mM
Forward primer 0.4uM
Downstream primer 0.4uM
Mutant molecules beacon 0.4uM
Wild type molecular beacon 0.3uM
5x Colorless Reaction Buffer 1x
MgCl2 2mM
The raw material of cell pyrolysis liquid is final concentration of:
Sodium lauryl sulphate 0.005%w/v
Triton X-100 0.01%w/v.From experiment, the end of PCR reaction mixture
When concentration is above-mentioned value, testing result is the most accurate.
Further, the dispensed loading amount of described test kit is 10-50ul.As required, result at 10-50ul all energy detections,
And during operation, it is only necessary to the dispensed loading amount of taking is that the test kit of 10-50ul can complete detection, it is not necessary to again divides and takes, operation
Simply, convenient, fast.
Gene mononucleotide polymorphism site fast detection method, detecting step includes:
The first step: sampling
A: patient first gargles 2-3 time with warm water, removes intraoral food debris；
B: open the test kit equipped with detectable, takes out the Reagent Tube equipped with reagent；
C: with sampler stretch at the cheek of patient oral cavity forward and backward or upper and lower scraping 3-4 time, acquirement sample；
D: the cell sample of acquirement is put in Reagent Tube；
After candidate agent freeze thawing completely, playing Reagent Tube, cell sample is mix homogeneously in reagent；
Remove bubble removing；
Second step: reaction
Reagent Tube after sample treatment is put into PCR instrument device react；
3rd step: analysis result
Obtain amplification curve and fluorescence color analysis result.
Further, the reactions steps of described second step is:
A, 95 DEG C of denaturations 5min；
B, 95 DEG C of degeneration 5s；
C, 56 DEG C of annealing 30s；
And 50 circulations of reaction of a, b, step c；
Optical condition in course of reaction is: fluorescent PCR is at least the dual pathways, and twin-channel excitation wavelength is respectively
For between 450-500nm and 550-600nm.
Further, the described sampler in first step D step is toothpick.Toothpick is conveniently easy to get, and easy to operate.
Accompanying drawing explanation
With embodiment, technical solution of the present invention is further illustrated below in conjunction with the accompanying drawings:
Fig. 1 is the fluoroscopic examination result of the embodiment of the present invention two；
Fig. 2 is the testing result one of the embodiment of the present invention two；
Fig. 3 is the testing result two of the embodiment of the present invention two；
Fig. 4 is the testing result three of the embodiment of the present invention two；
Fig. 5 is the testing result one of the embodiment of the present invention one；
Fig. 6 is the testing result two of the embodiment of the present invention one；
Fig. 7 is the testing result three of the embodiment of the present invention one；
Fig. 8 is the testing result one of the embodiment of the present invention four；
Fig. 9 is the testing result two of the embodiment of the present invention four；
Figure 10 is the testing result three of the embodiment of the present invention four；
Figure 11 is the testing result one of the embodiment of the present invention seven；
Figure 12 is the testing result two of the embodiment of the present invention seven；
Figure 13 is the testing result three of the embodiment of the present invention seven.
Detailed description of the invention
CYP2C19*2 genotype quick detection kit of the present invention and detection method thereof comprise the following steps:
Preparing 50 reagent according to the reaction system of 23ul, the final concentration of following indication refers to that each component is in 23ul system
Concentration, ul/ props up the content referring to each component in Reagent Tube.
Following experimental implementation is all carried out in Biohazard Safety Equipment, it is ensured that pollution-free.
Embodiment one to embodiment six is the detection of CYP2C19*2 genotype；
CYP2C19 is the important member in CYP450 enzyme the second subfamily, great expression in liver, participates in multi-medicament
Metabolism.Owing to CYP2C19 gene has single nucleotide polymorphism, therefore there is significant individual variation in CYP2C19 enzymatic activity
And race difference.Its modal two kinds of sudden changes are CYP2C19*2 and CYP2C19*3, and they all belong to and nonsynonymous mutation, so
This enzyme metabolic capacity to medicine can be directly affected.CYP2C19*2 (681G > A, rs244285) makes a variation, and causes in translation process
Produce the splice site of an exception thus produce the non-functional protein of a truncate.In drug metabolism processes, this is dashed forward
Change can make the blood drug level of some medicines raise, and such as anticoagulation medicine clopidogrel, anti-antiepileptic phenytoin Sodium etc., makes trouble
There is bad drug reaction in person.
