CN104673914A - Cell lysis solution for rapid gene detection - Google Patents
Cell lysis solution for rapid gene detection Download PDFInfo
- Publication number
- CN104673914A CN104673914A CN201510078877.7A CN201510078877A CN104673914A CN 104673914 A CN104673914 A CN 104673914A CN 201510078877 A CN201510078877 A CN 201510078877A CN 104673914 A CN104673914 A CN 104673914A
- Authority
- CN
- China
- Prior art keywords
- reagent
- pyrolysis liquid
- cell pyrolysis
- cell
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The invention discloses a cell lysis solution for rapid gene detection. The cell lysis solution comprises a PCR mixed solution, wherein the PCR mixed solution is prepared from the following raw materials: DNA polymerase, dNTPs, an upstream primer, a downstream primer, a mutant-type molecular beacon, a wild-type molecular beacon, MgCl2, a PCR buffer solution and the cell lysis solution. The invention also provides the cell lysis solution which can realize gene amplification or detection by using a cell as a template in a manner of cooperating with the PCR mixed solution and an application method of the cell lysis solution.
Description
Technical field
The invention belongs to biology field, be specifically related to a kind of cell pyrolysis liquid for Gene Detecting.
Background technology
Polymerase chain reaction (Polymerase Chain Reation, PCR) is a kind of method of external enzyme' s catalysis specific DNA fragment, is one of the most frequently used Protocols in Molecular Biology.Since Muller in 1985 invents polymerase chain reaction (PCR), the research mode of bio-science man is changed gradually.This can obtain the technology of a large amount of DNA fragmentation at short notice, in medical jurisprudence, DNA clone, genome analysis, inherited disease and Diagnosis of Infectious Diseases, play great function.
Round pcr is just widely used for molecular biological every field rapidly once appearance.It not only with the separation of gene, clone and nucleotide sequence analysis, can also be used for the structure of mutant and recombinant chou, the research of gene expression regulation, the analysis of gene pleiomorphism, the diagnosis of inherited disease and transmissible disease, the exploration of tumour mechanism, all many-sides such as forensic identification.Such as: single nucleotide polymorphism (the Single Nucleotide Polymorphism relevant to numerous disease, SNP) determine the susceptibility of human diseases and the otherness of drug reaction, all will produce immeasurable impact to the research that population genetics, pharmacy industry, medical jurisprudence, cancer and heredopathia are even evolved.By research SNP collection of illustrative plates, the mechanism of the much higher genopathies of sickness rate such as cancer, diabetes, vascular conditions and some psychotic disorder more profoundly can be familiar with.
PCR reaction system comprises archaeal dna polymerase, dNTPs, PCR damping fluid, Mg
2+, primer etc., add corresponding template DNA when reacting.At present, carrying out all the most frequently used sample of PCR reaction is blood, blood stain, with the hair of hair follicle, oral mucosa cell etc., other is as seminal stain, mixed stain, muscle, tooth, bone, the even amniotic fluid etc. of fetus, but sample can not be directly used in PCR reaction, need the DNA adding extraction purification from sample as template.If employing blood sample, complete from blood sampling to extraction purification DNA, at least need 4 hours, efficiency is lower.Existing cell lysing methods comprises chemical cracking, enzymatic lysis and mechanical lysis, and the normally comparatively gentle method of chemical cracking and enzymatic lysis, can seldom make DNA rupture usually, is method conventional in extraction purification DNA.A kind of cell lysing methods is not also had to directly apply to PCR at present.Therefore, directly cell is added in PCR reaction mixture as template and react, then in PCR process, lysis is thorough, and cell debris after lysis and some proteolytic enzyme can cause obstruction to PCR reaction, causes the low or the failure of an experiment of gene amplification efficiency.
Summary of the invention
The technical problem to be solved in the present invention be to provide a kind ofly to react fast, efficiency is high for the cell pyrolysis liquid of gene rapid amplifying or detection.
In order to solve the problems of the technologies described above, the invention provides following technical scheme: for the cell pyrolysis liquid of Gene Detecting, the raw material of described cell pyrolysis liquid is made up of sodium lauryl sulphate, Triton X-100.
Adopt the cell pyrolysis liquid for Gene Detecting of technical solution of the present invention, the effect of cell pyrolysis liquid is dissolved cell matter and cytolemma, between saboteur, many faint chemical bonds, decompose some proteolytic enzyme, the impact that the impurity produced after reducing lysis reacts PCR.The raw material of described cell pyrolysis liquid is made up of sodium lauryl sulphate, Triton X-100.Triton X-100 is a kind of nonionic surface active agent, and sodium lauryl sulphate is a kind of strong anion stain remover that can make protein denaturation.In Cytobiology and molecular biology field, sodium lauryl sulphate, is called for short SDS, is often used in nucleic acid extraction operation and destroys cell walls and cracking nucleic acid and albumen composition, at relatively high temperatures, destroys the combination of protein and DNA, DNA is discharged.Triton X-100 is called for short Triton X-100, is used to decomposition of protein enzyme, and Triton X-100 is also used as one of composition of the damping fluid of restriction enzyme in genetically engineered.Not thorough in order to solve lysis cracking in gene test process, cell debris and some proteolytic enzyme can cause obstruction to PCR reaction, cause the problem of the failure of an experiment, contriver is passing through test of many times, the composition of cell pyrolysis liquid is mixed in certain proportion to be added in PCR reaction mixture, achieving direct is that template carries out PCR reaction with Stomatocyte, thus the step of purification DNA can be omitted in the process of PCR reaction, and avoid contaminated samples, thus save time, composition is mixed by SDS and Triton X-100, after can realizing lysing cell and reducing cell rupture, cell debris is on the impact of PCR, simplify experimental procedure, testing process only needs about 1h.
