CN104789652A - ABCB1 genotype rapid detection kit and method thereof - Google Patents
ABCB1 genotype rapid detection kit and method thereof Download PDFInfo
- Publication number
- CN104789652A CN104789652A CN201510082572.3A CN201510082572A CN104789652A CN 104789652 A CN104789652 A CN 104789652A CN 201510082572 A CN201510082572 A CN 201510082572A CN 104789652 A CN104789652 A CN 104789652A
- Authority
- CN
- China
- Prior art keywords
- abcb1
- genotype
- detection kit
- reagent
- beacon
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention discloses a ABCB1 genotype rapid detection kit, which comprises a PCR reaction mixing solution, wherein the raw materials of the PCR reaction mixing solution comprise DNA polymerase, DNTPs, a ABCB1 upstream primer, a ABCB1 downstream primer, a ABCB1 mutant molecular beacon, a ABCB1 wild-type molecular beacon, MgCl2, 5x Colorless Reaction Buffer and a cell lysate. According to the present invention, the problem that the existing clinical ABCB1 genotype detection kit and the detection method thereof can not meet the rapid diagnosis of the rapid diagnosis for the clinical medication is overcome, and the ABCB1 genotype rapid detection kit with characteristics of rapid ABCB1 genotype detection and patient disease risk reducing, and the detection method thereof are provided.
Description
Technical field
The invention belongs to biology field, be specifically related to a kind of ABCB1 genotype quick detection kit and detection method thereof.
Background technology
Single nucleotide polymorphism (Single Nucleotide Polymorphism, SNP) mainly refers to the DNA sequence polymorphism caused by the variation of single core thuja acid in genomic level.In genomic dna, any base all likely morphs, and therefore SNP is both likely in gene order, on the non-coding sequence also likely beyond gene.On the whole, the SNP (coding SNP, cSNP) being positioned at coding region is fewer, but it is significant in heredopathia research, and therefore the research of cSNP is more concerned.
From the impact of the inherited character on biology, cSNP can be divided into 2 kinds: one is synonym cSNP, and the change of the encoding sequence namely caused by SNP does not affect the aminoacid sequence of the protein that it is translated, and mutating alkali yl is identical with the implication of non-mutating alkali yl; Another kind is non-synonym cSNP, and refer to that the change of base sequence can make the protein sequence translated for template with it change, thus affect the function of protein, this change is often the immediate cause causing biological character to change.
SNP is relevant to numerous disease, determines the susceptibility of human diseases and the otherness of drug reaction.Therefore, SNP has important using value in analyzing and diagnosing, Clinical Laboratory, medical jurisprudence, Pathogen test, genetic diseases and new drug development etc.
Molecular beacon (molecular beacon) is a kind of stem ring double-tagging oligonucleotide probe of the hairpin structure about 5 ' and 3 ' end self formation 8 bases, the nucleic acid array complementation pairing at two ends, the fluorophor being therefore marked at one end is tightly close with the quenching group being marked at the other end.Under this configuration, the photon produced after fluorophor is excited is quenched agent cancellation, so can not produce fluorescence.In high-temperature denatured or anneal process afterwards, this destructurized, cause fluorophor away from quenching group, fluorescence just can be excited and monitored instrument detects.