CYP2C19*2 mutated-genotype has homozygote A/A and heterozygote G/A two kinds, and its wild type genotype is G/G.Pure
Zygote A/A patient belongs to slow inactivation to the metabolic type of medicine, and heterozygote G/A patient belongs to medium to the metabolic type of medicine
Metabolic pattern, and wild type G/G patient belongs to homergy type to the metabolism of medicine.It is determined by the genotype of patient, it is possible to
Judge the phannacokinetic profiles of patient, thus help doctor correctly to select suitable medicine Reasonable adjustment drug dose, improve
Drug use effectiveness, reduces toxic and side effects.
One, the preparation of cell pyrolysis liquid: the cell pyrolysis liquid reagent of configuration 1000ul, reagent raw material and final concentration thereof such as table
Shown in 1, sodium lauryl sulphate (SDS) and Triton X-100 (TritonX-100) are purchased from Shanghai Pu Luomaigesheng
Tetramune company limited, initial concentration is respectively 0.1g/ml, 1.0655g/ml.
Table 1
In table 1, four embodiment cell pyrolysis liquid formula are the ultimate density in PCR reaction system, due to this concentration
The least, the lysate sample-adding time error of preparation this concentration a small amount of can increase, so the concentration of the lysate in order to prepare is accurate,
Use the sodium lauryl sulphate (SDS) in aforementioned four embodiment and Triton X-100 (Triton X-100)
Concentration expand, sample-adding time, the concentration expanded adds certain volume amount so that it is meet the requirement of above-mentioned final concentration, if
Ultimate density in definition aforementioned four embodiment is 1 times (1x), then concentration is expanded as 200 times (200x), cell pyrolysis liquid
The dilution 200 times when adding PCR reaction system so that it is final concentration of 1 times.
Two, the preparation of PCR reaction mixture: using pipettor to carry out the preparation of PCR reaction mixture, archaeal dna polymerase is adopted
With GoTaq DNA Polymerase.
Raw material and the final concentration thereof of PCR reaction mixture are as shown in table 2:
Table 2
Below for illustrating the present invention with embodiment citing in above-mentioned Tables 1 and 2.
Embodiment two,
One, configuration cell pyrolysis liquid:
Use 1.5ml centrifuge tube, add 100ulSDS and 18.78ulTriton X-100, add 881.22ul without
The water of nuclease, to cumulative volume 1000ul, makes the final concentration of SDS reach 1%, makes the final concentration of Triton X-100 reach 2%,
It is the cell pyrolysis liquid of 200x, then shakes mixing ,-4 DEG C of preservations.
The present invention, wherein, dNTPs, MgCl are described as a example by the final concentration of embodiment two in above-mentioned Tables 1 and 22、5x
Colorless Reaction Buffer, archaeal dna polymerase use GoTaq DNA Polymerase to be purchased from Shanghai Pu Luomaige
Biological product company limited.
Two, the PCR reaction mixture of 23ul is prepared: each raw material addition is as shown in table 3:
Table 3
Add each raw material by the addition in every test kit in table 3 and make PCR reaction mixture.
Wherein: CYP2C19*2 forward primer, CYP2C19*2 downstream primer, CYP2C19*2 mutant molecules beacon and
CYP2C19*2 wild type molecular beacon sequence is by Primer 5.0 software design, 5 ' end 6-FAM of wild type molecular beacon
Fluorescein labelling, 3 ' end BHQ1 quenching group labellings；And mutant molecules beacon 5 ' end Alexa Fluor 594 fluorescein
Labelling, 3 ' end BHQ2 quenching group labellings, forward primer, downstream primer, mutant molecules beacon and wild type molecular beacon
Synthesized by Shanghai Ying Jun Bioisystech Co., Ltd.
The sequence of forward primer and downstream primer is:
Forward primer (5 '-3 '): TGCAATAATTTTCCCACTATCATTG；
Downstream primer (5 '-3 '): CCAAAATATCACTTTCCATAAAAGCA.
Saltant type and wild type molecular beacon sequence are respectively as follows:
Mutant molecules beacon (5 '-3 '):
CGGACCTTTCCCGGGAACCCATAACGGTCCG；
Wild type molecular beacon (5 '-3 '):
CGGACCTCCCAGGAACCCATAACAAATGGTCCG。
One, the making of CYP2C19*2 genotype detection test kit；
Being divided in Reagent Tube by the PCR reaction mixture prepared, every Reagent Tube subpackage 23ul, after subpackage is complete
Keep in Dark Place at-20 DEG C；
CYP2C19*2 genotype quick detection kit is made up of the Reagent Tube equipped with reagent that subpackage is good, each reagent
Equipped with 16 reagent in box, each patient detects needs 1.