Further, the raw material final concentration of described cell pyrolysis liquid is:
Sodium lauryl sulphate 0.005-0.015%w/v
Triton X-100 0.001-0.03%w/v.
Further, the raw material final concentration of described cell pyrolysis liquid is:
Sodium lauryl sulphate 0.005%w/v
Triton X-100 0.01%w/v.
Further, the raw material final concentration of described cell pyrolysis liquid is:
Sodium lauryl sulphate 0.009%w/v
Triton X-100 0.02%w/v.
Further, the raw material final concentration of described cell pyrolysis liquid is:
Sodium lauryl sulphate 0.005%w/v
Triton X-100 0.001%w/v.
Further, the raw material final concentration of described cell pyrolysis liquid is:
Sodium lauryl sulphate 0.015%w/v
Triton X-100 0.003%w/v.
Accompanying drawing explanation
Below in conjunction with drawings and Examples, technical solution of the present invention is further illustrated:
Fig. 1 is the fluoroscopic examination result of the embodiment of the present invention two;
Fig. 2 is the detected result one of the embodiment of the present invention two;
Fig. 3 is the detected result two of the embodiment of the present invention two;
Fig. 4 is the detected result three of the embodiment of the present invention two;
Fig. 5 is the detected result one of the embodiment of the present invention one;
Fig. 6 is the detected result two of the embodiment of the present invention one;
Fig. 7 is the detected result three of the embodiment of the present invention one;
Fig. 8 is the detected result one of the embodiment of the present invention four;
Fig. 9 is the detected result two of the embodiment of the present invention four;
Figure 10 is the detected result three of the embodiment of the present invention four;
Figure 11 is the detected result one of the embodiment of the present invention seven;
Figure 12 is the detected result two of the embodiment of the present invention seven;
Figure 13 is the detected result three of the embodiment of the present invention seven;
Figure 14 is the detected result of the embodiment of the present invention eight;
Figure 15 is the detected result of the embodiment of the present invention nine.
Embodiment
The cell pyrolysis liquid that the present invention is used for Gene Detecting can be applicable to gene amplification and Gene Detecting.In the pcr amplification of such as CYP2C19*2 genotype rapid detection, ABCB1 genotype rapid detection, bovine mitochondrial gene, the pcr amplification of corn glyceraldehyde-3-phosphate dehydrogenase gene:
One, respectively the present invention is described by CYP2C19*2 genotype rapid detection and ABCB1 genotype rapid detection.
Prepare 50 reagent according to the reaction system of 23ul, the final concentration of following indication refers to the concentration of each component in 23ul system, and ul/ props up and refers to the content of each component in Reagent Tube.
Following experimental implementation is all carried out in Biohazard Safety Equipment, ensures pollution-free.
Embodiment one to embodiment six is the genotypic detection of CYP2C19*2.
CYP2C19 is the important member in CYP450 enzyme second subfamily, great expression in liver, participates in the metabolism of multi-medicament.Because CYP2C19 gene has single nucleotide polymorphism, therefore there is significant individual difference and racial difference in CYP2C19 enzymic activity.Its modal two kinds of sudden changes are CYP2C19*2 and CYP2C19*3, and they all belong to and nonsynonymous mutation, so directly can affect the metabolic capacity of this enzyme to medicine.CYP2C19*2(681G>A, rs244285) variation, cause producing the splice site of an exception in translation process thus the non-functional protein of a generation brachymemma.In drug metabolism processes, this sudden change can make the Plasma Concentration of some medicines raise, and as anticoagulation medicine clopidogrel, anti-antiepileptic drug phenytoin Sodium etc., makes patient occur bad drug reaction.
CYP2C19*2 mutated-genotype has homozygote A/A and heterozygote G/A two kinds, and its wild type genotype is G/G.The metabolic type of homozygote A/A patient to medicine belongs to slow inactivation, and the metabolic type of heterozygote G/A patient to medicine belongs to medium metabolic type, and the metabolism of wild-type G/G patient to medicine belongs to eubolism type.By determining the genotype of patient, just can judge the phannacokinetic profiles of patient, thus help medicine that doctor selecting properly is suitable and Reasonable adjustment drug dose, improve drug use validity, reduce toxic side effect.
(1), the preparation of cell pyrolysis liquid: the cell pyrolysis liquid reagent of configuration 1000ul, reagent raw material and final concentration as shown in table 1, sodium lauryl sulphate (SDS) and Triton X-100 (Triton X-100) are purchased from Shanghai Pu Luomaige biological products company limited, and starting point concentration is respectively 0.1g/ml, 1.0655g/ml.
Table 1
In table 1, four embodiment lysis liquid formula are the ultimate density in PCR reaction system, because this concentration is very little, the lysate application of sample time error of preparation this concentration a small amount of can increase, so in order to the concentration of the lysate prepared accurate, adopt and the concentration of the sodium lauryl sulphate (SDS) in above-mentioned four embodiments and Triton X-100 (Triton X-100) is expanded, when application of sample, the concentration expanded adds certain volume amount, it is made to meet the requirement of above-mentioned final concentration, if the ultimate density defined in above-mentioned four embodiments is 1 times (1x), then concentration is expanded as 200 times (200x), cell pyrolysis liquid dilutes 200 times when adding PCR reaction system, its final concentration is made to be 1 times.
(2), the preparation of PCR reaction mixture: use pipettor to carry out the preparation of PCR reaction mixture, archaeal dna polymerase adopts GoTaq DNA Polymerase.
Raw material and the final concentration thereof of PCR reaction mixture are as shown in table 2:
Table 2
Below for illustrating the present invention with embodiment citing in above-mentioned table 1 and table 2.
