CN110079597A - The susceptible related gene inspecting reagent kit of nonalcoholic fatty liver - Google Patents
The susceptible related gene inspecting reagent kit of nonalcoholic fatty liver Download PDFInfo
- Publication number
- CN110079597A CN110079597A CN201910456137.0A CN201910456137A CN110079597A CN 110079597 A CN110079597 A CN 110079597A CN 201910456137 A CN201910456137 A CN 201910456137A CN 110079597 A CN110079597 A CN 110079597A
- Authority
- CN
- China
- Prior art keywords
- seq
- fatty liver
- nonalcoholic fatty
- related gene
- tm6sf2
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses the susceptible related gene inspecting reagent kits of nonalcoholic fatty liver, belong to beyond body nucleic acid detection field, the susceptible related gene inspecting reagent kit of nonalcoholic fatty liver includes the 3 pairs of primers and 3 pairs of probes for detecting 3 PNPLA3 rs738409C > G, TM6SF2 rs58542926C > T, GCKR rs780094T > C SNP site polymorphisms.The susceptible related gene inspecting reagent kit of the nonalcoholic fatty liver, testing result accuracy rate 100% compared with sequencing result, three pipes while homozygous wildtype, homozygous mutant and the heterozygous for detecting three sites of sample；As a result it is easier to judge, as a result confirmation review can be carried out by quantitative fluorescent PCR curve, accurately and reliably by the accurate parting of parting software；It is not limited by Sample size, without collecting together sample, providing experimental result rapid and convenient when can distribute detection Sample size, Sample size less.
Description
Technical field
The invention belongs to beyond body nucleic acid detection fields, and in particular to a kind of susceptible related gene detection of nonalcoholic fatty liver
Kit.
Background technique
Non-alcohol fatty liver (non-alcoholicfattyliverdisease, NAFLD), refers to and pancreas islet
Element resists a kind of metabolic stress liver damage disease related with inheritance susceptible, including non-alcoholic fatty liver becomes (non-
Alcoholichepaticsteatosis), nonalcoholic fatty liver disease (non-alcoholicsteatohepatitis,
NASH), cirrhosis and hepatocellular carcinoma (hepatocellularcarcinoma, HCC).Currently, with obesity, diabetes B
The stream of the diseases such as (type 2diabetesmellitus, T2DM) and metabolic syndrome (metabolic syndrome, MetS)
Row, closely related NAFLD has become the head of the big chronic liver disease in China first and health examination liver biochemical indexes exception therewith
Cause.In addition, hepatitis type B virus (hepatitis B virus, HBV) chronic infection merging NAFLD is also more common, seriously
Endanger national life and health and quality of life.
The study found that NAFLD has familial aggregation and genetic predisposition.European Hepatology Association non-alcohol fatty liver
Clinical practice guideline " EASL-EASD-EASO Clinical Practice Guidelines for the Management
Of Non-Alcoholic Fatty Liver Disease " in point out, on the related gene locis such as PNPLA3 and TM6SF2
The risk that mutation will increase non-alcohol fatty liver morbidity and deteriorate.In addition, the non-obese disease crowd in Asia (BMI <
25kg/m2) in the prevalence rate of NAFLD be about 20%, the influence of genetic risk may be than fertilizer in many factors for causing it to fall ill
Fat disease crowd is bigger.Largely science of heredity relevant to various common diseases is found by genome-wide association study (GWAS) at present
Indicate site, dozens of is found with the related genetic susceptibility loci of NAFLD, according to these different sites of crowd region
Risk size it is also different.Every result of study display portion susceptibility loci may hair during the occurrence and development of NAFLD
Wave important function, mainly have PNPLA3 rs738409 C > G, TM6SF2 rs58542926 C > T, GCKR rs780094 T >
C etc..
PNPLA3, Patatin sample phosphatidase domain albumen 3, is mainly expressed in fat cell and liver cell, is encoded fat and is grown
Albumen is supported, which has lipase and glycerol transacetylase activity, adjust liver tg metabolism.Rs738409 C > G is prominent
Change causes 148 amino acids of PNPLA3 albumen to become methionine from isoleucine, prevents the combination of substrate and enzyme active sites,
Lipolytic activity decline, causes triglycerides to be accumulated in liver cell.
TM6SF2,6 superfamily member 2 of transmembrane protein are expressed in brain tissue, kidney, liver and small intestine.TM6SF2
The conversion of rs58542926 C > T causes the 167th glutaminic acid residue to be replaced by lysine residue, influences the egg of TM6SF2 coding
White matter function has the albumen of research conjecture saltant type since accelerated degradation, mutein amount are reduced abnormal expression in the cell,
Triglycerides, which is deposited in liver, increases lipid content in liver, causes liver that steatosis occurs and produces disease of the liver, and gradually
Development is the generation of severe liver fibrosis or cirrhosis, even hepatocellular carcinoma.