Clopidogrel and acetylsalicylic acid duplex Antiplatelet therapy are acute coronary artery syndrome (Acutecoronary syndrome, ACS) and prevent and treat after PCI (Percutaneous coronaryintervention, PCI) thrombotic episodes occur basis.But the reaction of Different Individual to clopidogrel is various, even if the clopidogrel of application standard dosage, still can there is cardiovascular event in some patients, is called clopidogrel Resistant (clopidogrel resistance, CR).Clopidogrel needs its antiplatelet effects of metabolism competence exertion of absorption through enteron aisle and liver in vivo.The P-gp existed in intestinal epithelial cell, can directly affect clopidogrel and enter blood from digestive tube, thus affect the antiplatelet effects of clopidogrel.P-gp is by ABCB1 (ATP-binding cassette subfamily B member1) genes encoding, and its cDNA total length 4660bp, comprises 28 exons, transcribe the mRNA that can obtain 4.5kb.The function of the P-gp of ABCB1 coding there are differences between Different Individual, and research finds that this is the result because ABCB1 gene rs1045642 (C3435T) loci polymorphism causes.ABCB1C3435T site mutation genotype has homozygote T/T and heterozygote C/T two kinds, and its wild type genotype is C/C.Research finds, carries the allelic Intestinal Mucosal Injury in Patients Undergoing of T and reduces the receptivity of clopidogrel, causes Plasma Concentration and active metabolite to reduce, has had a strong impact on result for the treatment of.Therefore the patient taking clopidogrel is necessary to understand its ABCB1 gene C 3435T loci gene type, patient for C3435T site mutation selects other medicine or adjust dosages, reduce the risk of patient disease treatment, and make result for the treatment of reach optimum regime.
At present on the market also not used for clinical ABCB1C3435T loci gene type detection kit.The clinical method use probe method mostly detected for other gene SNP site, and all need the DNA of extraction purification as template.Add the step extracting blood and extract blood DNA.At least 4 hours are needed to extraction purification DNA from blood drawing.And current reagent on the market in use operator needs according to the reagent component in test kit and illustrates that then reagent preparation could use, this process easily causes the pollution of reagent, and add detection operation steps, extending detection time, extracting DNA to showing that the whole process of detected result at least needs 8 hours from blood drawing.This is difficult to the quick diagnosis meeting clinical disease, adds the risk of patient disease treatment.
Summary of the invention
The technical problem to be solved in the present invention is to provide a kind of energy rapid detection ABCB1 genotype, reduces ABCB1 genotype quick detection kit and the detection method thereof of patient disease Operative risk.
In order to solve the problems of the technologies described above, the invention provides following technical scheme: ABCB1 genotype quick detection kit, comprise PCR reaction mixture, PCR reaction mixture raw material comprises archaeal dna polymerase, dNTPs, ABCB1 upstream primer, ABCB1 downstream primer, ABCB1 mutant molecules beacon, ABCB1 wild type molecular beacon, MgCl2, PCR damping fluid and cell pyrolysis liquid.
Adopt the ABCB1 genotype quick detection kit of technical solution of the present invention, the effect of PCR damping fluid contributes to stablizing of enzyme, provides an enzyme-catalyzed reaction condition the most applicable to polysaccharase;
DNTP is the abbreviation of deoxy-ribonucleoside triphosphate (deoxyribonucleoside triphosphate), dNTPs is mixed with identical ratio by four kinds of deoxynucleotides (dATP, dGTP, dTTP, dCTP), is the raw material of DNA replication dna;
MgCl
2effect be to provide Mg
2+be combined with dNTP and DNA profiling and form complex body, only have this species complex could by archaeal dna polymerase identification;
Archaeal dna polymerase is GoTaq DNA Polymerase, with DNA for copying template, copies to the enzyme of 3' end from DNA by 5' end points.
ABCB1 upstream primer, ABCB1 downstream primer are as the starting point of DNA replication dna, because archaeal dna polymerase only can be added to new Nucleotide on existing DNA chain in DNA synthesis, therefore, when nucleic acid building-up reactions, primer carries out as each polynucleotide chain the starting point that extends and works.
The effect of cell pyrolysis liquid is dissolved cell matter and cytolemma, and between saboteur, many faint chemical bonds, decompose some proteolytic enzyme, the impact that the impurity produced after reducing lysis reacts PCR.Therefore, owing to containing cell pyrolysis liquid in above-mentioned PCR reaction mixture, just can realize the genotypic detection of ABCB1 so add Stomatocyte as template.Upstream primer and downstream primer are that mutant molecules beacon is expressly combined with ABCB1 mutant nucleotide sequence, and wild type molecular beacon is combined with normal ABCB1 gene specific at the Auele Specific Primer of two ends, ABCB1 gene test site design.
