CN108410961A

CN108410961A - A kind of kit and its method of detection CYP3A4, CYP3A5 polymorphic site

Info

Publication number: CN108410961A
Application number: CN201810747931.6A
Authority: CN
Inventors: 唐荣; 苏丽; 吴丹
Original assignee: Wo Wo Medical Technology (shanghai) Co Ltd
Current assignee: Zhejiang dingchuang Medical Technology Co.,Ltd.
Priority date: 2018-07-10
Filing date: 2018-07-10
Publication date: 2018-08-17
Anticipated expiration: 2038-07-10
Also published as: JP2021531040A; CN108410961B; WO2020011277A1

Abstract

The invention discloses it is a kind of detection CYP3A4, CYP3A5 polymorphic site kit and its method, including in sequence table CYP3A5*3 shown in the specific upstream and downstream primer sequence and sequence 13 16 of CYP3A5*3 shown in the bis- fluorescence probe sequences of specificity T aqMan MGB, sequence 9 12 of CYP3A4*1G shown in the specific upstream and downstream primer sequence, sequence 58 of CYP3A4*1G shown in sequence 14 the bis- fluorescence probe sequences of specificity T aqMan MGB.Beneficial effects of the present invention are high specificity, anti-pollution, high sensitivity, detection speed is fast, interpretation of result is simple and accuracy is high, the kit can pass through detection CYP3A4, CYP3A5 gene polymorphism sites, judge the metabolic capability of object remifentanil class drug to be measured, to the more acurrate medication for effectively instructing the drugs such as fentanyl class, there is actual clinical value.After the kit to be applied to clinical diagnosis, the goodness of fit higher with the prior art, and cheap, repeatable height.

Description

A kind of kit and its method of detection CYP3A4, CYP3A5 polymorphic site

Technical field

The present invention relates to biotechnologies, and in particular to it is polymorphic to relate more specifically to CYP3A4, CYP3A5 for genetic test Property locus gene detection kit and its method.

Background technology

CYP3A4 is most important member in CYP3A subfamilies, accounts for the 30% ~ 40% of P450 enzyme system total amounts, is mainly distributed on Liver and enteron aisle.It takes part in the oxidative metabolism of many drugs and exogenous poisonous substance, metabolizable about 50% clinical commonly used drug. Research shows that there is apparent individual differences for the expression of CYP3A4 and its activity in people's liver, and this species diversity 90% and something lost It is related to pass polymorphism.CYP3A4 genes are located on No. 7 chromosome 7q21.1-q22.1 of the mankind, are about 27 kbp, gene knot Structure includes 13 exons and 12 intrones.CYP3A4*1G （20230G>A）It is a monokaryon in CYP3A4 introne 1s 0 Nucleotide polymorphism（SNP）, the occurrence frequency in Chinese han population is 22.1%~37%.CYP3A4*1G cuts down him with atropic Dosage, curative effect and the pharmacokinetics of the drugs such as spit of fland, cyclosporin, tacrolimus, fentanyl change related.

CYP3A5 is located at the mankind No. 7 chromosome q21.1-q22.1, full length gene 31.8kb, there is 13 exons, coding 502 amino acid.CYP3A5 accounts for the 50% of CYP3A total amounts, mainly in liver and small intestine and other extrahepatic tissues such as kidney, prostate and It is expressed in lung, CYP3A5 expression and activity are in high polymorphism, there is individual and racial difference extensively.The amino acid of CYP3A5 enzymes There are 84% similitude, CYP3A5 enzymes and CYP3A4 enzymes that there is the metabolism substrate of many overlappings with the amino acid of coding CYP3A4 enzymes With similar catalytic activity, but CYP3A5 activity ratios CYP3A4 low 80%.Wherein it is located at SNP (6986 A of introne 3>G is prominent Become) it is mostly important, mutation is defined as CYP3A5*3, and the occurrence frequency in Chinese population is higher（71%~77.8%）.