The Glucokinase regulatory protein of GCKR gene coding, is the allosteric of glucokinase (glucokinase, GCK)
Inhibitor, and GCK is the key enzyme in liver cell glucose metabolic process.The site rs780094 is located at the enhancing of GCKR gene
On son, allele T can cause the downward of Glucokinase regulatory protein expression quantity, weaken to the active rejection ability of GCK, cause
Over-conversion is triglycerides and accumulates in the cell glucose in liver cell under GCK catalysis, finally causes fatty liver.
Therefore, by detection PNALA3 gene, TM6SF2 gene and GCKR gene and its related locus, it is known that tested
The height of the nonalcoholic fatty liver susceptible risk degree of person, to carry out individuation to examinee according to testing result
NAFLD prevents and treats guiding opinion, is of great significance for prevention and treatment NAFLD and its complication, improvement examinee's quality of life.
Currently, the kit of detection NAFLD susceptibility loci polymorphism has detection single locus, also there is detection multiple
Sites Combination.Only detection single locus genotype cannot fully assess the susceptible risk of NAFLD；And detect the examination in multiple sites
The method that agent box uses is generation PCR sequencing PCR, and this method needs purify the sample after amplification, Amplification Analysis sequence again,
Detecting step is cumbersome, complicated, more demanding to environment and operator, need expensive instrument and equipment, is at high cost, clinically
With certain limitation.
Summary of the invention
In order to solve the above-mentioned technical problem, the technical solution adopted by the present invention are as follows: the susceptible dependency basis of nonalcoholic fatty liver
Because of detection kit, including for detecting PNPLA3 rs738409 C > G, TM6SF2 rs58542926 C > T, GCKR
The 3 pairs of primers and 3 pairs of probes of 3 SNP site polymorphisms of rs780094T > C；
Sequence such as the SEQ ID No:1, SEQ ID of the primer and probe for being used to detect PNPLA3 rs738409 C > G
Shown in No:2, SEQ ID No:7 and SEQ ID No:8；
Sequence such as SEQ ID No:3, SEQ of the primer and probe for being used to detect TM6SF2 rs58542926 C > T
Shown in ID No:4, SEQ ID No:9 and SEQ ID No:10；
Sequence such as the SEQ ID No:5, SEQ ID of the primer and probe for being used to detect GCKR rs780094T > C
Shown in No:6, SEQ ID No:11 and SEQ ID No:12.
The beneficial effects of the present invention are: the susceptible related gene detection reagent of nonalcoholic fatty liver provided by the invention
Box is a kind of detection kit for PNPLA3, TM6SF2, GCKR gene pleiomorphism, and include in kit is used to detect
PNPLA3 rs738409 C > G, TM6SF2 rs58542926 C > T, GCKR rs780094T > C 3 SNP site polymorphisms
3 pairs of primers and 3 pairs of probes, testing result and sequencing result accuracy rate are up to 100%, three pipes while can detect three positions of sample
Homozygous wildtype, homozygous mutant and the heterozygous of point；It is easier to judge compared to the judging result using Δ Ct value method, it as a result can be with
By the accurate parting of parting software, confirmation review can also be carried out by quantitative fluorescent PCR curve, as a result accurately and reliably；This hair
The susceptible related gene inspecting reagent kit of the nonalcoholic fatty liver of bright offer is not limited by Sample size, can distribute detection sample
Without collecting together sample, providing experimental result rapid and convenient when number of cases, Sample size are few.
Detailed description of the invention
Fig. 1 show the amplification curve of PNPLA3 rs738409 C > G Wild homozygous of the specific embodiment of the invention；
Fig. 2 show the amplification curve of PNPLA3 rs738409 C > G heterozygous of the specific embodiment of the invention；
Fig. 3 show the amplification curve of PNPLA3 rs738409 C > G mutated homozygous of the specific embodiment of the invention；
The amplification that Fig. 4 show TM6SF2 rs58542926 C > T Wild homozygous of the specific embodiment of the invention is bent
Line；
Fig. 5 show the amplification curve of TM6SF2 rs58542926 C > T heterozygous of the specific embodiment of the invention；
The amplification that Fig. 6 show TM6SF2 rs58542926 C > T mutated homozygous of the specific embodiment of the invention is bent
Line；
Fig. 7 show the amplification curve of GCKR rs780094 T > C Wild homozygous of the specific embodiment of the invention；
Fig. 8 show the amplification curve of GCKR rs780094 T > C heterozygous of the specific embodiment of the invention；
Fig. 9 show the amplification curve of GCKR rs780094 T > C mutated homozygous of the specific embodiment of the invention；
Figure 10 show the PNPLA3 rs738409 site primer sample genotyping result figure of the specific embodiment of the invention；
Figure 11 show the TM6SF2 rs58542926 site primer sample genotyping result of the specific embodiment of the invention
Figure；
Figure 12 show the GCKR rs780094 site primer sample genotyping result figure of the specific embodiment of the invention.