Embodiment two,
(1), cell pyrolysis liquid is configured:
Use the centrifuge tube of 1.5ml, add 100ulSDS and 18.78ulTriton X-100, add the water of 881.22ul nuclease free again to cumulative volume 1000ul, the final concentration of SDS is made to reach 1%, the final concentration of Triton X-100 is made to reach 2%, be the cell pyrolysis liquid of 200x, then shake mixing ,-4 DEG C of preservations.
For the final concentration of embodiment two in above-mentioned table 1 and table 2, the present invention is described, wherein, dNTPs, MgCl
2, 5x Colorless Reaction Buffer, archaeal dna polymerase adopt GoTaq DNA Polymerase all purchased from Shanghai Pu Luomaige biological products company limited.
(2) the PCR reaction mixture of 23ul, is prepared: each raw material add-on is as shown in table 3:
Table 3
Add each raw material by the add-on of often propping up in test kit in table 3 and make PCR reaction mixture.
Wherein: CYP2C19*2 upstream primer, CYP2C19*2 downstream primer, CYP2C19*2 mutant molecules beacon and CYP2C19*2 wild type molecular beacon sequence are by Primer 5.0 software design, 5 ' end 6-FAM of wild type molecular beacon is fluorescein-labelled, 3 ' end BHQ1 quenching group mark; And mutant molecules beacon 5 ' end Alexa Fluor 594 is fluorescein-labelled, 3 ' end BHQ2 quenching group mark, upstream primer, downstream primer, mutant molecules beacon and wild type molecular beacon are synthesized by Shanghai Ying Jun Bioisystech Co., Ltd.
The sequence of upstream primer and downstream primer is:
Upstream primer (5 '-3 '): TGCAATAATTTTCCCACTATCATTG;
Downstream primer (5 '-3 '): CCAAAATATCACTTTCCATAAAAGCA.
Saltant type and wild type molecular beacon sequence are respectively:
Mutant molecules beacon (5 '-3 '):
CGGACCTTTCCCGGGAACCCATAACGGTCCG；
Wild type molecular beacon (5 '-3 '):
CGGACCTCCCAGGAACCCATAACAAATGGTCCG。
(3), the making of CYP2C19*2 genotype detection test kit;
The PCR reaction mixture prepared is divided in Reagent Tube, often props up Reagent Tube packing 23ul, divide after installing and keep in Dark Place at-20 DEG C;
CYP2C19*2 genotype quick detection kit is made up of point Reagent Tube that reagent is housed installed, and 16 reagent are housed in each test kit, and each patient detects needs 1.
(4), CYP2C19*2 genotype rapid detection step is:
(1) sample
The first step: patient first gargles 2-3 time with warm water, removes intraoral swill;
Second step: open the test kit that detection reagent is housed, takes out Reagent Tube;
3rd step: stretch into the forward and backward or upper and lower scraping in Inner cheek place, patient oral cavity 3-4 time with toothpick, obtain buccal cell samples, after taking sample, pull out the stopper of Reagent Tube, the toothpick getting sample is inserted in Reagent Tube with one end of sample, before reagent freeze thawing, completes sampling process;
4th step: after the complete freeze thawing of candidate agent, flick Reagent Tube, makes the Stomatocyte of scraping mix in reagent, if any bubble in Reagent Tube, flicks with finger, makes bubbles burst or swims in reagent upper strata.
(2) react:
1, Reagent Tube is put into OM-1000 type fluorescent PCR instrument (license notification number: CN103820306B) to react, adopt two-step approach, temperature program(me) is:
2, the information such as Date of Sampling, patient's name, sex and age are marked;
3, after one hour, observations, result has three kinds, and be " GG ", " GA " or " AA " respectively, wherein negative findings is " GG ", and positive findings is " GA " and " AA ".As shown in Figure 1, Figure 2 and Figure 3, in figure, G line represents CYP2C19*2 non-mutator gene amplification situation, and A line represents CYP2C19*2 mutator gene amplification situation;
(3) interpretation of result:
During analysis, cell pyrolysis liquid is added in a reaction system, in another reaction system, do not add cell pyrolysis liquid carry out analysis contrast, analytical results as shown in Figure 1, as seen from Figure 1: detected the fluorescent value discovery analyzed and obtain by the present invention, the fluorescent value having added cell pyrolysis liquid in reaction system is higher than the fluorescent value not adding cell pyrolysis liquid by 65.67%, and therefore, cell pyrolysis liquid reagent contributes to the raising of reaction efficiency and fluorescent value.
Fig. 2, Fig. 3 and Fig. 4 are the result that the reaction system that is added with cell pyrolysis liquid obtains.
As shown in Figure 2: only have G line to have exponential growth, and A line does not have exponential growth, therefore detected result is wild-type GG, normally, this genotype is eubolism type for prompting institute's gene expression detection or active possibility;
As shown in Figure 3: G line and A line have exponential growth, represent that detected result is heterozygous variance type GA, prompting detect gene activity and may decline, this genotype belongs to medium metabolic type;
As shown in Figure 4: only have A line to have exponential growth, and G line does not have exponential growth, represent that detected result is the anomaly AA that isozygotys, prompting institute detects gene activity and obviously declines and maybe may lose, and its activity decrease or forfeiture may cause active constituents of medicine Plasma Concentration to reduce;
Thus, can analyze the genotype drawing CYP2C19*2 from Fig. 2, Fig. 3 and Fig. 4, thus can draw, patient is to the metabolic type of medicine.
Embodiment one,
Be cell pyrolysis liquid with the difference of embodiment two, PCR reaction mixture configures, concrete operations are as follows:
(1), cell pyrolysis liquid is configured:
Use the centrifuge tube of 1.5ml, add 10ul SDS and 1.88ul Triton X-100, add the water of 988.12ul nuclease free again to cumulative volume 1000ul, the final concentration of SDS is made to reach 0.1%, the final concentration of Triton X-100 is made to reach 2%, be the cell pyrolysis liquid of 200x, then shake mixing ,-4 DEG C of preservations.