Four, the quick detecting step of CYP2C19*2 genotype is:
(1) sampling
The first step: patient first gargles 2-3 time with warm water, removes intraoral food debris；
Second step: open the test kit equipped with detectable, takes out Reagent Tube；
3rd step: with toothpick stretch at the cheek of patient oral cavity forward and backward or upper and lower scraping 3-4 time, acquirement Stomatocyte sample
Product, after taking sample, pull out the stopper of Reagent Tube, insert in Reagent Tube by taking the toothpick of sample one end with sample,
Sampling process was completed before reagent freeze thawing；
4th step: after the complete freeze thawing of candidate agent, flick Reagent Tube so that the Stomatocyte of scraping mixes all in reagent
Even, if any bubble in Reagent Tube, flick with finger, make bubbles burst or swim in reagent upper strata.
(2) reaction:
1, Reagent Tube is put into OM-1000 type fluorescent PCR instrument (license notification number: CN103820306B) carry out instead
Should, using two-step method, temperature program(me) is:
2, the information such as labelling Date of Sampling, patient's name, sex and age；
3, after one hour, observed result, result has three kinds, is " GG ", " GA " or " AA " respectively, wherein negative findings
Being " GG ", positive findings is " GA " and " AA ".As shown in Figure 1, Figure 2 and Figure 3, in figure, G line represents the unmutated gene of CYP2C19*2
Amplification situation, A line represents that CYP2C19*2 mutant gene expands situation；
(3) interpretation of result:
During analysis, a reaction system adds cell pyrolysis liquid, non-refinement cellular lysate in another reaction system
Liquid is analyzed contrast, and analysis result is as it is shown in figure 1, as seen from Figure 1: is detected by the present invention and analyzes the fluorescent value obtained and send out
Existing, the fluorescent value having added cell pyrolysis liquid in reaction system is higher by 65.67% than the fluorescent value not adding cell pyrolysis liquid, because of
This, cell pyrolysis liquid reagent contributes to the raising of reaction efficiency and fluorescent value.
Fig. 2, Fig. 3 and Fig. 4 are the result that the reaction system added with cell pyrolysis liquid obtains.
As shown in Figure 2: only G line has exponential increase, and A line does not has exponential increase, and therefore testing result is wild type GG,
Pointing out detected gene expression or activity possible normal, this genotype is homergy type；
As shown in Figure 3: G line and A line have exponential increase, representing that testing result is heterozygous variance type GA, prompting is detected
Gene activity may decline, and this genotype belongs to medium metabolic type；
As shown in Figure 4: only A line has exponential increase, and G line does not has exponential increase, represents that testing result is variation of isozygotying
Type AA, points out detected gene activity to be decreased obviously and maybe may lose, and its activity decrease or forfeiture may cause pharmaceutically active to become
Blood drug level is divided to reduce；
Thus, can analyze the genotype drawing CYP2C19*2, thus can draw from Fig. 2, Fig. 3 and Fig. 4, patient is to medicine
The metabolic type of thing.
Embodiment one,
Difference with embodiment two is that cell pyrolysis liquid, PCR reaction mixture configure, and concrete operations are as follows:
One, configuration cell pyrolysis liquid:
Use 1.5ml centrifuge tube, add 10ul SDS and 1.88ul Triton X-100, add 988.12ul without
The water of nuclease, to cumulative volume 1000ul, makes the final concentration of SDS reach 0.1%, makes the final concentration of Triton X-100 reach
2%, it is the cell pyrolysis liquid of 200x, then shakes mixing ,-4 DEG C of preservations.
The present invention, wherein, dNTPs, MgCl are described as a example by the final concentration of embodiment one in above-mentioned Tables 1 and 22、5x
Colorless Reaction Buffer, archaeal dna polymerase use GoTaq DNA Polymerase to be purchased from Shanghai Pu Luomaige
Biological product company limited.
Two, the PCR reaction mixture of 23ul is prepared: addition is as shown in table 4:
Table 4
Add each raw material by the addition in every test kit in table 4 and make PCR reaction mixture.
Wherein: CYP2C19*2 forward primer, CYP2C19*2 downstream primer, CYP2C19*2 mutant molecules beacon and
CYP2C19*2 wild type molecular beacon sequence is by Primer 5.0 software design, 5 ' end 6-FAM of wild type molecular beacon
Fluorescein labelling, 3 ' end BHQ1 quenching group labellings；And mutant molecules beacon 5 ' end Alexa Fluor 594 fluorescein
Labelling, 3 ' end BHQ2 quenching group labellings, forward primer, downstream primer, mutant molecules beacon and wild type molecular beacon
Synthesized by Shanghai Ying Jun Bioisystech Co., Ltd.