Specific embodiment
To explain the technical content, the achieved purpose and the effect of the present invention in detail, below in conjunction with embodiment and cooperate attached
Figure is explained.
The most critical design of the present invention is: selected highly relevant with NAFLD in Chinese population three of the present invention
Using Real-Time Fluorescent Quantitative PCR Technique Taqman probe is added on the basis of Standard PCR to realize gene position in gene loci
The function of point parting.
Please refer to table 1 (primer) and table 2 (probe), the susceptible related gene detection reagent of nonalcoholic fatty liver of the invention
Box, including for detecting PNPLA3 rs738409 C > G, TM6SF2 rs58542926 C > T, GCKR rs780094 T > C 3
The 3 pairs of primers and 3 pairs of probes of a SNP site polymorphism；
Sequence such as the SEQ ID No:1, SEQ ID of the primer and probe for being used to detect PNPLA3 rs738409C > G
Shown in No:2, SEQ ID No:7 and SEQ ID No:8；
Sequence such as SEQ ID No:3, SEQ of the primer and probe for being used to detect TM6SF2 rs58542926 C > T
Shown in ID No:4, SEQ ID No:9 and SEQ ID No:10；
Sequence such as the SEQ ID No:5, SEQ ID of the primer and probe for being used to detect GCKR rs780094 T > C
Shown in No:6, SEQ ID No:11 and SEQ ID No:12.
Table 1
| Title | Sequence (5 ' → 3 ') | Base number | |
| SEQ ID No:1 | 409-F1 | GGTGCTCTCGCCTATAACTTCT | 22 |
| SEQ ID No:2 | 409-R1 | GCAGAGAAAGCCGACTTACCAC | 22 |
| SEQ ID No:3 | 926-F1 | GCTGGCTGAAGACCTTCATG | 20 |
| SEQ ID No:4 | 926-R3 | AACAGATGTCCAGCAGGGTTC | 21 |
| SEQ ID No:5 | 094-F2 | GGATTCATTCCACTAAACCAC | 21 |
| SEQ ID No:6 | 094-R3 | CATGTTGGCTAGGCTTGT | 18 |
Table 2
| Title | Sequence (5 ' → 3 ') | Base number | |
| SEQ ID No:7 | P409C-2 | TTCCTGCTTCATCCC | 15 |
| SEQ ID No:8 | P409G-2 | TTCCTGCTTCATGCC | 15 |
| SEQ ID No:9 | P926C-2 | CAAATACAGCTCCGAGATCAGGCC | 24 |
| SEQ ID No:10 | P926T-2 | CAAATACAGCTCCAAGATCAGGCC | 24 |
| SEQ ID No:11 | P094C-1 | ATGACTGACACATGTTT | 17 |
| SEQ ID No:12 | P094T-1 | ATGACTGACACATATTT | 17 |
Wherein, above-mentioned probe 3 ' end is modified using MGB or is not modified, the modifications at 5 ' ends can for FAM, HEX, cy3,
Cy5, fluorophor are unlimited.
As can be seen from the above description, the beneficial effects of the present invention are: provide a kind of PNPLA3, TM6SF2, GCKR gene
The detection kit of polymorphism, include in kit for detecting PNPLA3 rs738409 C > G, TM6SF2
The 3 pairs of primers and 3 pairs of probes of rs58542926 C > T, GCKR rs780094 3 SNP site polymorphisms of T > C, testing result
It is up to 100% with sequencing result accuracy rate, three pipes while the homozygous wildtype in three sites of sample, homozygous mutant can be detected
And heterozygous；It is easier to judge compared to the judging result using Δ Ct value method, as a result can also may be used by the accurate parting of parting software
To carry out confirmation review by quantitative fluorescent PCR curve, as a result accurately and reliably；Nonalcoholic fatty liver provided by the invention is susceptible
Related gene inspecting reagent kit is not limited by Sample size, can distribute detection Sample size, Sample size it is few when without collect together sample,
Provide experimental result rapid and convenient.
Further, the susceptible related gene inspecting reagent kit of nonalcoholic fatty liver, including PCR reaction solution 1, PCR reaction
Liquid 2 and PCR reaction solution 3；
The PCR reaction solution 1 includes the primer and probe for detecting PNPLA3 rs738409 C > G；
The PCR reaction solution 2 includes the primer and probe for detecting TM6SF2 rs58542926 C > T；
The PCR reaction solution 3 includes the primer and probe for detecting GCKR rs780094 T > C.
It further, further include 2 × qPCR Mix in each PCR reaction solution, 2 × qPCR Mix includes thermal starting
Taq enzyme, dNTP, UNG enzyme, Mg2+And ultrapure water.
As can be seen from the above description, introducing UNG enzyme decontamination system, more accurate, stable parting inspection can be carried out to sample
It surveys.