For the final concentration of embodiment one in above-mentioned table 1 and table 2, the present invention is described, wherein, dNTPs, MgCl
2, 5x Colorless Reaction Buffer, archaeal dna polymerase adopt GoTaq DNA Polymerase all purchased from Shanghai Pu Luomaige biological products company limited.
(2) the PCR reaction mixture of 23ul, is prepared: add-on is as shown in table 4:
Table 4
Add each raw material by the add-on of often propping up in test kit in table 4 and make PCR reaction mixture.
Wherein: CYP2C19*2 upstream primer, CYP2C19*2 downstream primer, CYP2C19*2 mutant molecules beacon and CYP2C19*2 wild type molecular beacon sequence are by Primer 5.0 software design, 5 ' end 6-FAM of wild type molecular beacon is fluorescein-labelled, 3 ' end BHQ1 quenching group mark; And mutant molecules beacon 5 ' end Alexa Fluor 594 is fluorescein-labelled, 3 ' end BHQ2 quenching group mark, upstream primer, downstream primer, mutant molecules beacon and wild type molecular beacon are synthesized by Shanghai Ying Jun Bioisystech Co., Ltd.
The sequence of upstream primer and downstream primer is:
Upstream primer (5 '-3 '): TGCAATAATTTTCCCACTATCATTG;
Downstream primer (5 '-3 '): CCAAAATATCACTTTCCATAAAAGCA.
Saltant type and wild type molecular beacon sequence are respectively:
Mutant molecules beacon (5 '-3 '):
CGGACCTTTCCCGGGAACCCATAACGGTCCG；
Wild type molecular beacon (5 '-3 '):
CGGACCTCCCAGGAACCCATAACAAATGGTCCG。
Sampling in the making of all the other CYP2C19*2 genotype detection test kits, CYP2C19*2 genotype rapid detection step, reaction are all identical with embodiment two.
CYP2C19*2 genotype rapid detection step (3) interpretation of result of embodiment one is as follows:
As shown in Figure 5: only have G line to have exponential growth, and A line does not have exponential growth, therefore detected result is wild-type GG, normally, this genotype is eubolism type for prompting institute's gene expression detection or active possibility;
As shown in Figure 6: G line and A line have exponential growth, represent that detected result is heterozygous variance type GA, prompting detect gene activity and may decline, this genotype belongs to medium metabolic type;
As shown in Figure 7: only have A line to have exponential growth, and G line does not have exponential growth, represent that detected result is the anomaly AA that isozygotys, prompting institute detects gene activity and obviously declines and maybe may lose, and its activity decrease or forfeiture may cause active constituents of medicine Plasma Concentration to reduce;
Thus, can analyze the genotype drawing CYP2C19*2 from Fig. 5, Fig. 6 and Fig. 7, thus can draw, patient is to the metabolic type of medicine.
Embodiment four,
Be cell pyrolysis liquid with the difference of embodiment two, PCR reaction mixture configures, concrete operations are as follows:
(1), cell pyrolysis liquid is configured:
Use the centrifuge tube of 1.5ml, add 300ul SDS and 56.34ulTriton X-100, add the water of 643.66ul nuclease free again to cumulative volume 1000ul, the final concentration of SDS is made to reach 3%, the final concentration of Triton X-100 is made to reach 6%, be the cell pyrolysis liquid of 200x, then shake mixing ,-4 DEG C of preservations.
For the final concentration of embodiment four in above-mentioned table 1 and table 2, the present invention is described, wherein, dNTPs, MgCl2,5x Colorless Reaction Buffer, archaeal dna polymerase adopt GoTaq DNA Polymerase all purchased from Shanghai Pu Luomaige biological products company limited.
(2) the PCR reaction mixture of 23ul, is prepared: add-on is as shown in table 5:
Table 5
Add each raw material by the add-on of often propping up in test kit in table 5 and make PCR reaction mixture.
Wherein: CYP2C19*2 upstream primer, CYP2C19*2 downstream primer, CYP2C19*2 mutant molecules beacon and CYP2C19*2 wild type molecular beacon sequence are by Primer 5.0 software design, 5 ' end 6-FAM of wild type molecular beacon is fluorescein-labelled, 3 ' end BHQ1 quenching group mark; And mutant molecules beacon 5 ' end Alexa Fluor 594 is fluorescein-labelled, 3 ' end BHQ2 quenching group mark, upstream primer, downstream primer, mutant molecules beacon and wild type molecular beacon are synthesized by Shanghai Ying Jun Bioisystech Co., Ltd.
The sequence of upstream primer and downstream primer is:
Upstream primer (5 '-3 '): TGCAATAATTTTCCCACTATCATTG;
Downstream primer (5 '-3 '): CCAAAATATCACTTTCCATAAAAGCA.
Saltant type and wild type molecular beacon sequence are respectively:
Mutant molecules beacon (5 '-3 '):
CGGACCTTTCCCGGGAACCCATAACGGTCCG；
Wild type molecular beacon (5 '-3 '):
CGGACCTCCCAGGAACCCATAACAAATGGTCCG。
Sampling in the making of all the other CYP2C19*2 genotype detection test kits, CYP2C19*2 genotype rapid detection step, reaction are all identical with embodiment two.