Cleaning Principle of the present invention is: at ABCB1 gene mutation site both sides conservative region design pair of primers, and design two molecular beacons at sequence place, mutational site, ABCB1 mutant molecules beacon, ABCB1 wild type molecular beacon, ABCB1 wild type molecular beacon is combined with non-mutant nucleotide sequence, and ABCB1 mutant molecules beacon is combined with mutational site sequence.6-FAM is fluorescein-labelled for wild type molecular beacon 5 ' end, and mutant molecules beacon 5 ' end Alexa Fluor 594 or Cal Fluor Red 610 is fluorescein-labelled, or wild type molecular beacon 5 ' end Alexa Fluor 594 or Cal Fluor Red 610 is fluorescein-labelled, and mutant molecules beacon 5 ' end 6-FAM is fluorescein-labelled, 3 ' the end BHQ1 quenching group mark of the molecular beacon of 6-FAM mark, and the molecular beacon 3 ' end that Alexa Fluor 594 or Cal Fluor Red 610 marks all uses BHQ2 quenching group to mark.At PCR annealing stage, wild type molecular beacon is combined with the sequence of not suddenling change, and mutant molecules beacon is combined with there being the sequence in mutational site, after bonding, fluorophor is away from quenching group, the fluorescence now sent is recorded by real time fluorescent quantitative detector, thus judges the genotype of detected gene by the color of fluorescence; Cell pyrolysis liquid is included in PCR reaction mixture in test kit, usually, PCR reaction is all that the DNA of extraction purification in cell is as template, if directly add cell to provide template, then in PCR process, lysis is not thorough, and the cell debris after lysis and some proteolytic enzyme can cause obstruction to PCR reaction, easily cause the failure of an experiment.And contriver is passing through test of many times, the composition of cell pyrolysis liquid is mixed in certain proportion to be added in PCR reaction mixture, achieving direct is that template carries out PCR reaction with Stomatocyte, thus the step of purification DNA can be omitted in the process of PCR reaction, and avoid contaminated samples, thus save time.The effect of cell pyrolysis liquid is dissolved cell matter and cytolemma, many faint chemical bonds between saboteur, decompose some proteolytic enzyme, the impact that the impurity produced after reducing lysis reacts PCR, therefore, when detecting, can directly obtain Stomatocyte to detect as template, cell pyrolysis liquid is by after the cytolemma of Stomatocyte and endolysis, decomposition of protein enzyme also destroys chemical bond, obtain required DNA, this process only needs about 1h, rapid detection can go out result analysis, and then bring foundation for clinical quick diagnosis, reduce patient disease Operative risk.
Further, the raw material of described cell pyrolysis liquid is made up of sodium lauryl sulphate, Triton X-100.Triton X-100 is a kind of nonionic surface active agent, and sodium lauryl sulphate is a kind of strong anion stain remover that can make protein denaturation.In Cytobiology and molecular biology field, sodium lauryl sulphate, is called for short SDS, is often used in nucleic acid extraction operation and destroys cell walls and cracking nucleic acid and albumen composition, at relatively high temperatures, destroys the combination of protein and DNA, DNA is discharged.Triton X-100 is called for short Triton X-100, be used to decomposition of protein enzyme, Triton X-100 is also used as one of composition of the damping fluid of restriction enzyme in genetically engineered, in experimentation, contriver finds to mix composition by SDS and Triton X-100, can the problem of quick solution contaminated samples.
Further, described PCR damping fluid is 5x Colorless Reaction Buffer.5x ColorlessReaction Buffer is called the colourless reaction buffer of 5x.
Further, the final concentration of described PCR reaction mixture raw material is:
Archaeal dna polymerase 0.08U/ul dNTPs 0.3mM
ABCB1 upstream primer 0.4uM
ABCB1 downstream primer 0.4uM
ABCB1 mutant molecules beacon 0.4uM
ABCB1 wild type molecular beacon 0.3uM
5x Colorless Reaction Buffer 1x
MgCl
22.0mM
The raw material final concentration of cell pyrolysis liquid is:
Sodium lauryl sulphate 0.005%w/v
Triton X-100 0.01%w/v.