Further, the susceptible related gene inspecting reagent kit of nonalcoholic fatty liver further includes positive quality control product 1, positive
Quality-control product 2, positive quality control product 3 and negative quality-control product；
The positive quality control product 1 is PNPLA3 rs738409CC, TM6SF2 rs58542926 CT, GCKR rs780094
The human gene group DNA of TT genotype combination, concentration are 1-10ng/ μ L；
The positive quality control product 2 is PNPLA3 rs738409 CG, TM6SF2 rs58542926 CC, GCKR
The human gene group DNA of rs780094 CC genotype combination, concentration are 1-10ng/ μ L；
The positive quality control product 3 is PNPLA3 rs738409 GG, TM6SF2 rs58542926 CC, GCKR
The human gene group DNA of rs780094 CT genotype combination, concentration are 1-10ng/ μ L；
The feminine gender quality-control product is sterilizing purified water.
As can be seen from the above description, the accuracy of detection can be improved by setting positive quality control product and negative quality-control product.
Further, the susceptible related gene inspecting reagent kit of nonalcoholic fatty liver further includes DMSO additive.
As can be seen from the above description, amplification efficiency can be improved in addition DMSO, better amplification curve diagram is obtained
Further, the susceptible related gene inspecting reagent kit of nonalcoholic fatty liver, further include lysate stoste and 20 ×
Dilution.
As can be seen from the above description, can configure lysate and 1 × Tris-HCL using lysate stoste and 20 × dilution, into
And the extraction of whole blood sample DNA can be carried out.
Embodiment one:
The susceptible related gene inspecting reagent kit of nonalcoholic fatty liver includes ingredient shown in table 3；
Table 3
| Serial number | Component | Ingredient | Quantity | Specification |
| 1 | PCR reaction solution 1 | Primer, probe, Taq enzyme, dNTP, UNG enzyme, water | 1 | 900 μ L/ pipe |
| 2 | PCR reaction solution 2 | Primer, probe, Taq enzyme, dNTP, UNG enzyme, water | 1 | 900 μ L/ pipe |
| 3 | PCR reaction solution 3 | Primer, probe, Taq enzyme, dNTP, UNG enzyme, water | 1 | 900 μ L/ pipe |
| 4 | Positive quality control product 1 | Extracted human gene group DNA | 1 | 100 μ L/ pipe |
| 5 | Positive quality control product 2 | Extracted human gene group DNA | 1 | 100 μ L/ pipe |
| 6 | Positive quality control product 3 | Extracted human gene group DNA | 1 | 100 μ L/ pipe |
| 7 | Negative quality-control product | Sterilize purified water | 1 | 100 μ L/ pipe |
Wherein, the primer and probe in the PCR reaction solution 1 is the primer for detecting PNPLA3 rs738409 C > G
And probe；
Primer and probe in the PCR reaction solution 2 is primer and the spy for detecting TM6SF2 rs58542926 C > T
Needle；
Primer and probe in the PCR reaction solution 3 is the primer and probe for detecting GCKR rs780094 T > C；
The positive quality control product 1 is PNPLA3 rs738409 CC, TM6SF2 rs58542926 CT, GCKR
The human gene group DNA of rs780094 TT genotype combination, concentration are 1-10ng/ μ L；
The positive quality control product 2 is PNPLA3 rs738409 CG, TM6SF2 rs58542926 CC, GCKR
The human gene group DNA of rs780094 CC genotype combination, concentration are 1-10ng/ μ L；
The positive quality control product 3 is PNPLA3 rs738409 GG, TM6SF2 rs58542926 CC, GCKR
The human gene group DNA of rs780094 CT genotype combination, concentration are 1-10ng/ μ L.
Embodiment two:
The susceptible related gene inspecting reagent kit of nonalcoholic fatty liver, the difference with embodiment one are to further include lysate
Stoste (NaOH solution of 2mol/L) and 20 × dilution (Tris-HCl of 1.0-2.0mol/L).
Embodiment three:
1, buccal swab sample DNA is extracted
Using the dedicated sampling suit of buccal swab or buccal swab sample, all sample centrifugations are taken out, supernatant is removed, adds
Enter the lysate of 100 μ L, 95 DEG C are boiled 10min, cool down 5min rapidly, and centrifugation takes out supernatant into new centrifuge tube, carries out mark
Note is put 2~8 DEG C and is kept in, and obtains DNA sample, is not used for a long time, please be stored in -20 ± 5 DEG C.
Or buccal swab sample DNA is extracted using commercial reagents box, obtain DNA sample.
2, PCR reaction system is prepared and is loaded
PCR reaction system number n (n=Sample size+positive control × 3+ negative control) is prepared according to Sample size, often
Pipe quantitative fluorescent PCR pipe dispenses 18 μ L of PCR reaction system, and DNA sample amount adds 2 μ L, 2 μ L of negative control, 2 μ L of positive control,
After being sufficiently mixed rear of short duration centrifugation, machine in preparation.