Fentanyl class drug be artificial synthesized potent narcotic antalgesic, analgesic mechanism is similar to morphine, for opium by Body agonist, action intensity are 60-80 times of morphine.It mainly passes through the CYP3A4/ of liver cytochrome enzyme P450 systems CYP3A5 subfamilies are metabolized, and the metabolic rate of drug in vivo is influenced by enzyme activity.Fentanyl class drug is clinical main anesthesia Medication, once but drug dose excess, the danger that respiration inhibition can be caused even dead.By the master for detecting fentanyl class drug The gene loci for wanting metabolic gene CYP3A4/CYP3A5, to judge the metabolic capability of patient's remifentanil class drug, to instruct The dosage of drug.

Many drugs are metabolized by the enzyme of P450 families at present, are measured P450 genotype, are determined that enzyme activity is very crucial.But Several critical sites of CYP3A4, CYP3A5 gene, since sequential structure is more special, the difficulty for designing fluorescence probe is larger, And the probe designed the PCR primer not high while matching to the rate respectively of genotype require it is also high, primer itself or There are secondary structure or primer are low with the joint efficiency of DNA profiling between upstream and downstream primer, the DNA moulds between upstream and downstream primer There are the special constructions such as high GC for plate sequence, all PCR efficiency will be caused low.Current market sales of parting product, it is only global Maximum biotech firm Thermal Fisher are provided, and sequence all maintains secrecy with formula, and kit is expensive.State at present It is interior general gene pleiomorphism to be detected using direct sequencing and qualitative PCR method.The sensitivity and specificity of both methods are equal It is not high, it can not accurately detect gene pleiomorphism.In addition, direct Sequencing is largely tested using outsourcing, detection time is too It is long, 24 hours are at least needed, is made troubles for detection.

In conclusion there is an urgent need in the art to develop, easy to operate, specificity is good, accuracy rate is high, can efficiently detect The kit and method of CYP3A4, CYP3A5 polymorphic site, to make up domestic CYP3A4, CYP3A5 genetic test in terms of not Foot.

Invention content

Present inventor's in-depth study by extensive by, is largely screened, has found suitable CYP3A4*1G, CYP3A5* The specific primer and the bis- fluorescence probes of specificity T aqMan-MGB of 3 genetic tests, provide in particular for CYP3A4*1G bases The upstream and downstream primer and specificity fluorescent probe of cause and CYP3A5*3 genes are made more for detecting CYP3A4, CYP3A5 gene The real-time fluorescence PCR assay kit in state property site.

Kit provided by the present invention for detecting CYP3A4, CYP3A5 polymorphic site includes sequence 1- in sequence table The specificity T aqMan-MGB of CYP3A4*1G shown in the specific primer upstream and downstream sequence of CYP3A4*1G shown in 4, sequence 5-8 is bis- CYP3A5* shown in the specific primer upstream and downstream sequence of CYP3A5*3 and sequence 13-16 shown in fluorescence probe sequence, sequence 9-12 The 3 bis- fluorescence probe sequences of specificity T aqMan-MGB；2 × Master Mix and operation instructions.

A kind of kit of detection CYP3A4, CYP3A5 polymorphic site, which includes primer, specificity T aqMan Double fluorescence probes and PCR amplification reagent, wherein detection kit are divided into two groups：