The sequence of forward primer and downstream primer is:
Forward primer (5 '-3 '): TGCAATAATTTTCCCACTATCATTG；
Downstream primer (5 '-3 '): CCAAAATATCACTTTCCATAAAAGCA.
Saltant type and wild type molecular beacon sequence are respectively as follows:
Mutant molecules beacon (5 '-3 '):
CGGACCTTTCCCGGGAACCCATAACGGTCCG；
Wild type molecular beacon (5 '-3 '):
CGGACCTCCCAGGAACCCATAACAAATGGTCCG。
Taking in the making of remaining CYP2C19*2 genotype detection test kit, the quick detecting step of CYP2C19*2 genotype
Sample, reaction all identical with embodiment two.
CYP2C19*2 genotype quick detecting step (3) interpretation of result of embodiment one is as follows:
As shown in Figure 5: only G line has exponential increase, and A line does not has exponential increase, and therefore testing result is wild type GG,
Pointing out detected gene expression or activity possible normal, this genotype is homergy type；
As shown in Figure 6: G line and A line have exponential increase, representing that testing result is heterozygous variance type GA, prompting is detected
Gene activity may decline, and this genotype belongs to medium metabolic type；
As shown in Figure 7: only A line has exponential increase, and G line does not has exponential increase, represents that testing result is variation of isozygotying
Type AA, points out detected gene activity to be decreased obviously and maybe may lose, and its activity decrease or forfeiture may cause pharmaceutically active to become
Blood drug level is divided to reduce；
Thus, can analyze the genotype drawing CYP2C19*2, thus can draw from Fig. 5, Fig. 6 and Fig. 7, patient is to medicine
The metabolic type of thing.Embodiment four,
Difference with embodiment two is that cell pyrolysis liquid, PCR reaction mixture configure, and concrete operations are as follows:
One, configuration cell pyrolysis liquid:
Use 1.5ml centrifuge tube, add 300ul SDS and 56.34ulTriton X-100, add 643.66ul without
The water of nuclease, to cumulative volume 1000ul, makes the final concentration of SDS reach 3%, makes the final concentration of Triton X-100 reach 6%,
It is the cell pyrolysis liquid of 200x, then shakes mixing ,-4 DEG C of preservations.
The present invention, wherein, dNTPs, MgCl2,5x are described as a example by the final concentration of embodiment four in above-mentioned Tables 1 and 2
Colorless Reaction Buffer, archaeal dna polymerase use GoTaq DNA Polymerase to be purchased from Shanghai Pu Luomaige
Biological product company limited.
Two, the PCR reaction mixture of 23ul is prepared: addition is as shown in table 5:
Table 5
| Component | Final concentration | Ul/ props up |
| The water of nuclease free | - | 11.53 |
| Promega Colourless Buffer | 1x | 6.9 |
| dNTPs | 0.3mM | 1.15 |
| MgCl2 | 2.0mM | 2.3 |
| 200x cell pyrolysis liquid | 1x | 0.12 |
| CYP2C19*2 forward primer | 0.4uM | 0.15 |
| CYP2C19*2 downstream primer | 0.4uM | 0.17 |
| Wild type molecular beacon | 0.4uM | 0.1 |
| Saltant type analyzes beacon | 0.3uM | 0.14 |
| GoTaq DNA Polymerase | 0.08U/ul | 0.46 |
Add each raw material by the addition in every test kit in table 5 and make PCR reaction mixture.
Wherein: CYP2C19*2 forward primer, CYP2C19*2 downstream primer, CYP2C19*2 mutant molecules beacon and
CYP2C19*2 wild type molecular beacon sequence is by Primer 5.0 software design, 5 ' end 6-FAM of wild type molecular beacon
Fluorescein labelling, 3 ' end BHQ1 quenching group labellings；And mutant molecules beacon 5 ' end Alexa Fluor 594 fluorescein
Labelling, 3 ' end BHQ2 quenching group labellings, forward primer, downstream primer, mutant molecules beacon and wild type molecular beacon
Synthesized by Shanghai Ying Jun Bioisystech Co., Ltd.
The sequence of forward primer and downstream primer is:
Forward primer (5 '-3 '): TGCAATAATTTTCCCACTATCATTG；
Downstream primer (5 '-3 '): CCAAAATATCACTTTCCATAAAAGCA.
Saltant type and wild type molecular beacon sequence are respectively as follows:
Mutant molecules beacon (5 '-3 '):
CGGACCTTTCCCGGGAACCCATAACGGTCCG；
Wild type molecular beacon (5 '-3 '):
CGGACCTCCCAGGAACCCATAACAAATGGTCCG。
Taking in the making of remaining CYP2C19*2 genotype detection test kit, the quick detecting step of CYP2C19*2 genotype
Sample, reaction all identical with embodiment two.