From experiment, when the final concentration of PCR reaction mixture is above-mentioned value, detected result is the most accurate.
Further, described ABCB1 upstream primer, the sequence of ABCB1 downstream primer are respectively: upstream primer 5 '-3 ': GAACATTGCCTATGGAGACA; Downstream primer 5 '-3 ': CCAGGCTGTTTATTTGAAGA.
Further, described ABCB1 mutant molecules beacon and the sequence of ABCB1 wild type molecular beacon are respectively: mutant molecules beacon 5 '-3 ':
CGGGACCTGCCCTCACGATCTCTTCGTCCCG；
Wild type molecular beacon 5 '-3 ':
CGTGCAGCTGCCCTCACAATCTCTTTGCACG。
Further, the dispensed loading amount of described test kit is 10-50ul.As required, 10-50ul all can detection place result, and during operation, and the dispensed loading amount that only needs to take is that the test kit of 10-50ul can complete detection, gets without the need to again dividing, simple, convenient, quick.
ABCB1 genotype method for quick, detecting step comprises:
One, sample:
A: patient first gargles 2-3 time with warm water, removes intraoral swill;
B: open the test kit that detection reagent is housed, takes out the Reagent Tube that reagent is housed;
C: stretch into the forward and backward or upper and lower scraping in Inner cheek place, patient oral cavity 3-4 time with toothpick, obtain sample;
D: the toothpick getting sample is inserted in Reagent Tube with one end of sample;
After candidate agent freeze thawing, play Reagent Tube, cell sample mixes in reagent;
Remove bubble;
Two, react
Reagent Tube after sample preparation is put into quantitative PCR instruments react;
Three, analytical results
Obtain amplification curve and fluorescence color analytical results.
Further, in the reactions steps of described second step, reactions steps is:
A, 95 DEG C of denaturation 5min;
B, 95 DEG C of sex change 5s;
C, 56 DEG C of annealing 30s;
And a, b, step c react 50 circulations;
Optical condition in reaction process is: fluorescent PCR is at least two channels, and twin-channel excitation wavelength is respectively between 450-500nm and 550-600nm.
Accompanying drawing explanation
Below in conjunction with drawings and Examples, technical solution of the present invention is further illustrated:
Fig. 1 is the fluoroscopic examination result of the embodiment of the present invention two;
Fig. 2 is the detected result one of the embodiment of the present invention two;
Fig. 3 is the detected result two of the embodiment of the present invention two;
Fig. 4 is the detected result three of the embodiment of the present invention one.
Embodiment
ABCB1 genotype quick detection kit of the present invention and detection method thereof comprise the following steps:
Prepare 50 reagent according to the reaction system of 23ul, the final concentration of following indication refers to the concentration of each component in 23ul system, and ul/ props up and refers to the content of each component in Reagent Tube.
Following experimental implementation is all carried out in Biohazard Safety Equipment, ensures pollution-free.
The preparation of cell pyrolysis liquid: the cell pyrolysis liquid reagent of configuration 1000ul, reagent raw material and final concentration thereof are: sodium lauryl sulphate 0.005%w/v, Triton X-100 0.01%w/v, sodium lauryl sulphate (SDS) and Triton X-100 (Triton X-100) are purchased from Shanghai Pu Luomaige biological products company limited, and starting point concentration is respectively 0.1g/ml, 1.0655g/ml.
Lysis liquid formula is the ultimate density in PCR reaction system, because this concentration is very little, the lysate application of sample time error of preparation this concentration a small amount of can increase, so in order to the concentration of the lysate prepared accurate, adopt and the concentration of the sodium lauryl sulphate (SDS) in above-mentioned four embodiments and Triton X-100 (Triton X-100) is expanded, when application of sample, the concentration expanded adds certain volume amount, it is made to meet the requirement of above-mentioned final concentration, if the ultimate density defined in above-mentioned four embodiments is 1 times (1x), then concentration is expanded as 200 times (200x), cell pyrolysis liquid dilutes 200 times when adding PCR reaction system, its final concentration is made to be 1 times.