A groups

Primer sequence for detection site CYP3A4*1G：

SEQ1：5' CAGAGCCTTCCTACATAGAG 3'；

SEQ2：5' GGCCCAATCAATTATCTTTA 3'；

Probe sequence for detection site CYP3A4*1G：

SEQ3：5'FAM-TCTCCATGTACCATCCACTC-3' MGB；

SEQ4：5' VIC-TCTCCATGTATCATCCACTC-3' MGB；

Primer sequence for detection site CYP3A5*3：

SEQ5：5' AGAGTGGCATAGGAGATACC 3'；

SEQ6：5' GTGTGACACACAGCAAGAGT 3'；

Probe sequence for detection site CYP3A5*3：

SEQ7：5' FAM-TTGTCTTTCAATATCTCTTCCC-3' MGB；

SEQ8：5' VIC-TTGTCTTTCAGTATCTCTTCCC-3' MGB；

B groups

Primer sequence for detection site CYP3A4*1G：

SEQ9：5' CTTACGCTTCTGCCAGTAG 3'；

SEQ10：5' TATGTATGAACTGGCCACTC 3'；

Probe sequence for detection site CYP3A4*1G：

SEQ11：5' FAM-CTCCATGTACCATCCACT-3' MGB；

SEQ12：5' VIC-CTCCATGTATCATCCACT-3' MGB；

Primer sequence for detection site CYP3A5*3：

SEQ13：5' GAGAGTGGCATAGGAGATAC 3'；

SEQ14：5' AAGCCAGACTTTGATCATTA 3'；

Probe sequence for detection site CYP3A5*3：

SEQ15：5' FAM-TGTCTTTCAATATCTCTTCCC-3' MGB；

SEQ16：5' VIC-TGTCTTTCAGTATCTCTTCCC-3' MGB；

The bis- fluorescence probes of specificity T aqMan are divided into specific wild type TaqMan fluorescence probes and specific mutations type TaqMan fluorescence probes, 5 ' ends are connected with fluorescent reporter group, and 3 ' ends are connected with quenching group；The specificity wild type The fluorescent reporter group of TaqMan fluorescence probes and the specific mutations type TaqMan fluorescence probes is different certainly, is quenched Group can it is identical can be different.

The fluorescent reporter group can be selected from the reporter group of the following group：FAM、VIC、TET、JOE、HEX；

The quenching group can be selected from the quenching group of the following group：BHQ1、BHQ2、TAMRA、MGB.

Preferably, the fluorescent reporter group of specific wild type TaqMan fluorescence probes of the present invention is FAM, is quenched Group is MGB；The fluorescent reporter group of the specific mutations type TaqMan fluorescence probes is VIC, quenching group MGB.

The PCR amplification reagent includes PCR buffer solution dATP, dCTP, dGTP, dUTP, dTTP, UDG enzyme, Taq enzyme and dd H2O。

Kit of the present invention can be used for the detection of CYP3A4, CYP3A5 polymorphic site, and detection method includes the following steps：

The genomic DNA of sample to be tested, a concentration of 10-100ng/ μ L, the sample to be tested are extracted using Extraction Methods of Genome It is selected from：Blood sample, saliva sample, buccal swab, or combinations thereof；

Compound concentration be the primer solution of 50-900nM, a concentration of 50-500nM probe solution and PCR amplification reagent（2× Master Mix）；

2 × Master Mix components	Concentration range
		Tris-HCl（pH8.0-pH9.0）	10-100mM
KCl	10-50 mM
		(NH4)2SO4	1-10 mM
MgCl2	1.5-6.0mM
		dATP	0.2-0.5mM
dCTP	0.2-0.5mM
		dGTP	0.2-0.5mM
dUTP	0.2-0.5mM
		dTTP	0.1-0.3mM
UDG enzymes	0.05-0.2U
		Taq enzyme	0.05-0.2U
Glycerine	10-20%

3）Prepare quantitative fluorescent PCR reaction system：Including PCR amplification reagent, specific primer upstream and downstream, specific wild type The genomic DNA and ddH2O of TaqMan fluorescence probes, specific mutations type TaqMan fluorescence probes, sample to be tested；

4）PCR amplification is carried out with real-time fluorescence quantitative PCR instrument：

37-50℃ 2-3min

95℃ 10min

95℃ 15s

58-62℃ 1min

5）The data that amplification obtains are analyzed, the genotyping result of gene is obtained.

This kit can be used for detecting CYP3A4, CYP3A5 gene polymorphism sites, judge object remifentanil class to be measured The metabolic capability of drug, to the more acurrate medication for effectively instructing the drugs such as fentanyl class.