CYP2C19*2 genotype quick detecting step (3) interpretation of result of embodiment four is as follows:
As shown in Figure 8: only G line has exponential increase, and A line does not has exponential increase, and therefore testing result is wild type GG,
Pointing out detected gene expression or activity possible normal, this genotype is homergy type；
As shown in Figure 9: G line and A line have exponential increase, representing that testing result is heterozygous variance type GA, prompting is detected
Gene activity may decline, and this genotype belongs to medium metabolic type；
As shown in Figure 10: only A line has exponential increase, and G line does not has exponential increase, represents that testing result is variation of isozygotying
Type AA, points out detected gene activity to be decreased obviously and maybe may lose, and its activity decrease or forfeiture may cause pharmaceutically active to become
Blood drug level is divided to reduce；
Thus, can analyze the genotype drawing CYP2C19*2, thus can draw from Fig. 8, Fig. 9 and Figure 10, patient is to medicine
The metabolic type of thing.
Embodiment five:
In embodiment two in above-mentioned Tables 1 and 2 as a example by the final concentration of raw material, the PCR reaction mixture of preparation 10ul,
Each raw material addition is as shown in table 6:
The preparation table 6 of 10ul PCR reaction mixture
Embodiment six:
In embodiment two in above-mentioned Tables 1 and 2 as a example by the final concentration of raw material, the PCR reaction mixture of preparation 50ul,
Each raw material addition is as shown in table 7:
The preparation table 7 of 50ul PCR reaction mixture
Embodiment seven is the detection of ABCB1 genotype.
Embodiment seven:
Clopidogrel and aspirin duplex Antiplatelet therapy are acute coronary artery syndrome (Acute coronary
Syndrome, ACS) and PCI (Percutaneous coronary intervention, PCI) rear defence
Control the basis that thrombotic episodes occurs.But Different Individual is various to the reaction of clopidogrel, though application standard dose
Clopidogrel, some patients still can occur cardiovascular event, referred to as clopidogrel Resistant (clopidogrel
Resistance, CR).Clopidogrel needs its antiplatelet of metabolism competence exertion of the absorption through intestinal and liver in vivo
Effect.The P-gp existed in intestinal epithelial cell, can directly affect clopidogrel and enter blood from digestive tract, thus affect
The antiplatelet effects of clopidogrel.P-gp is by ABCB1 (ATP-binding cassette subfamily B
Member1) gene code, its cDNA total length 4660bp, comprise 28 exons, transcribe the mRNA of available 4.5kb.
The function of the P-gp of ABCB1 coding there are differences between Different Individual, and research finds that this is due to ABCB1 gene rs1045642
(C3435T) result that loci polymorphism causes.ABCB1C3435T site mutation genotype has homozygote T/T and heterozygote C/T
Two kinds, its wild type genotype is C/C.Research finds, carries the T allelic Intestinal Mucosal Injury in Patients Undergoing absorbability to clopidogrel
Reduce, cause blood drug level and active metabolite to reduce, had a strong impact on therapeutic effect.Therefore for taking clopidogrel
Patient is necessary to understand its ABCB1 gene C 3435T loci gene type, and the patient for C3435T site mutation selects other
Medicine or regulation dosage, reduce the risk of patient disease treatment, and make therapeutic effect reach optimum state.
It is below by the present invention detection to ABCB1 gene C 3435T site.
One, configuration cell pyrolysis liquid:
Use 1.5ml centrifuge tube, add 100ulSDS and 18.78ulTriton X-100, add 881.22ul without
The water of nuclease, to cumulative volume 1000ul, makes the final concentration of SDS reach 1%, makes the final concentration of Triton X-100 reach 2%,
It is the cell pyrolysis liquid of 200x, then shakes mixing ,-4 DEG C of preservations.
The present invention, wherein, dNTPs, MgCl are described as a example by the final concentration of embodiment two in above-mentioned Tables 1 and 22、5x
Colorless Reaction Buffer, archaeal dna polymerase use GoTaq DNA Polymerase to be purchased from Shanghai Pu Luomaige
Biological product company limited.
Two, the PCR reaction mixture of 23ul is prepared: each raw material addition is as shown in table 8:
Table 8
Add each raw material by the addition in every test kit in table 8 and make PCR reaction mixture.