Using the susceptible related gene inspecting reagent kit of the nonalcoholic fatty liver of embodiment one, PCR reactant is prepared by table 4
It is each n pipe of 1-3.
Table 4
3, it by above-mentioned quantitative fluorescent PCR pipe, is put into fluorescent PCR instrument, program setting is as shown in table 5:
Table 5
For fluorescence signal collection at 361 DEG C of 45s of stage (* label), the fluorescence signal of collection is the fluorescence of probe label, can be with
For (FAM, JOE).The stage of adding 4 is needed to collect fluorescence signal using genotyping program, as a result software can automatically analyze number
According to.
4, interpretation of result
Quality-control product standard need to meet the following conditions: 1, positive quality control product testing result is normal；2, negative quality-control product detection knot
Fruit is normal.
After meeting two above condition, the analysis of gene type is carried out according to 6 pairs of detection samples of table, otherwise the failure of an experiment.
Table 6
PNPLA3 rs738409 C > G amplification curve interpretation result is as shown in Figure 1-3, be followed successively by Wild homozygous, heterozygosis
Type, mutated homozygous；
TM6SF2 rs58542926 C > T amplification curve interpretation result is as Figure 4-Figure 6, is followed successively by Wild homozygous, miscellaneous
Mould assembly, mutated homozygous；
GCKR rs780094 T > C amplification curve interpretation result is as Figure 7-9, be followed successively by Wild homozygous, heterozygous,
Mutated homozygous.
After the completion of amplified reaction, Analysis of test results is carried out by collecting obtained fluorescence signal: Y-axis is set as FAM
(genotype is wild type), X-axis is set as HEX (JOE) (genotype is saltant type), on Genotyping figure, close to the sample of Y-axis
This testing result is wild type, and the pattern detection result close to X-axis is saltant type, is heterozygous close to cornerwise sample.
Quality control standard: 1, negative quality-control product testing result point should be near origin；2, the detection of positive quality control product 1,2,3 knot
Fruit is that wild homozygous genotype point should be at X-axis, and mutant homozygous genotype call results point should be at close Y-axis, heterozygosis
Genotype call results point should be at diagonal line.
Specific sample results interpretation is as shown in figs. 10-12.
Example IV:
1,21 sample whole blood sample DNAs extract
(1) 200 μ L whole bloods, 600 μ L sterilizing purified water are sequentially added in 1.5mL centrifuge tube, concussion mixes, brief centrifugation,
Lysate lysis at room temperature 2min is added, then 13000rpm is centrifuged 2min, removes supernatant；600 μ L sterilizing purified water, shake is added
Mixing is swung, 13000rpm is centrifuged 2min, removes supernatant；The NaOH of 20 μ L0.25mol/L is added, concussion mixes, brief centrifugation；
(2) by step (1), treated that centrifuge tube is put into dry bath device: taking out after 99 DEG C of water-bath 8min and is cooled to room
Temperature, be added 180 μ 1 × dilutions of L, concussion mix, 13000rpm centrifugation 3min take 50~150 μ L supernatants be transferred to it is new from
In heart pipe, whole blood DNA sample is obtained, is saved backup in 2~8 DEG C；
Wherein, the configuration method of the lysate are as follows: take the susceptible related gene of the nonalcoholic fatty liver of 2mL embodiment two
14mL sterile water is added in lysate stoste in detection kit, 2~8 DEG C of preservations after mixing；
The configuration method of 1 × dilution are as follows: take the susceptible related gene detection examination of the nonalcoholic fatty liver of 2mL embodiment two
38mL sterile water is added in 20 × dilution in agent box, after mixing, 2~8 DEG C of preservations.
Or whole blood DNA is extracted using commercialization whole blood extracts kit, obtain whole blood DNA sample.
2, PCR reaction system number 25 is prepared according to Sample size, every pipe quantitative fluorescent PCR pipe dispenses PCR reaction system
18 μ L, DNA sample amount add 2 μ L, 2 μ L of negative control, 2 μ L of positive control, are sufficiently mixed rear of short duration centrifugation, machine in preparation.
Using the susceptible related gene inspecting reagent kit of the nonalcoholic fatty liver of embodiment two, PCR reactant is prepared by table 4
It is each 25 pipe of 1-3.
3, it by above-mentioned quantitative fluorescent PCR pipe, is put into fluorescent PCR instrument, program setting is as shown in table 5；
For fluorescence signal collection at 361 DEG C of 45s of stage (* label), the fluorescence signal of collection is the fluorescence of probe label, can be with
For (FAM, JOE).The stage of adding 4 is needed to collect fluorescence signal using genotyping program, as a result software can automatically analyze number
According to.