By detecting CYP3A4 and CYP3A5 gene polymorphism sites, CYP3A4 and CYP3A5 assortment of genes medicaments are provided Gradient fractionation (table 1) is measured, dosage is classified as I-IV grades (i.e. I grades of dosage is minimum, and IV grades of dosages are most), practical medication from less to more Amount is subject to actual clinical.For example, when reaching identical analgesic effect, the PCIA sufentanil amounts of * 1G/*1G group patients consumption are (49.8 ± 10.2) μ g reduce (P ＜ compared with * 1/*1 groups (64.6 ± 10.9) μ g and * 1/*1G groups (62.5 ± 12.7) μ g 0.01)。

The dosage of table 1 CYP3A4 and CYP3A5 genes and fentanyl

Advantageous effect：

The kit can quickly and easily detect CYP3A4, CYP3A5 gene polymorphism sites, and advantage is：

1, high specificity：This kit uses the bis- fluorescence probes of specificity T aqMan to know gene polymorphism sites Not, and TaqMan probe is connected with MGB quenching groups at 3 ' ends.Son is quenched in MGB probe unstressed configurations, reduces background signal, increases Add signal-to-noise ratio；The Tm values of probe are improved 10 DEG C or so, improve the annealing temperature of probe and template conjugate, enhance DNA Combination；The two combination is can inhibit when the single base of probe and template mismatches, improves special probe specificity.

2, anti-pollution：DUTP and UDG enzymes are added in PCR amplification reagent, can prevent Aerosol Pollution；This kit It is not required to uncap in amplification and detection process, is carried out in same pipe, reduce the possibility of pollution.

3, high sensitivity：Denier genomic DNA can also detect CYP3A4, CYP3A5 gene pleiomorphism.

4, detection speed is fast：The PCR reaction time is short, can directly see testing result after completion of the reaction；It can once examine Survey single or multiple samples.

5, interpretation of result is simple and accuracy is high：There are two specificity T aqMan-MGB probes, detection knot in this kit Fruit can directly obtain from amplification curve, improve the accuracy for judging gene polymorphism sites.

6, the kit can judge object to be measured to sweet smell too by detecting CYP3A4, CYP3A5 gene polymorphism sites The metabolic capability of Buddhist nun's class drug to the more acurrate medication for effectively instructing the drugs such as fentanyl class there is actual clinic to answer With value.After the kit to be applied to clinical diagnosis, the goodness of fit higher with the prior art, and it is cheap, repeatable Property it is high.

Description of the drawings

Figure 1A is the amplification curve diagram of the A groups CYP3A4*1G of sample 1；

Figure 1B is the amplification curve diagram of the B groups CYP3A4*1G of sample 1；

Fig. 2A is the amplification curve diagram of the A groups CYP3A5*3 of sample 1；

Fig. 2 B are the amplification curve diagram of the B groups CYP3A5*3 of sample 1；

Fig. 3 A are the amplification curve diagram of the A groups CYP3A4*1G of sample 2；

Fig. 3 B are the amplification curve diagram of the B groups CYP3A4*1G of sample 2；

Fig. 4 A are the amplification curve diagram of the A groups CYP3A5*3 of sample 2；

Fig. 4 B are the amplification curve diagram of the B groups CYP3A5*3 of sample 2；

Fig. 5 is sample amplification curve graph Comprehensive Correlation figure.

Specific implementation mode

With reference to embodiment and attached drawing, present disclosure is further illustrated, and the present invention is further elaborated, But these embodiments have any restrictions to the present invention absolutely not.

Embodiment 1：The collection of sample

30 minutes before sample collection, patient is gargled using clear water, should not be fed in 30 minutes, drinking-water.

1, buccal swab packaging is opened, carefully takes out swab, swab head rubs 20-30 times back and forth in oral cavity wall.

2, it opens saliva preservation pipe swab head fractures in preserving pipe, covers and preserve pipe lid, complete sample collection.

Embodiment 2：DNA is extracted

This extraction steps uses standing grain medical science and technology of writing from memory（Shanghai）The saliva DNA extraction kit of Co., Ltd（Paramagnetic particle method）It is carried It takes.Extraction obtains sample to be tested 1,2,3.

1. the sample gathered is placed on isothermal vibration blending instrument, 56 DEG C of selection parameter, 15min, 800rpm/min.Into Row saliva sample pre-treatment.