Wherein: wherein: ABCB1 forward primer, ABCB1 downstream primer, ABCB1 mutant molecules beacon and ABCB1 are wild
Type molecular beacon sequences is by Primer 5.0 software design, and the 5 ' of wild type molecular beacon are held and used 6-FAM fluorescein labellings, and 3 '
End BHQ1 quenching group labelling；And mutant molecules beacon 5 ' end Alexa Fluor 594 fluorescein labelling, 3 ' ends are used
BHQ2 quenching group labelling, forward primer, downstream primer, mutant molecules beacon and wild type molecular beacon are by Shanghai English fine horse
Bioisystech Co., Ltd synthesizes.
The sequence of forward primer and downstream primer is respectively as follows:
Forward primer (5 '-3 '):
GAACATTGCCTATGGAGACA；
Downstream primer (5 '-3 '):
CCAGGCTGTTTATTTGAAGA；
The sequence of wild type molecular beacon and mutant molecules beacon is respectively as follows:
Saltant type analysis beacon (5 '-3 '):
CGGGACCTGCCCTCACGATCTCTTCGTCCCG；
Wild type molecular beacon (5 '-3 '):
CGTGCAGCTGCCCTCACAATCTCTTTGCACG。
One, the making of ABCB1 genotype detection test kit；
Being divided in Reagent Tube by the PCR reaction mixture prepared, every Reagent Tube subpackage 23ul, after subpackage is complete
Keep in Dark Place at-20 DEG C；
ABCB1 genotype quick detection kit is made up of the Reagent Tube that subpackage is good, equipped with 16 examinations in each test kit
Agent, each patient detects needs 1.
Four, the quick detecting step of ABCB1 genotype is:
(1) sampling
The first step: patient first gargles 2-3 time with warm water, removes intraoral food debris；
Second step: open the test kit equipped with detectable, takes out Reagent Tube；
3rd step: with toothpick stretch at the cheek of patient oral cavity forward and backward or upper and lower scraping 3-4 time, acquirement Stomatocyte sample
Product, after taking sample, pull out the stopper of Reagent Tube, insert in Reagent Tube by taking the toothpick of sample one end with sample,
Sampling process was completed before reagent freeze thawing；
4th step: after the complete freeze thawing of candidate agent, flick Reagent Tube so that the Stomatocyte of scraping mixes all in reagent
Even, if any bubble in Reagent Tube, flick with finger, make bubbles burst or swim in reagent upper strata.
(2) reaction:
1, Reagent Tube is put into OM-1000 type fluorescent PCR instrument (license notification number: CN103820306B) carry out instead
Should, using two-step method, temperature program(me) is:
2, the information such as labelling Date of Sampling, patient's name, sex and age；
3, after one hour, observed result, result has three kinds, is " CC ", " CT " or " TT " respectively, wherein negative findings
Being " CC ", positive findings is " CT " and " TT ".As shown in Figure 11, Figure 12 and Figure 13, in figure, C line represents ABCB1C3435T site
Unmutated sequence amplification situation, T line represents the gene order amplification situation of ABCB1C3435T site mutation；
(3) interpretation of result:
Figure 11: only C line has exponential increase, and T line does not has exponential increase, and therefore testing result is wild type CC, prompting
Detected gene expression or activity may be normal, do not affect the intestinal absorption to clopidogrel；
Figure 12: C line and T line have exponential increase, represent that testing result is heterozygous variance type CT, prompting ABCB1 coding
P-gp activity may decline, and causes intestinal to decline the absorbability of clopidogrel；
Figure 13: only T line has exponential increase, and C line does not has exponential increase, represents that testing result is the anomaly TT that isozygotys,
The P-gp activity of prompting ABCB1 coding is decreased obviously maybe may be lost, cause intestinal the most weak to the absorbability of clopidogrel or
Person loses, and has a strong impact on therapeutic effect.
Thus, can analyze the genotype drawing ABCB1, thus can draw from Figure 11, Figure 12 and Figure 13, patient is to medicine
Metabolic type.
For a person skilled in the art, on the premise of without departing from present configuration, it is also possible to make some changes
Shape and improvement, these also should be considered as protection scope of the present invention, and these are all without affecting effect and the patent that the present invention implements
Practicality.