CYP2C19*2 genotype rapid detection step (3) interpretation of result of embodiment four is as follows:
As shown in Figure 8: only have G line to have exponential growth, and A line does not have exponential growth, therefore detected result is wild-type GG, normally, this genotype is eubolism type for prompting institute's gene expression detection or active possibility;
As shown in Figure 9: G line and A line have exponential growth, represent that detected result is heterozygous variance type GA, prompting detect gene activity and may decline, this genotype belongs to medium metabolic type;
As shown in Figure 10: only have A line to have exponential growth, and G line does not have exponential growth, represent that detected result is the anomaly AA that isozygotys, prompting institute detects gene activity and obviously declines and maybe may lose, and its activity decrease or forfeiture may cause active constituents of medicine Plasma Concentration to reduce;
Thus, can analyze the genotype drawing CYP2C19*2 from Fig. 8, Fig. 9 and Figure 10, thus can draw, patient is to the metabolic type of medicine.
Embodiment five:
For the final concentration of embodiment two Raw in above-mentioned table 1 and table 2, the PCR reaction mixture of preparation 10ul, each raw material add-on is as shown in table 6:
The preparation table 6 of 10ul PCR reaction mixture
Embodiment six:
For the final concentration of embodiment two Raw in above-mentioned table 1 and table 2, the PCR reaction mixture of preparation 50ul, each raw material add-on is as shown in table 7:
The preparation table 7 of 50ul PCR reaction mixture
The genotypic detection of embodiment seven: ABCB1.
Clopidogrel and acetylsalicylic acid duplex Antiplatelet therapy are acute coronary artery syndrome (Acute coronary syndrome, ACS) and prevent and treat after PCI (Percutaneous coronary intervention, PCI) thrombotic episodes occur basis.But the reaction of Different Individual to clopidogrel is various, even if the clopidogrel of application standard dosage, still can there is cardiovascular event in some patients, is called clopidogrel Resistant (clopidogrel resistance, CR).Clopidogrel needs its antiplatelet effects of metabolism competence exertion of absorption through enteron aisle and liver in vivo.The P-gp existed in intestinal epithelial cell, can directly affect clopidogrel and enter blood from digestive tube, thus affect the antiplatelet effects of clopidogrel.P-gp is by ABCB1(ATP-binding cassette subfamily B member 1) genes encoding, its cDNA total length 4660bp, comprises 28 exons, transcribes the mRNA that can obtain 4.5kb.The function of P-gp of ABCB1 coding there are differences between Different Individual, and research finds that this is due to ABCB1 gene rs1045642(C3435T) result that causes of loci polymorphism.ABCB1 C3435T site mutation genotype has homozygote T/T and heterozygote C/T two kinds, and its wild type genotype is C/C.Research finds, carries the allelic Intestinal Mucosal Injury in Patients Undergoing of T and reduces the receptivity of clopidogrel, causes Plasma Concentration and active metabolite to reduce, has had a strong impact on result for the treatment of.Therefore the patient taking clopidogrel is necessary to understand its ABCB1 gene C 3435T loci gene type, patient for C3435T site mutation selects other medicine or adjust dosages, reduce the risk of patient disease treatment, and make result for the treatment of reach optimum regime.
Be below by the detection of the present invention to ABCB1 gene C 3435T site.
(1), cell pyrolysis liquid is configured:
Use the centrifuge tube of 1.5ml, add 100ulSDS and 18.78ulTriton X-100, add the water of 881.22ul nuclease free again to cumulative volume 1000ul, the final concentration of SDS is made to reach 1%, the final concentration of Triton X-100 is made to reach 2%, be the cell pyrolysis liquid of 200x, then shake mixing ,-4 DEG C of preservations.
For the final concentration of embodiment two in above-mentioned table 1 and table 2, the present invention is described, wherein, dNTPs, MgCl
2, 5x Colorless Reaction Buffer, archaeal dna polymerase adopt GoTaq DNA Polymerase all purchased from Shanghai Pu Luomaige biological products company limited.
(2) the PCR reaction mixture of 23ul, is prepared: each raw material add-on is as shown in table 8:
Table 8
Add each raw material by the add-on of often propping up in test kit in table 8 and make PCR reaction mixture.
Wherein: wherein: ABCB1 upstream primer, ABCB1 downstream primer, ABCB1 mutant molecules beacon and ABCB1 wild type molecular beacon sequence are by Primer 5.0 software design, 5 ' end 6-FAM of wild type molecular beacon is fluorescein-labelled, 3 ' end BHQ1 quenching group mark; And mutant molecules beacon 5 ' end Alexa Fluor 594 is fluorescein-labelled, 3 ' end BHQ2 quenching group mark, upstream primer, downstream primer, mutant molecules beacon and wild type molecular beacon are synthesized by Shanghai Ying Jun Bioisystech Co., Ltd.
The sequence of upstream primer and downstream primer is respectively:
Upstream primer (5 '-3 '):
GAACATTGCCTATGGAGACA；
Downstream primer (5 '-3 '):
CCAGGCTGTTTATTTGAAGA；
The sequence of wild type molecular beacon and mutant molecules beacon is respectively:
Saltant type analysis beacon (5 '-3 '):
CGGGACCTGCCCTCACGATCTCTTCGTCCCG；
Wild type molecular beacon (5 '-3 '):
CGTGCAGCTGCCCTCACAATCTCTTTGCACG。
(3), the making of ABCB1 genotype detection test kit;
The PCR reaction mixture prepared is divided in Reagent Tube, often props up Reagent Tube packing 23ul, divide after installing and keep in Dark Place at-20 DEG C;
ABCB1 genotype quick detection kit is made up of point Reagent Tube installed, and 16 reagent are housed in each test kit, and each patient detects needs 1.