2. opening kit, comb is taken out, is rocked 6-10 time up and down, makes comb 7. after the magnetic bead mixing in hole, careful removing Sealed membrane;

3. be added in the 1. hole after 300 μ L processing after saliva sample, 100 μ L elution buffers are added in the 9. hole, it will Comb is placed to CTC-2000 instrument for extracting nucleic acid drawers, and bar magnet set is loaded onto.Select the operation of saliva DNA programs.

4. the DNA after EP (end of program) after extraction is collected in 9. hole carries out subsequent experimental or -20 DEG C of preservations.

After testing, sample to be tested 1,2 DNA concentration is respectively 10ng/ μ L, 40ng/ μ L.

3 fluorescent PCR of embodiment detects

1. by CYP3A4*1G specificity upstream and downstream primers sequence 1 and sequence 2, the bis- fluorescence probe sequences of specificity T aqMan-MGB 5 and sequence 6；CYP3A4*1G specificity upstream and downstream primers sequence 3 and sequence 4, the bis- fluorescence probe sequences of specificity T aqMan-MGB 7 and sequence 8；CYP3A5*3 specificity upstream and downstream primers sequence 9 and sequence 10, the bis- fluorescence probe sequences of specificity T aqMan-MGB 13 and sequence 14；CYP3A5*3 specificity upstream and downstream primers sequence 11 and sequence 12, the bis- fluorescence probes of specificity T aqMan-MGB Sequence 15 and sequence 16 are divided into two groups（Respectively A groups, B groups）PCR experiment is carried out, shown in table specific as follows：

2. preparing quantitative fluorescent PCR reaction system：Including PCR amplification reagent, specific primer upstream and downstream, specific wild type The genomic DNA and ddH2O of TaqMan fluorescence probes, specific mutations type TaqMan fluorescence probes, sample to be tested；

The composition of TaqMan 2 × Master of fluorescent quantitation Mix (1mL) is as follows：

Component	Concentration
		Tris-HCl(pH8.6)	50mM
KCl	50mM
		(NH₄)₂SO₄	5mM
MgCl₂	4mM
		dATP	0.4mM
dCTP	0.4mM
		dGTP	0.4mM
dUTP	0.4mM
		dTTP	0.2mM
UDG enzymes	0.2U
		Taq enzyme	0.2U
Glycerine	13%

PCR reaction systems (10 μ L) are as follows：

2× Master Mix	5 μl
		ddH2O	3 μl
Primers F (10 μM)	0.25 μl
		Primer R (10 μM)	0.25 μl
Probe 1 (10 μM)	0.25 μl
		Probe 2 (10 μM)	0.25 μl
Template DNA	1μl

3. reaction condition is：50 DEG C 2 minutes → 95 DEG C 10 minutes → [95 DEG C 15 seconds, 60 DEG C 1 minute] totally 40 Cycle.

4. as shown in Figure 4.The result shows that having amplification curve after 2 groups of primed probes amplification of this kit CYP3A5*3 Experimental result

The amplification curve of two groups of CYP3A4*1G of sample 1 is as shown in Figure 1.The result shows that 2 groups of this kit CYP3A4*1G There is an amplification curve after primed probe amplification, but B groups（Figure 1B）Than the amplification efficiency higher of A group (Figure 1A).It can from figure Clearly two kinds of fluorescence of the FAM and VIC of judgement sample 1 have amplification curve, so CYP3A4 genotype is heterozygous （CYP3A4*1/*1G）.

The amplification curve of two groups of CYP3A5*3 of sample 1 is as shown in Figure 2.The result shows that the 2 of this kit CYP3A5*3 Organizing has amplification curve after primed probe expands, but B groups（Fig. 2 B）Than the amplification efficiency higher of A group (Fig. 2A).From figure, energy There are the amplification curves of FAM fluorescence for enough clearly judgement samples 1 without the amplification curve of VIC fluorescence, so sample 1 CYP3A5 genotype is wild homozygous（CYP3A5*1/*1）.

The amplification curve of two groups of CYP3A4*1G of sample 2 is as shown in Figure 3.The result shows that this kit CYP3A4*1G The amplification of 2 groups of primed probes after have an amplification curve, but B groups（Fig. 3 B）Than the amplification efficiency higher of A group (Fig. 3 A).From figure Clearly can only have the amplification curve of VIC fluorescence without the amplification curve of FAM fluorescence by judgement sample 2, so sample 2 CYP3A4 genotype is mutant homozygous type（CYP3A4*1G/*1G）.

The amplification curve of two groups of CYP3A5*3 of sample 2, but B groups（Fig. 4 B）Than A group (Fig. 4 A) amplification efficiency more It is high.From figure, the two kinds of fluorescence of FAM and VIC for capableing of clearly judgement sample 2 have amplification curve, so 2 CYP3A5 of sample Genotype is heterozygous（CYP3A5*1/*3）.

CYP3A4 and CYP3A5 genetic tests result and fentanyl metabolic capability

	CYP3A4 genotype	CYP3A5 genotype	Fentanyl metabolic capability
				Sample 1	CYP3A41/1G	CYP3A51/1	Normally
Sample 2	CYP3A41G/1G	CYP3A51/3	It is most weak

The sequencing of above example is only for ease of description, can not represent the quality of embodiment.

Finally it should be noted that：The above embodiments are merely illustrative of the technical solutions of the present invention, rather than its limitations；Although Present invention has been described in detail with reference to the aforementioned embodiments, it will be understood by those of ordinary skill in the art that：It still may be used With technical scheme described in the above embodiments is modified or equivalent replacement of some of the technical features； And these modifications or replacements, various embodiments of the present invention technical solution that it does not separate the essence of the corresponding technical solution spirit and Range.

Sequence table

<110>Silent standing grain medical science and technology（Shanghai）Co., Ltd

<120>A kind of kit and its method of detection CYP3A4, CYP3A5 polymorphic site

<160> 16

<210> 1

<211> 20

<212> DNA

<213>Homo sapiens（Homo sapiens）

<400> 1

cagagccttc ctacatagag 20

<210> 2

<211> 20

<212> DNA

<213>Homo sapiens（Homo sapiens）

<400> 2

ggcccaatca attatcttta 20

<210> 3

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<220>

<223>Probe

<400> 3

tctccatgta ccatccactc 20

<210> 4

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<220>

<223>Probe

<400> 4

tctccatgta tcatccactc 20

<210> 5

<211> 20

<212> DNA

<213>Homo sapiens（Homo sapiens）

<400> 5

agagtggcat aggagatacc 20

<210> 6

<211> 20

<212> DNA

<213>Homo sapiens（Homo sapiens）

<400> 6

gtgtgacaca cagcaagagt 20

<210> 7

<211> 22

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<220>

<223>Probe

<400> 7

ttgtctttca atatctcttc cc ttgtcttt cagtatctct tccc 22

<210> 8

<211> 22

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<220>

<223>Probe

<400> 8

ttgtctttca gtatctcttc cc 22

<210> 9

<211> 19

<212> DNA

<213>Homo sapiens（Homo sapiens）

<400> 9

cttacgcttc tgccagtag t atgtatgaac tggccactc 19

<210> 10

<211> 20

<212> DNA

<213>Homo sapiens（Homo sapiens）

<400> 10

Tatgtatgaa ctggccactc 20

<210> 11

<211> 18

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<220>

<223>Probe

<400> 11

ctccatgtac catccact ct ccatgtatca tccact 18

<210> 12

<211> 18

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<220>

<223>Probe

<400> 12

ctccatgtat catccact 18

<210> 13

<211> 20

<212> DNA

<213>Homo sapiens（Homo sapiens）

<400> 13

gagagtggca taggagatac 20

<210> 14

<211> 20

<212> DNA

<213>Homo sapiens（Homo sapiens）

<400> 14

aagccagact ttgatcatta 20

<210> 15

<211> 21

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<220>

<223>Probe

<400> 15

tgtctttcaa tatctcttcc c 21

<210> 16

<211> 21

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<220>

<223>Probe

<400> 16

tgtctttcag tatctcttcc c 21

Claims

1. a kind of kit of detection CYP3A4, CYP3A5 polymorphic site, which includes primer, and specificity T aqMan is bis- Fluorescence probe and PCR amplification reagent, wherein detection kit are divided into two groups：

A groups

Primer sequence for detection site CYP3A4*1G：

SEQ1：5' CAGAGCCTTCCTACATAGAG 3'；

SEQ2：5' GGCCCAATCAATTATCTTTA 3'；

Probe sequence for detection site CYP3A4*1G：

SEQ3：5'FAM-TCTCCATGTACCATCCACTC-3' MGB；

SEQ4：5' VIC-TCTCCATGTATCATCCACTC-3' MGB；

Primer sequence for detection site CYP3A5*3：

SEQ5：5' AGAGTGGCATAGGAGATACC 3'；

SEQ6：5' GTGTGACACACAGCAAGAGT 3'；

Probe sequence for detection site CYP3A5*3：

SEQ7：5' FAM-TTGTCTTTCAATATCTCTTCCC-3' MGB；

SEQ8：5' VIC-TTGTCTTTCAGTATCTCTTCCC-3' MGB；

B groups

Primer sequence for detection site CYP3A4*1G：

SEQ9：5' CTTACGCTTCTGCCAGTAG 3'；

SEQ10：5' TATGTATGAACTGGCCACTC 3'；

Probe sequence for detection site CYP3A4*1G：

SEQ11：5' FAM-CTCCATGTACCATCCACT-3' MGB；

SEQ12：5' VIC-CTCCATGTATCATCCACT-3' MGB；

Primer sequence for detection site CYP3A5*3：

SEQ13：5' GAGAGTGGCATAGGAGATAC 3'；

SEQ14：5' AAGCCAGACTTTGATCATTA 3'；

Probe sequence for detection site CYP3A5*3：

SEQ15：5' FAM-TGTCTTTCAATATCTCTTCCC-3' MGB；

SEQ16：5' VIC-TGTCTTTCAGTATCTCTTCCC-3' MGB；

The bis- fluorescence probes of specificity T aqMan are divided into specific wild type TaqMan fluorescence probes and specific mutations type TaqMan fluorescence probes, 5 ' ends are connected with fluorescent reporter group, and 3 ' ends are connected with quenching group；The specificity wild type The fluorescent reporter group of TaqMan fluorescence probes and the specific mutations type TaqMan fluorescence probes is different certainly, is quenched Group can it is identical can be different；

The quenching group can be selected from the quenching group of the following group：BHQ1、BHQ2、TAMRA、MGB；

The fluorescent reporter group of the specificity wild type TaqMan fluorescence probes is FAM, quenching group MGB；It is described special Property saltant type TaqMan fluorescence probes fluorescent reporter group be VIC, quenching group MGB；

The detection of CYP3A4, CYP3A5 polymorphic site kit is in the metabolic energy for judging object remifentanil class drug to be measured Application in power.

2. a kind of kit of detection CYP3A4, CYP3A5 polymorphic site according to claim 1, which is characterized in that The PCR amplification reagent includes dATP, dCTP, dGTP, dUTP, dTTP, UDG enzyme, Taq enzyme and dd H₂O。

3. a kind of detection method of detection CYP3A4, CYP3A5 polymorphic site, includes the following steps：

1）Compound concentration be the primer solution of 50-900nM, a concentration of 50-500nM probe solution；

Prepare PCR amplification liquid：

3）Sample to be tested DNA, a concentration of 10-100ng/ μ L, the sample to be tested are selected from：Blood sample, saliva sample, oral cavity are wiped Son, or combinations thereof；

4）Carry out PCR amplification：

37-50℃ 2-3min

95℃ 10min

95℃ 15s

58-62℃ 1min

5）Detection sample is detected with real-time fluorescence quantitative PCR instrument.