4, interpretation of result
Shown in 21 pattern detection result charts 7, compared with sequencing result, consistency 100%.
Table 7
| Serial number | Sample number | rs738409C>G | rs58542926C>T | rs780094C>T |
| 1 | B60060351 | CC | CC | CT |
| 2 | B60060352 | CC | CC | CC |
| 3 | B60060353 | CG | CC | CC |
| 4 | B60060354 | CG | CC | TT |
| 5 | B60060355 | CG | CC | TT |
| 6 | B60060356 | CG | CC | CT |
| 7 | B60060357 | CG | CC | CC |
| 8 | B60060358 | CG | CC | TT |
| 9 | B60060359 | CC | CC | CT |
| 10 | B60060360 | CC | CC | CC |
| 11 | B60060361 | CC | CC | CT |
| 12 | B60060362 | CC | CT | TT |
| 13 | B60060363 | CG | CC | CC |
| 14 | B60060364 | GG | CC | CT |
| 15 | B60060365 | GG | CC | TT |
| 16 | B60060366 | CC | CC | CT |
| 17 | B60060367 | CC | CC | CT |
| 18 | B60060368 | CG | CC | TT |
| 19 | B60060369 | CC | CC | CT |
| 20 | B60060370 | CG | CC | TT |
| 21 | B60060371 | CG | CC | TT |
In conclusion the susceptible related gene inspecting reagent kit of nonalcoholic fatty liver provided by the invention, is that one kind is used for
The detection kit of PNPLA3, TM6SF2, GCKR gene pleiomorphism, include in kit for detecting PNPLA3
Rs738409 C > G, TM6SF2 rs58542926 C > T, 3 SNP site polymorphisms of GCKR rs780094T > C 3 pairs of primers
With 3 pairs of probes, testing result and sequencing result accuracy rate are up to 100%, can three pipes and meanwhile detect sample three sites it is pure
Close wild type, homozygous mutant and heterozygous；It is easier to judge compared to the judging result using Δ Ct value method, it as a result can be by dividing
The accurate parting of type software can also carry out confirmation review by quantitative fluorescent PCR curve, as a result accurately and reliably；The present invention provides
The susceptible related gene inspecting reagent kit of nonalcoholic fatty liver do not limited by Sample size, can distribute detection Sample size,
Without collecting together sample, providing experimental result rapid and convenient when Sample size is few；
Comprising for extracting whole blood in the susceptible related gene inspecting reagent kit of the nonalcoholic fatty liver of offer of the invention
The extraction reagent of DNA sample, is utilized the principle of alkaline lysis, can be without purifying with rapidly extracting whole blood genomic nucleic acids
It can be used for expanding；More existing phenol chloroform method, adsorption column method of purification and paramagnetic particle method, step is simple, time-consuming short, and comparison reagent kit mentions
It is the extract operation period, at low cost, it is only necessary to which that two kinds of reagents can be completed nucleic acid extraction and meet the requirement of detection, can be applied to zero
It dissipates the extraction of sample, limited by sample size and reagent dosage and instrument, can be widely applied to the extraction of clinical sample.
The above description is only an embodiment of the present invention, is not intended to limit the scope of the invention, all to utilize this hair
Equivalents made by bright specification and accompanying drawing content are applied directly or indirectly in relevant technical field, similarly include
In scope of patent protection of the invention.
Sequence table
<110>A Jian (Foochow) gene Laboratory of medical test Co., Ltd
<120>the susceptible related gene inspecting reagent kit of nonalcoholic fatty liver
<160> 12
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213>artificial sequence
<400> 1
ggtgctctcg cctataactt ct 22
<210> 2
<211> 22
<212> DNA
<213>artificial sequence
<400> 2
gcagagaaag ccgacttacc ac 22
<210> 3
<211> 20
<212> DNA
<213>artificial sequence
<400> 3
gctggctgaa gaccttcatg 20
<210> 4
<211> 21
<212> DNA
<213>artificial sequence
<400> 4
aacagatgtc cagcagggtt c 21
<210> 5
<211> 21
<212> DNA
<213>artificial sequence
<400> 5
ggattcattc cactaaacca c 21
<210> 6
<211> 18
<212> DNA
<213>artificial sequence
<400> 6
catgttggct aggcttgt 18
<210> 7
<211> 15
<212> DNA
<213>artificial sequence
<400> 7
ttcctgcttc atccc 15
<210> 8
<211> 15
<212> DNA
<213>artificial sequence
<400> 8
ttcctgcttc atgcc 15
<210> 9
<211> 24
<212> DNA
<213>artificial sequence
<400> 9
caaatacagc tccgagatca ggcc 24
<210> 10
<211> 24
<212> DNA
<213>artificial sequence
<400> 10
caaatacagc tccaagatca ggcc 24
<210> 11
<211> 17
<212> DNA
<213>artificial sequence
<400> 11
atgactgaca catgttt 17
<210> 12
<211> 17
<212> DNA
<213>artificial sequence
<400> 12
atgactgaca catattt 17
Claims (6)
1. the susceptible related gene inspecting reagent kit of nonalcoholic fatty liver, which is characterized in that including for detecting PNPLA3
Rs738409 C > G, TM6SF2 rs58542926 C > T, GCKR rs780094 T > C3 SNP site polymorphism 3 pairs of primers
With 3 pairs of probes；
Sequence such as the SEQ ID No:1, SEQ ID No of the primer and probe for being used to detect PNPLA3 rs738409 C > G:
2, shown in SEQ ID No:7 and SEQ ID No:8；
Sequence such as the SEQ ID No:3, SEQ ID of the primer and probe for being used to detect TM6SF2 rs58542926 C > T
Shown in No:4, SEQ ID No:9 and SEQ ID No:10；
The sequence such as SEQ ID No:5 of primer and probe for detecting GCKR rs780094 T > C, SEQ ID No:6,
Shown in SEQ ID No:11 and SEQ ID No:12.