(4), ABCB1 genotype rapid detection step is:
(1) sample
The first step: patient first gargles 2-3 time with warm water, removes intraoral swill;
Second step: open the test kit that detection reagent is housed, takes out Reagent Tube;
3rd step: stretch into the forward and backward or upper and lower scraping in Inner cheek place, patient oral cavity 3-4 time with toothpick, obtain buccal cell samples, after taking sample, pull out the stopper of Reagent Tube, the toothpick getting sample is inserted in Reagent Tube with one end of sample, before reagent freeze thawing, completes sampling process;
4th step: after the complete freeze thawing of candidate agent, flick Reagent Tube, makes the Stomatocyte of scraping mix in reagent, if any bubble in Reagent Tube, flicks with finger, makes bubbles burst or swims in reagent upper strata.
(2) react:
1, Reagent Tube is put into OM-1000 type fluorescent PCR instrument (license notification number: CN103820306B) to react, adopt two-step approach, temperature program(me) is:
2, the information such as Date of Sampling, patient's name, sex and age are marked;
3, after one hour, observations, result has three kinds, and be " CC ", " CT " or " TT " respectively, wherein negative findings is " CC ", and positive findings is " CT " and " TT ".As shown in Figure 11, Figure 12 and Figure 13, in figure, C line represents that the sequence amplification situation that ABCB1 C3435T site does not suddenly change, T line represent the gene order amplification situation of ABCB1 C3435T site mutation;
(3) interpretation of result:
Figure 11: only have C line to have exponential growth, and T line does not have exponential growth, therefore detected result is wild-type CC, prompting institute's gene expression detection or active possibility normally, do not affect the absorption of enteron aisle to clopidogrel;
Figure 12: C line and T line have exponential growth, represent that detected result is heterozygous variance type CT, and the P-gp activity of prompting ABCB1 coding may decline, and causes enteron aisle to decline to the receptivity of clopidogrel;
Figure 13: only have T line to have exponential growth, and C line does not have exponential growth, represent that detected result is the anomaly TT that isozygotys, the active obviously decline of P-gp of prompting ABCB1 coding maybe may be lost, cause enteron aisle very weak or forfeiture to the receptivity of clopidogrel, have a strong impact on result for the treatment of.
Thus, can analyze the genotype drawing ABCB1 from Figure 11, Figure 12 and Figure 13, thus can draw, patient is to the metabolic type of medicine.
As can be seen here, the present invention can detect genotype fast and accurately for the cell pyrolysis liquid of Gene Detecting.
Embodiment eight:
For the bovine mitochondrial gene that increases, checking can fresh beef cell be that template carries out gene amplification containing the PCR mixed solution of cell pyrolysis liquid.
Experimental implementation is carried out in Biohazard Safety Equipment, ensures pollution-free.2X PCR MasterMix, sodium lauryl sulphate (SDS) and Triton X-100 (Triton X-100) are all purchased from Shanghai Pu Luomaige biological products company limited, and SYBR Green I dyestuff is purchased from Xiamen Zhi Shan Bioisystech Co., Ltd.Primer sequence is synthesized by Shanghai Ying Jun Bioisystech Co., Ltd by Primer 5.0 software design.
Primer sequence used is:
Upstream primer (5 '-3 '): CCCGATTCTTCGCTTTCCAT
Downstream primer (5 '-3 '): CTACGTCTGAGGAAATTCCTGTTG
One, prepare the 200x cell pyrolysis liquid of 1000ul, proportion scale is as shown in table 9:
Table 9
Use the centrifuge tube of 1.5ml, add 100ulSDS and 18.78ulTriton X-100, add the water of 881.22ul nuclease free again to cumulative volume 1000ul, the final concentration of SDS is made to reach 1%, the final concentration of Triton X-100 is made to reach 2%, be the cell pyrolysis liquid of 200x, then shake mixing ,-4 DEG C of preservations.
Two, reaction mixture is prepared:
Then prepare 10 reagent according to the reaction system of 23ul, concentration refers to the original concentration of component, and final concentration refers to the concentration of each component in 23ul system, and ul/ props up and refers to the content of each component in Reagent Tube.The content of each component in 23ul reagent is multiplied by 10, and then unification is added in the centrifuge tube of 1.5ml, is exactly the total amount of 10 reagent, and after adding each component, concussion mixing, then packing is in Beijing because of in Reagent Tube, often props up Reagent Tube packing 23ul.Divide after installing and keep in Dark Place at-20 DEG C;
Reagent component is as shown in table 10:
Table 10
Bovine mitochondrial gene detection reagent is divided in Reagent Tube, often props up Reagent Tube packing 23ul, divide after installing and keep in Dark Place at-20 DEG C;
Three, pcr amplification
(1) sample
The first step: buy the beef of just having slaughtered, preferably speckle with blood;
Second step: from-20 DEG C, the reagent prepared is taken out.
3rd step: scrape gently on beef with toothpick, can not repeat to scrape, can not exert oneself very much during scraping sample, in order to avoid get monoblock tissue;
4th step: after taking sample, pulls out the stopper of Reagent Tube, is inserted in Reagent Tube by the toothpick getting sample, before reagent freeze thawing, complete sampling process with one end of sample;
5th step: after waiting the complete freeze thawing of reagent, flick Reagent Tube, makes the cell of scraping mix in reagent, if any bubble in Reagent Tube, flicks with finger, makes bubbles burst or swims in reagent upper strata;
(2) react:
Reagent Tube is put into capital because of OM-1000 type fluorescent PCR instrument (license notification number: CN103820306B) and react, adopt two-step approach, temperature program(me) is:
(3) analytical results:
After one hour, observations, as shown in figure 14: occur a curve, illustrates that lysate can act on ox cell and do pcr amplification.
Embodiment nine:
For the corn glyceraldehyde-3-phosphate dehydrogenase gene that increases, checking can fresh corn cell be that template carries out gene amplification containing the PCR mixed solution of cell pyrolysis liquid.