Claims (4)
1. gene mononucleotide polymorphism site quick detection kit, it is characterised in that: including PCR reaction mixture, PCR is anti-
Answer mixed liquor include archaeal dna polymerase, dNTPs, forward primer, downstream primer, mutant molecules beacon, wild type molecular beacon,
MgCl2, PCR buffer and cell pyrolysis liquid,
Described cell pyrolysis liquid is made up of sodium lauryl sulphate, Triton X-100,
Described PCR buffer is 5 × Colorless Reaction Buffer,
The concentration of described PCR reaction mixture is:
Archaeal dna polymerase 0.04-0.1U/ μ l dNTPs 0.1-0.5mM
Forward primer 0.2-0.5 μM
Downstream primer 0.2-0.5 μM
Mutant molecules beacon 0.2-0.5 μM
Wild type molecular beacon 0.2-0.5 μM
5× Colorless Reaction Buffer 0.5-1.5×
MgCl2 1-2.5 mM
The concentration of cell pyrolysis liquid is:
Sodium lauryl sulphate 0.005-0.015%w/v
Triton X-100 0.001-0.03%w/v.
2. gene mononucleotide polymorphism site as claimed in claim 1 quick detection kit, it is characterised in that:
The concentration of described PCR reaction mixture is:
Archaeal dna polymerase 0.08U/ μ l dNTPs 0.3mM
Forward primer 0.4 μM
Downstream primer 0.4 μM
Mutant molecules beacon 0.4 μM
Wild type molecular beacon 0.3 μM
5× Colorless Reaction Buffer 1×
MgCl2 2 mM
The concentration of cell pyrolysis liquid is:
Sodium lauryl sulphate 0.005%w/v
Triton X-100 0.01%w/v.
3. gene mononucleotide polymorphism site as claimed in claim 1 or 2 quick detection kit, it is characterised in that: described
The dispensed loading amount of test kit be 10-50 μ l.
4. gene mononucleotide polymorphism site as claimed in claim 3 quick detection kit, it is characterised in that: it is used for examining
The sample surveyed is cell sample.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510079092.1A CN104673915B (en) | 2015-02-13 | 2015-02-13 | Rapid detection kit for gene single-nucleotide polymorphism site and method for rapid detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510079092.1A CN104673915B (en) | 2015-02-13 | 2015-02-13 | Rapid detection kit for gene single-nucleotide polymorphism site and method for rapid detection kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104673915A CN104673915A (en) | 2015-06-03 |
| CN104673915B true CN104673915B (en) | 2017-01-11 |
Family
ID=53309497
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510079092.1A Active CN104673915B (en) | 2015-02-13 | 2015-02-13 | Rapid detection kit for gene single-nucleotide polymorphism site and method for rapid detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104673915B (en) |
Families Citing this family (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106755535A (en) * | 2017-03-01 | 2017-05-31 | 上海荻硕贝肯医学检验所有限公司 | Primer, probe, kit and method for detecting mankind's CYP2C19 gene pleiomorphisms |
| CN107312842A (en) * | 2017-07-05 | 2017-11-03 | 重庆京因生物科技有限责任公司 | Primer, molecular beacon, kit and its detection method of CYP2C19*3 gene pleiomorphism quick detections |
| CN107227371A (en) * | 2017-07-25 | 2017-10-03 | 重庆京因生物科技有限责任公司 | Primer, molecular beacon, kit and its detection method of CYP2C9*3 gene pleiomorphism quick detections |
| CN107354212A (en) * | 2017-07-25 | 2017-11-17 | 重庆京因生物科技有限责任公司 | Primer, molecular beacon, kit and its detection method of VKORC1 gene pleiomorphism quick detections |
| CN107446998A (en) * | 2017-07-25 | 2017-12-08 | 重庆京因生物科技有限责任公司 | MTHFR C677T, rs1801133 single nucleotide polymorphisms quick detections primer, molecular beacon, kit and its detection method |
| CN107227372A (en) * | 2017-07-25 | 2017-10-03 | 重庆京因生物科技有限责任公司 | Primer, molecular beacon, kit and its detection method of ALDH2 gene pleiomorphism quick detections |
| CN107299140A (en) * | 2017-07-25 | 2017-10-27 | 重庆京因生物科技有限责任公司 | MTHFR A1298C gene pleiomorphism quick detections primer, molecular beacon, kit and detection method |
| CN107245527A (en) * | 2017-07-25 | 2017-10-13 | 重庆京因生物科技有限责任公司 | Primer, molecular beacon, kit and its detection method of MTRR gene pleiomorphism quick detections |
| CN108130364A (en) * | 2017-11-06 | 2018-06-08 | 浙江大学 | Nucleic acid rapid detection method based on molecular beacon under a kind of room temperature |
| CN109251978A (en) * | 2018-02-14 | 2019-01-22 | 重庆京因生物科技有限责任公司 | IL28B genotype quick detection kit based on POCT mode |
| CN109251975A (en) * | 2018-02-14 | 2019-01-22 | 重庆京因生物科技有限责任公司 | The genotype quick detection kit of CYP2C19*2 or * 3 based on POCT mode |
| CN109251981A (en) * | 2018-02-14 | 2019-01-22 | 重庆京因生物科技有限责任公司 | ALDH2 genotype quick detection kit based on POCT mode |
| CN109251976A (en) * | 2018-02-14 | 2019-01-22 | 重庆京因生物科技有限责任公司 | CYP2C9 and VKORC1 genotype quick detection kit based on POCT mode |
| CN109251971A (en) * | 2018-02-14 | 2019-01-22 | 重庆京因生物科技有限责任公司 | ADRB1 genotype quick detection kit based on POCT mode |
| CN109251972A (en) * | 2018-02-14 | 2019-01-22 | 重庆京因生物科技有限责任公司 | CYP3A5*3 genotype quick detection kit based on POCT mode |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101338343B (en) * | 2007-07-03 | 2011-08-31 | 英科新创(厦门)科技有限公司 | Method for detecting hepatitis B virus DNA and G1896A mutation thereof and kit |
| CN102604935B (en) * | 2012-04-09 | 2014-02-12 | 邢秀梅 | Method for safely and quickly extracting genomic deoxyribose nucleic acid (DNA) from blood |
-
2015
- 2015-02-13 CN CN201510079092.1A patent/CN104673915B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN104673915A (en) | 2015-06-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104673915B (en) | Rapid detection kit for gene single-nucleotide polymorphism site and method for rapid detection kit | |
| Luthra et al. | Novel 5′ exonuclease-based real-time PCR assay for the detection of t (14; 18)(q32; q21) in patients with follicular lymphoma | |
| ES2620289T3 (en) | Polynucleotide primers to detect PIK3CA mutations | |
| CN106119363A (en) | SNP combination, detection method and test kit for the detection of antituberculotics hepatic injury susceptible genotype | |
| CN102534031B (en) | High-specificity kit for detecting deafness predisposing genes and uses | |
| CN104711345A (en) | Quick detection kit for the CYP2C19*2 genetype and detection method thereof | |
| CN107227371A (en) | Primer, molecular beacon, kit and its detection method of CYP2C9*3 gene pleiomorphism quick detections | |
| KR101220806B1 (en) | Identification of group of hypertension-susceptibility genes | |
| CN105177116A (en) | Human CYP2C9 and VKORC1 genetic polymorphism detection kit | |
| JP5290957B2 (en) | Probes for detecting polymorphisms in immune-related genes and uses thereof | |
| CN111118138A (en) | Kit and method for detecting polymorphism of folate metabolism ability genes MTHFR and MTRR | |
| CN106834434B (en) | Nucleic acid, kit and method for detecting COX-1, COX-2 and GPIIIa gene polymorphism | |
| CN104673914A (en) | Cell lysis solution for rapid gene detection | |
| CN106755320A (en) | Nucleic acid, kit and method for detecting mankind's OPRM1 Gene A 118G loci polymorphisms | |
| CN107227372A (en) | Primer, molecular beacon, kit and its detection method of ALDH2 gene pleiomorphism quick detections | |
| CN104789652A (en) | ABCB1 genotype rapid detection kit and method thereof | |
| CN104120166A (en) | Method and kit for detecting mutation of PDS gene 2168A>G by using fluorescence PCR technology | |
| CN107446998A (en) | MTHFR C677T, rs1801133 single nucleotide polymorphisms quick detections primer, molecular beacon, kit and its detection method | |
| CN109251974A (en) | APOE2 and APOE4 genotype quick detection kit based on POCT mode | |
| JP2008538549A5 (en) | ||
| TW201311908A (en) | Method and kit for diagnosis of canine glaucoma | |
| CN102534030A (en) | Kit for jointly detecting four deafness predisposing genes and application thereof | |
| CN102732623B (en) | Chinese Han people tuberculosis gene detection kit and detection method | |
| CN107312842A (en) | Primer, molecular beacon, kit and its detection method of CYP2C19*3 gene pleiomorphism quick detections | |
| CN111334568A (en) | Multiple connection probe amplification probe combination and kit for screening congenital heart disease gene copy number variation and susceptible persons |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CP02 | Change in the address of a patent holder |
Address after: 400000 2-1, 2-9, building 4, 101 Cuibai Road, Chunhui road street, Dadukou District, Chongqing Patentee after: CHONGQING JINGYIN BIOTECHNOLOGY Co.,Ltd. Address before: 400051 9, LONCIN international office 5, 2 Shiping bridge, Kowloon Po, Chongqing. Patentee before: CHONGQING JINGYIN BIOTECHNOLOGY Co.,Ltd. |
|
| CP02 | Change in the address of a patent holder |