The preparation of PCR reaction mixture: use pipettor to carry out the preparation of PCR reaction mixture, archaeal dna polymerase adopts GoTaq DNA Polymerase;
The final concentration of PCR reaction mixture raw material is:
Archaeal dna polymerase 0.08U/ul dNTPs 0.3mM
ABCB1 upstream primer 0.4uM
ABCB1 downstream primer 0.4uM
ABCB1 mutant molecules beacon 0.4uM
ABCB1 wild type molecular beacon 0.3uM
5x Colorless Reaction Buffer 1x
MgCl2 2.0mM
200x cell pyrolysis liquid 1X
Embodiment:
One, cell pyrolysis liquid is configured:
Use the centrifuge tube of 1.5ml, add 100ulSDS and 18.78ulTriton X-100, add the water of 881.22ul nuclease free again to cumulative volume 1000ul, the final concentration of SDS is made to reach 1%, the final concentration of TritonX-100 is made to reach 2%, be the cell pyrolysis liquid of 200x, then shake mixing ,-4 DEG C of preservations.
Wherein, dNTPs, MgCl
2, 5x colorless reaction buffer, archaeal dna polymerase adopt GoTaq DNA Polymerase all purchased from Shanghai Pu Luomaige biological products company limited.
Two, the PCR reaction mixture of 23ul is prepared: each raw material add-on is as shown in table 1:
Table 1
Add each raw material by the add-on of often propping up in test kit in table 1 and make PCR reaction mixture.
Wherein: ABCB1 upstream primer, ABCB1 downstream primer, ABCB1 mutant molecules beacon and ABCB1 wild type molecular beacon sequence are by Primer 5.0 software design, 5 ' end 6-FAM of wild type molecular beacon is fluorescein-labelled, 3 ' end BHQ1 quenching group mark; And mutant molecules beacon 5 ' end Alexa Fluor 594 is fluorescein-labelled, 3 ' end BHQ2 quenching group mark, upstream primer, downstream primer, mutant molecules beacon and wild type molecular beacon are synthesized by Shanghai Ying Jun Bioisystech Co., Ltd.
The sequence of upstream primer and downstream primer is:
Upstream primer (5 '-3 '): GAACATTGCCTATGGAGACA;
Downstream primer (5 '-3 '): CCAGGCTGTTTATTTGAAGA.
Saltant type and wild type molecular beacon sequence are respectively:
Mutant molecules beacon (5 '-3 '):
CGGGACCTGCCCTCACGATCTCTTCGTCCCG；
Wild type molecular beacon (5 '-3 '):
CGTGCAGCTGCCCTCACAATCTCTTTGCACG。
Three, the making of ABCB1 genotype detection test kit;
The PCR reaction mixture prepared is divided in Reagent Tube, often props up Reagent Tube packing 23ul, divide after installing and keep in Dark Place at-20 DEG C;
CYP2C19*2 genotype quick detection kit is made up of point Reagent Tube installed, and the Reagent Tube that 16 are equipped with reagent is housed in each test kit, and each patient detects needs and repeats for 2 times, and namely each patient detects CYP2C19*2 genotype needs 2 Reagent Tubes.
Four, ABCB1 genotype rapid detection step is:
(1) sample
The first step: patient first gargles 2-3 time with warm water, removes intraoral swill;
Second step: open the test kit that detection reagent is housed, takes out Reagent Tube;
3rd step: stretch into the forward and backward or upper and lower scraping in Inner cheek place, patient oral cavity 3-4 time with toothpick, obtain buccal cell samples, after taking sample, pull out the stopper of Reagent Tube, the toothpick getting sample is inserted in Reagent Tube with one end of sample, before reagent freeze thawing, completes sampling process;
4th step: after the complete freeze thawing of candidate agent, flick Reagent Tube, makes the Stomatocyte of scraping mix in reagent, if any bubble in Reagent Tube, flicks with finger, makes bubbles burst or swims in reagent upper strata.