Experimental implementation is carried out in Biohazard Safety Equipment, ensures pollution-free.2X PCR MasterMix, sodium lauryl sulphate (SDS) and Triton X-100 (Triton X-100) are all purchased from Shanghai Pu Luomaige biological products company limited, and SYBR GreenI dyestuff is purchased from Xiamen Zhi Shan Bioisystech Co., Ltd.Primer sequence is synthesized by Shanghai Ying Jun Bioisystech Co., Ltd by Primer 5.0 software design.
Primer sequence used is:
Upstream primer (5 '-3 '): ACTTCGGCATTGTTGAGG
Downstream primer (5 '-3 '): AAGTCGGTAGAAACCAGAT
(1), preparation 1000ul 200x cell pyrolysis liquid reagent, shown in agent prescription table 11:
Table 11
Use the centrifuge tube of 1.5ml, add 100ulSDS and 18.78ulTriton X-100, add the water of 881.22ul nuclease free again to cumulative volume 1000ul, the final concentration of SDS is made to reach 1%, the final concentration of Triton X-100 is made to reach 2%, be the cell pyrolysis liquid of 200x, then shake mixing ,-4 DEG C of preservations.
(2), reaction mixture is prepared:
10 reagent are prepared according to the reaction system of 23ul.Component refers to all ingredients that will add in reagent, and concentration refers to the original concentration of component, and final concentration refers to the concentration of each component in 23ul system, and ul/ props up and refers to the content of each component in Reagent Tube.The content of each component in 23ul reagent is multiplied by 10, and then unification is added in the centrifuge tube of 1.5ml, is exactly the total amount of 10 reagent, and after adding each component, concussion mixing, then packing is in Beijing because of in Reagent Tube, often props up Reagent Tube packing 23ul.Divide after installing and keep in Dark Place at-20 DEG C;
Reagent component is as shown in table 12:
Table 12
Corn glyceraldehyde-3-phosphate dehydrogenase gene detection reagent is divided in Reagent Tube, often props up Reagent Tube packing 23ul, divide after installing and keep in Dark Place at-20 DEG C.
(3), pcr amplification
(1) sample
The first step: buy fresh green corn;
Second step: from-20 DEG C, the reagent prepared is taken out.
3rd step: the seed coat of tearing gently with tweezers on corn grain, then scrapes the seed tearing seed coat gently with toothpick, can not exert oneself very much, in order to avoid sampling too much;
4th step: after taking sample, pulls out the stopper of Reagent Tube, is inserted in Reagent Tube by the toothpick getting sample, before reagent freeze thawing, complete sampling process with one end of sample;
5th step: after waiting the complete freeze thawing of reagent, flick Reagent Tube, makes the cell of scraping mix in reagent, if any bubble in Reagent Tube, flicks with finger, makes bubbles burst or swims in reagent upper strata;
(2) react:
Reagent Tube is put into capital because of OM-1000 type fluorescent PCR instrument (license notification number: CN103820306B) and react, adopt two-step approach, temperature program(me) is:
(3) analytical results: after hour, observations, as shown in figure 15: occur a curve, illustrates that cell pyrolysis liquid can act on maize cell and do pcr amplification.
For a person skilled in the art, under the prerequisite not departing from structure of the present invention, can also make some distortion and improvement, these also should be considered as protection scope of the present invention, and these all can not affect effect of the invention process and practical applicability.
Claims (6)
1. for the cell pyrolysis liquid of Gene Detecting, it is characterized in that: the raw material of described cell pyrolysis liquid is made up of sodium lauryl sulphate, Triton X-100.
2. as claimed in claim 1 for the cell pyrolysis liquid of Gene Detecting, it is characterized in that: the raw material final concentration of described cell pyrolysis liquid is:
Sodium lauryl sulphate 0.005-0.015%w/v
Triton X-100 0.001-0.03%w/v.
3. as claimed in claim 2 for the cell pyrolysis liquid of Gene Detecting, it is characterized in that: the raw material final concentration of described cell pyrolysis liquid is:
Sodium lauryl sulphate 0.005%w/v
Triton X-100 0.01%w/v.
4. as claimed in claim 2 for the cell pyrolysis liquid of Gene Detecting, it is characterized in that: the raw material final concentration of described cell pyrolysis liquid is:
Sodium lauryl sulphate 0.009%w/v
Triton X-100 0.02%w/v.
5. as claimed in claim 2 for the cell pyrolysis liquid of Gene Detecting, it is characterized in that: the raw material final concentration of described cell pyrolysis liquid is:
Sodium lauryl sulphate 0.005%w/v
Triton X-100 0.001%w/v.