2. the susceptible related gene inspecting reagent kit of nonalcoholic fatty liver according to claim 1, which is characterized in that including
PCR reaction solution 1, PCR reaction solution 2 and PCR reaction solution 3；
The PCR reaction solution 1 includes the primer and probe for detecting PNPLA3 rs738409 C > G；
The PCR reaction solution 2 includes the primer and probe for detecting TM6SF2 rs58542926 C > T；
The PCR reaction solution 3 includes the primer and probe for detecting GCKR rs780094 T > C.
3. the susceptible related gene inspecting reagent kit of nonalcoholic fatty liver according to claim 2, which is characterized in that each
PCR reaction solution further includes 2 × qPCRMix, and the 2 × qPCRMix includes hot start Taq polymerase, dNTP, UNG enzyme and Mg2+。
4. the susceptible related gene inspecting reagent kit of nonalcoholic fatty liver according to claim 1, which is characterized in that also wrap
Include positive quality control product 1, positive quality control product 2, positive quality control product 3 and negative quality-control product；
The positive quality control product 1 is PNPLA3 rs738409 CC, TM6SF2 rs58542926 CT, GCKR rs780094 TT
The human gene group DNA of genotype combination, concentration are 1-10ng/ μ L；
The positive quality control product 2 is PNPLA3 rs738409 CG, TM6SF2 rs58542926 CC, GCKR rs780094 CC
The human gene group DNA of genotype combination, concentration are 1-10ng/ μ L；
The positive quality control product 3 is PNPLA3 rs738409 GG, TM6SF2 rs58542926 CC, GCKR rs780094 CT
The human gene group DNA of genotype combination, concentration are 1-10ng/ μ L；
The feminine gender quality-control product is sterilizing purified water.
5. the susceptible related gene inspecting reagent kit of nonalcoholic fatty liver according to claim 1, which is characterized in that also wrap
Include DMSO additive.
6. the susceptible related gene inspecting reagent kit of nonalcoholic fatty liver according to claim 1, which is characterized in that also wrap
Include lysate stoste and 20 × dilution.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910456137.0A CN110079597A (en) | 2019-05-29 | 2019-05-29 | The susceptible related gene inspecting reagent kit of nonalcoholic fatty liver |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910456137.0A CN110079597A (en) | 2019-05-29 | 2019-05-29 | The susceptible related gene inspecting reagent kit of nonalcoholic fatty liver |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110079597A true CN110079597A (en) | 2019-08-02 |
Family
ID=67422327
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910456137.0A Pending CN110079597A (en) | 2019-05-29 | 2019-05-29 | The susceptible related gene inspecting reagent kit of nonalcoholic fatty liver |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110079597A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113025701A (en) * | 2021-03-10 | 2021-06-25 | 北京科力丹迪生物医疗科技有限公司 | Early screening method and kit for non-alcoholic fatty liver disease susceptibility gene |
| WO2022010917A1 (en) * | 2020-07-06 | 2022-01-13 | Laboratory Corporation Of America Holdings | Methods, compositions, and systems for detecting pnpla3 allelic variants |
| CN114231620A (en) * | 2021-12-31 | 2022-03-25 | 吉林大学第一医院 | Application of UQCC1 gene polymorphism in diagnosis of moderate and severe MAFLD |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102146438A (en) * | 2010-12-22 | 2011-08-10 | 协和干细胞基因工程有限公司 | Kit for detecting alcoholic liver disease susceptibility |
| CN105039513A (en) * | 2015-05-29 | 2015-11-11 | 广州市第一人民医院 | Method and primer for detection of non-alcoholic fatty liver disease-correlated target gene polymorphism, as well as kit |
| WO2017021926A1 (en) * | 2015-08-05 | 2017-02-09 | Orga Bio Human S.R.L. | Snp rs12603226 as a predictive marker for nafld |
-
2019
- 2019-05-29 CN CN201910456137.0A patent/CN110079597A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102146438A (en) * | 2010-12-22 | 2011-08-10 | 协和干细胞基因工程有限公司 | Kit for detecting alcoholic liver disease susceptibility |