(2) react:
1, Reagent Tube is put into OM-1000 type fluorescent PCR instrument (license notification number: CN103820306B) to react, adopt two-step approach, temperature program(me) is:
2, the information such as Date of Sampling, patient's name, sex and age are marked;
3, after one hour, observations, result has three kinds, and be " CC ", " CT " or " TT " respectively, wherein negative findings is " CC ", and positive findings is " CT " and " TT ".As shown below, in figure, blue solid lines represents that the sequence amplification situation that ABCB1C3435T site does not suddenly change, green dotted line represent the gene order amplification situation of ABCB1C3435T site mutation;
(3) interpretation of result: during analysis, cell pyrolysis liquid is added in a reaction system, in another reaction system, do not add cell pyrolysis liquid carry out analysis contrast, analytical results as shown in Figure 1, as seen from Figure 1: detected the fluorescent value discovery analyzed and obtain by the present invention, the fluorescent value having added cell pyrolysis liquid in reaction system is higher than the fluorescent value not adding cell pyrolysis liquid by 65.67%, and therefore, cell pyrolysis liquid reagent contributes to the raising of reaction efficiency and fluorescent value.
Fig. 2, Fig. 3 and Fig. 4 are the result that the reaction system that is added with cell pyrolysis liquid obtains.
Fig. 2: only have blue solid lines to have exponential growth, and green dotted line does not have exponential growth, therefore detected result is wild-type CC, and prompting institute's gene expression detection or active possibility normally, do not affect the absorption of enteron aisle to clopidogrel;
Fig. 3: blue solid lines and green dotted line have exponential growth, represents that detected result is heterozygous variance type CT, and the P-gp activity of prompting ABCB1 coding may decline, and causes enteron aisle to decline to the receptivity of clopidogrel;
Fig. 4: only have green dotted line to have exponential growth, and blue solid lines does not have exponential growth, represent that detected result is the anomaly TT that isozygotys, the active obviously decline of P-gp of prompting ABCB1 coding maybe may be lost, cause enteron aisle very weak or forfeiture to the receptivity of clopidogrel, have a strong impact on result for the treatment of.
Thus, can analyze the genotype drawing ABCB1 from Fig. 2, Fig. 3 and Fig. 4, thus can draw, patient is to the metabolic type of medicine.
For a person skilled in the art, under the prerequisite not departing from structure of the present invention, can also make some distortion and improvement, these also should be considered as protection scope of the present invention, and these all can not affect effect of the invention process and practical applicability.
Claims (9)
1.ABCB1 genotype quick detection kit, it is characterized in that: comprise PCR reaction mixture, PCR reaction mixture raw material comprises archaeal dna polymerase, dNTPs, ABCB1 upstream primer, ABCB1 downstream primer, ABCB1 mutant molecules beacon, ABCB1 wild type molecular beacon, MgCl2, PCR damping fluid and cell pyrolysis liquid.
2. ABCB1 genotype quick detection kit as claimed in claim 1, is characterized in that: the raw material of described cell pyrolysis liquid is made up of sodium lauryl sulphate, Triton X-100.
3. ABCB1 genotype quick detection kit as claimed in claim 2, is characterized in that: described PCR damping fluid is 5x Colorless Reaction Buffer.
4. ABCB1 genotype quick detection kit as claimed in claim 3, is characterized in that: the final concentration of PCR reaction mixture raw material is:
Archaeal dna polymerase 0.08U/ul dNTPs 0.3mM
ABCB1 upstream primer 0.4uM
ABCB1 downstream primer 0.4uM
ABCB1 mutant molecules beacon 0.4 uM
ABCB1 wild type molecular beacon 0.3 uM
5x Colorless Reaction Buffer 1x
MgCl
2 2.0 mM
The raw material final concentration of cell pyrolysis liquid is:
Sodium lauryl sulphate 0.005%w/v
Triton X-100 0.01%w/v.
5., as the ABCB1 genotype quick detection kit in claim 1-4 as described in any one, it is characterized in that:
Described ABCB1 upstream primer, the sequence of ABCB1 downstream primer are respectively:
Upstream primer 5 '-3 ': GAACATTGCCTATGGAGACA;
Downstream primer 5 '-3 ': CCAGGCTGTTTATTTGAAGA.
6. ABCB1 genotype quick detection kit as claimed in claim 5, is characterized in that: described ABCB1 mutant molecules beacon and the sequence of ABCB1 wild type molecular beacon are respectively:
Mutant molecules beacon 5 '-3 ':
CGGGACCTGCCCTCACGATCTCTTCGTCCCG；
Wild type molecular beacon 5 '-3 ':
CGTGCAGCTGCCCTCACAATCTCTTTGCACG。
7. ABCB1 genotype quick detection kit as claimed in claim 6, is characterized in that: the dispensed loading amount of described test kit is 10-50ul.
8.ABCB1 genotype method for quick, is characterized in that: detecting step comprises:
Sampling:
A: patient first gargles 2-3 time with warm water, removes intraoral swill;
B: open the test kit that detection reagent is housed, takes out the Reagent Tube that reagent is housed;
C: stretch into the forward and backward or upper and lower scraping in Inner cheek place, patient oral cavity 3-4 time with toothpick, obtain sample;
D: the toothpick getting sample is inserted in Reagent Tube with one end of sample;
After candidate agent freeze thawing, play Reagent Tube, cell sample mixes in reagent;
Remove bubble;
Reaction
Reagent Tube after sample preparation is put into quantitative PCR instruments react;
Three, analytical results
Obtain amplification curve and fluorescence color analytical results.
9. ABCB1 genotype method for quick as claimed in claim 8, is characterized in that: in the reactions steps of described second step, reactions steps is:
A, 95 DEG C of denaturation 5min;
B, 95 DEG C of sex change 5s;
C, 56 DEG C of annealing 30s;
And a, b, step c react 50 circulations;
Optical condition in reaction process is: fluorescent PCR is at least two channels, and twin-channel excitation wavelength is respectively between 450-500nm and 550-600nm.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510082572.3A CN104789652A (en) | 2015-02-13 | 2015-02-13 | ABCB1 genotype rapid detection kit and method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510082572.3A CN104789652A (en) | 2015-02-13 | 2015-02-13 | ABCB1 genotype rapid detection kit and method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104789652A true CN104789652A (en) | 2015-07-22 |
Family
ID=53554841
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510082572.3A Pending CN104789652A (en) | 2015-02-13 | 2015-02-13 | ABCB1 genotype rapid detection kit and method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104789652A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107312842A (en) * | 2017-07-05 | 2017-11-03 | 重庆京因生物科技有限责任公司 | Primer, molecular beacon, kit and its detection method of CYP2C19*3 gene pleiomorphism quick detections |
| CN114085926A (en) * | 2021-11-10 | 2022-02-25 | 郑州华沃生物科技有限公司 | Primer, probe, kit and detection method for SNP site polymorphism of ABCB1 gene C3435T |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102604935A (en) * | 2012-04-09 | 2012-07-25 | 邢秀梅 | Method for safely and quickly extracting genomic deoxyribose nucleic acid (DNA) from blood |
| US20140335520A1 (en) * | 2011-10-05 | 2014-11-13 | Spartan Bioscience, Inc. | Direct nucleic acid analysis |
-
2015
- 2015-02-13 CN CN201510082572.3A patent/CN104789652A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140335520A1 (en) * | 2011-10-05 | 2014-11-13 | Spartan Bioscience, Inc. | Direct nucleic acid analysis |
| CN102604935A (en) * | 2012-04-09 | 2012-07-25 | 邢秀梅 | Method for safely and quickly extracting genomic deoxyribose nucleic acid (DNA) from blood |
Non-Patent Citations (2)
| Title |
|---|
| 董琳等: "ABCB1基因多态性与难治性癫痫", 《生命的化学》 * |
| 解魏卫: "ABCB1基因多态性与抑郁症及抗抑郁药疗效的相关性研究", 《中国优秀硕士学位论文全文数据库》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107312842A (en) * | 2017-07-05 | 2017-11-03 | 重庆京因生物科技有限责任公司 | Primer, molecular beacon, kit and its detection method of CYP2C19*3 gene pleiomorphism quick detections |
| CN114085926A (en) * | 2021-11-10 | 2022-02-25 | 郑州华沃生物科技有限公司 | Primer, probe, kit and detection method for SNP site polymorphism of ABCB1 gene C3435T |
| CN114085926B (en) * | 2021-11-10 | 2023-10-03 | 郑州华沃生物科技有限公司 | Primer, probe, kit and detection method for SNP locus polymorphism of ABCB1 gene C3435T |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104673915B (en) | Rapid detection kit for gene single-nucleotide polymorphism site and method for rapid detection kit | |
| CN105506118B (en) | Primer pair, fluorescence probe, kit and method for detecting CYP2C19 Genotypings | |
| CN104711345A (en) | Quick detection kit for the CYP2C19*2 genetype and detection method thereof | |
| CN107227371A (en) | Primer, molecular beacon, kit and its detection method of CYP2C9*3 gene pleiomorphism quick detections | |
| JP5727694B2 (en) | Marker for predicting therapeutic effect of hepatitis C, method for predicting therapeutic effect of hepatitis C, and preventive or therapeutic agent for hepatitis C | |
| JP5290957B2 (en) | Probes for detecting polymorphisms in immune-related genes and uses thereof | |
| CN106834434B (en) | Nucleic acid, kit and method for detecting COX-1, COX-2 and GPIIIa gene polymorphism | |
| CN104711344A (en) | Warfarin individualized medication gene detection kit and application thereof | |
| CN104673914A (en) | Cell lysis solution for rapid gene detection | |
| CN110079597A (en) | The susceptible related gene inspecting reagent kit of nonalcoholic fatty liver | |
| CN106755320A (en) | Nucleic acid, kit and method for detecting mankind's OPRM1 Gene A 118G loci polymorphisms | |
| CN104789652A (en) | ABCB1 genotype rapid detection kit and method thereof | |
| CN110819709A (en) | Method for detecting CYP2C9 and VKORC1 gene polymorphism by fluorescent quantitative PCR (polymerase chain reaction) | |
| CN107446998A (en) | MTHFR C677T, rs1801133 single nucleotide polymorphisms quick detections primer, molecular beacon, kit and its detection method | |
| CN109251972A (en) | CYP3A5*3 genotype quick detection kit based on POCT mode | |
| CN115747340A (en) | Method for detecting human SLCO1B1 genotyping | |
| CN106282329A (en) | A kind of helicobacter pylori gyrA gene mutation detection kit and detection method thereof | |
| CN108277273A (en) | With detecting non-deletion type α probe, primer and the kit of poor gene mutation | |
| CN109251974A (en) | APOE2 and APOE4 genotype quick detection kit based on POCT mode | |
| JP2008538549A5 (en) | ||
| CN102534030A (en) | Kit for jointly detecting four deafness predisposing genes and application thereof | |
| CN102732623B (en) | Chinese Han people tuberculosis gene detection kit and detection method | |
| CN107312842A (en) | Primer, molecular beacon, kit and its detection method of CYP2C19*3 gene pleiomorphism quick detections | |
| CN110951858A (en) | Primer-probe combination for guiding detection of genes related to glibenclamide drug personalized administration, kit and application | |
| CN109207570B (en) | Novel DNA extraction-free rapid SNPs genotyping method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150722 |
|
| RJ01 | Rejection of invention patent application after publication |