6. as claimed in claim 2 for the cell pyrolysis liquid of Gene Detecting, it is characterized in that: the raw material final concentration of described cell pyrolysis liquid is:
Sodium lauryl sulphate 0.015%w/v
Triton X-100 0.003%w/v.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510078877.7A CN104673914A (en) | 2015-02-13 | 2015-02-13 | Cell lysis solution for rapid gene detection |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510078877.7A CN104673914A (en) | 2015-02-13 | 2015-02-13 | Cell lysis solution for rapid gene detection |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104673914A true CN104673914A (en) | 2015-06-03 |
Family
ID=53309496
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510078877.7A Pending CN104673914A (en) | 2015-02-13 | 2015-02-13 | Cell lysis solution for rapid gene detection |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104673914A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107312842A (en) * | 2017-07-05 | 2017-11-03 | 重庆京因生物科技有限责任公司 | Primer, molecular beacon, kit and its detection method of CYP2C19*3 gene pleiomorphism quick detections |
| CN109251977A (en) * | 2018-02-14 | 2019-01-22 | 重庆京因生物科技有限责任公司 | SLCO1B1 genotype quick detection kit based on POCT mode |
| CN109251981A (en) * | 2018-02-14 | 2019-01-22 | 重庆京因生物科技有限责任公司 | ALDH2 genotype quick detection kit based on POCT mode |
| CN114480575A (en) * | 2022-01-19 | 2022-05-13 | 武汉承启医学科技有限公司 | Method for rapidly detecting pathogen |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102181541A (en) * | 2011-04-08 | 2011-09-14 | 孟维娜 | Kit for specific PCR (polymerase chain reaction) detection of pneumocystis and detection method thereof |
| CN102321613A (en) * | 2011-09-05 | 2012-01-18 | 吴剑 | Extraction method of clotting genomic DNA (deoxyribonucleic acid) |
| CN102604935A (en) * | 2012-04-09 | 2012-07-25 | 邢秀梅 | Method for safely and quickly extracting genomic deoxyribose nucleic acid (DNA) from blood |
| CN102906262A (en) * | 2010-07-07 | 2013-01-30 | 戴阿冈有限公司 | Procedure for the specific isolation of total DNA content of bacterial germs and a kit for this purpose |
| US20140335520A1 (en) * | 2011-10-05 | 2014-11-13 | Spartan Bioscience, Inc. | Direct nucleic acid analysis |
-
2015
- 2015-02-13 CN CN201510078877.7A patent/CN104673914A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102906262A (en) * | 2010-07-07 | 2013-01-30 | 戴阿冈有限公司 | Procedure for the specific isolation of total DNA content of bacterial germs and a kit for this purpose |
| CN102181541A (en) * | 2011-04-08 | 2011-09-14 | 孟维娜 | Kit for specific PCR (polymerase chain reaction) detection of pneumocystis and detection method thereof |
| CN102321613A (en) * | 2011-09-05 | 2012-01-18 | 吴剑 | Extraction method of clotting genomic DNA (deoxyribonucleic acid) |
| US20140335520A1 (en) * | 2011-10-05 | 2014-11-13 | Spartan Bioscience, Inc. | Direct nucleic acid analysis |
| CN102604935A (en) * | 2012-04-09 | 2012-07-25 | 邢秀梅 | Method for safely and quickly extracting genomic deoxyribose nucleic acid (DNA) from blood |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107312842A (en) * | 2017-07-05 | 2017-11-03 | 重庆京因生物科技有限责任公司 | Primer, molecular beacon, kit and its detection method of CYP2C19*3 gene pleiomorphism quick detections |
| CN109251977A (en) * | 2018-02-14 | 2019-01-22 | 重庆京因生物科技有限责任公司 | SLCO1B1 genotype quick detection kit based on POCT mode |
| CN109251981A (en) * | 2018-02-14 | 2019-01-22 | 重庆京因生物科技有限责任公司 | ALDH2 genotype quick detection kit based on POCT mode |
| CN114480575A (en) * | 2022-01-19 | 2022-05-13 | 武汉承启医学科技有限公司 | Method for rapidly detecting pathogen |
| CN114480575B (en) * | 2022-01-19 | 2024-04-09 | 武汉承启医学科技有限公司 | Method for rapidly detecting pathogen |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104673915B (en) | Rapid detection kit for gene single-nucleotide polymorphism site and method for rapid detection kit | |
| Tourang et al. | Association between Human Endogenous Retrovirus K gene expression and breast cancer | |
| JP2023528777A (en) | Method for detecting donor-derived cell-free DNA | |
| US20140087961A1 (en) | Genetic variants useful for risk assessment of thyroid cancer | |
| KR20170026383A (en) | Analysis of nucleic acid sequences | |
| WO2012085948A1 (en) | Genetic variants useful for risk assessment of thyroid cancer | |
| US10519484B2 (en) | Lytic composition and application thereof, kit, method for preparing nucleic acid by utilizing lytic composition, and nucleic acid analysis method | |
| CN104673914A (en) | Cell lysis solution for rapid gene detection | |
| JP2023123658A (en) | Circulating rna signatures specific to preeclampsia | |
| CN104711345A (en) | Quick detection kit for the CYP2C19*2 genetype and detection method thereof | |
| WO2023142619A1 (en) | Marker for dilated cardiomyopathy genetic detection and use thereof | |
| JP2024511980A (en) | How to determine transplant rejection | |
| CN111560428B (en) | Application of substance for detecting single nucleotide polymorphism of mitochondrial DNA rs3937033 | |
| CN106834434B (en) | Nucleic acid, kit and method for detecting COX-1, COX-2 and GPIIIa gene polymorphism | |
| CN104711344A (en) | Warfarin individualized medication gene detection kit and application thereof | |
| EP4006155A1 (en) | Method for detecting or quantifying smn1 gene | |
| CN109923215A (en) | The detection of sequence variants | |
| US20140080727A1 (en) | Variants predictive of risk of gout | |
| CN104789652A (en) | ABCB1 genotype rapid detection kit and method thereof | |
| Lee et al. | Differential distribution of human mitochondrial DNA in somatic tissues and hairs | |
| CN107446998A (en) | MTHFR C677T, rs1801133 single nucleotide polymorphisms quick detections primer, molecular beacon, kit and its detection method | |
| Abumsimir et al. | Molecular characterization of human papillomavirus and mouse mammary tumor virus‑like infections in prostate cancer tissue and relevance with tumor characteristics | |
| CN111647653B (en) | SNP locus related to non-syndromic cleft lip and palate and detection kit | |
| CN111139295B (en) | SNP marker related to non-syndromic polyodontogenesis diagnosis and application thereof | |
| CN107245527A (en) | Primer, molecular beacon, kit and its detection method of MTRR gene pleiomorphism quick detections |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150603 |
|
| RJ01 | Rejection of invention patent application after publication |