| CN105039513A (en) * | 2015-05-29 | 2015-11-11 | 广州市第一人民医院 | Method and primer for detection of non-alcoholic fatty liver disease-correlated target gene polymorphism, as well as kit |
| WO2017021926A1 (en) * | 2015-08-05 | 2017-02-09 | Orga Bio Human S.R.L. | Snp rs12603226 as a predictive marker for nafld |
| CN108012546A (en) * | 2015-08-05 | 2018-05-08 | 奥尔加生物人类有限责任公司 | Predictive markers of the SNP RS12603226 as NAFLD |
Non-Patent Citations (2)
| Title |
|---|
| 宋燕，等: "PNPLA3基因多态性与非酒精性脂肪性肝病关系的初步探讨", 《现代检验医学杂志》 * |
| 郭亮，等: "非酒精性脂肪肝发病机制和治疗的研究进展", 《生命科学》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022010917A1 (en) * | 2020-07-06 | 2022-01-13 | Laboratory Corporation Of America Holdings | Methods, compositions, and systems for detecting pnpla3 allelic variants |
| CN113025701A (en) * | 2021-03-10 | 2021-06-25 | 北京科力丹迪生物医疗科技有限公司 | Early screening method and kit for non-alcoholic fatty liver disease susceptibility gene |
| CN114231620A (en) * | 2021-12-31 | 2022-03-25 | 吉林大学第一医院 | Application of UQCC1 gene polymorphism in diagnosis of moderate and severe MAFLD |
| CN114231620B (en) * | 2021-12-31 | 2023-03-10 | 吉林大学第一医院 | Application of UQCC1 gene polymorphism in diagnosis of moderate and severe MAFLD (myeloproliferative disorder) |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101760528B (en) | Medicine metabolic relevant loci detection method | |
| CN105506118B (en) | Primer pair, fluorescence probe, kit and method for detecting CYP2C19 Genotypings | |
| CN104673915B (en) | Rapid detection kit for gene single-nucleotide polymorphism site and method for rapid detection kit | |
| CN110079597A (en) | The susceptible related gene inspecting reagent kit of nonalcoholic fatty liver | |
| CN108410961A (en) | A kind of kit and its method of detection CYP3A4, CYP3A5 polymorphic site | |
| CN107201410A (en) | ARMS qPCR methods and kit for helicobacter pylori individuation genetic test | |
| CN113025701B (en) | Early screening method and kit for non-alcoholic fatty liver disease susceptibility gene | |
| CN106755360B (en) | Nucleic acid, kit and method for detecting human CYP2D6 gene polymorphism | |
| CN107227371A (en) | Primer, molecular beacon, kit and its detection method of CYP2C9*3 gene pleiomorphism quick detections | |
| CN107893114A (en) | For primer pair, kit and the method for instructing fentanyl class medicine personalized medicine related gene to detect | |
| CN110699440A (en) | Primer and method for detecting SNP (single nucleotide polymorphism) locus of gene related to metformin personalized medicine | |
| CN106755320B (en) | Nucleic acid, kit and method for detecting human OPRM1 gene A118G site polymorphism | |
| CN104711345A (en) | Quick detection kit for the CYP2C19*2 genetype and detection method thereof | |
| CN105648082A (en) | Primer-probe combination and kit for detecting associated genotyping of warfarin medication | |
| CN106282329A (en) | A kind of helicobacter pylori gyrA gene mutation detection kit and detection method thereof | |
| CN108913766A (en) | A kind of specific primer and probe and kit detecting depressed individuals chemical drug object therapeutic gene multisite mutation | |
| CN107653317A (en) | A kind of kit of molecular beacon probe detection mankind's CYP2C9 gene pleiomorphisms, method and its application | |
| CN106868174A (en) | Detect the kit and method of the full extron of ADAMTS13 genes | |
| CN106636370A (en) | Nucleic acid, kit and method for detecting human HLA-B*5701 allele | |
| CN110819709A (en) | Method for detecting CYP2C9 and VKORC1 gene polymorphism by fluorescent quantitative PCR (polymerase chain reaction) | |
| CN110093424A (en) | For detecting the primer, probe and kit of HBV associated hepatocellular carcinoma neurological susceptibility | |
| CN110734969A (en) | PCR-RFLP method for detecting single nucleotide polymorphism of gene CREB1 | |
| CN113322317A (en) | Primer pair, probe set and kit for mitochondrial obesity gene mutation detection | |
| CN104789652A (en) | ABCB1 genotype rapid detection kit and method thereof | |
| CN102796819A (en) | Kit for detecting microdeletion of Y chromosome |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |