CN107299140A - MTHFR A1298C gene pleiomorphism quick detections primer, molecular beacon, kit and detection method - Google Patents
MTHFR A1298C gene pleiomorphism quick detections primer, molecular beacon, kit and detection method Download PDFInfo
- Publication number
- CN107299140A CN107299140A CN201710615435.0A CN201710615435A CN107299140A CN 107299140 A CN107299140 A CN 107299140A CN 201710615435 A CN201710615435 A CN 201710615435A CN 107299140 A CN107299140 A CN 107299140A
- Authority
- CN
- China
- Prior art keywords
- mthfr
- molecular beacon
- kit
- gene
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses the kit of MTHFR A1298C, RS1801131 gene pleiomorphism quick detections, including PCR reaction solutions, specific primer and molecular beacon;The 0.1U/ μ L of archaeal dna polymerase 0.04;dNTPs 0.1‑0.5mM;The 1.5X of 5X PCR buffer solutions 0.5;MgCl2 1‑2.5mM;Lauryl sodium sulfate 0.0005 0.015%(w/v);Triton X-100 0.001 0.03%(w/v);Specific primer includes sense primer and anti-sense primer, and its final concentration is 0.2 0.7 μM;Molecular beacon includes mutant molecules beacon and wild type molecular beacon, and its final concentration is 0.2 0.7 μM;It is used to detect cell sample.The technical problem to be solved in the present invention is to provide it is a kind of it is simple to operate, avoid polluting and detect primer, molecular beacon, kit and its detection method involved by quick MTHFR A1298C, RS1801131 gene pleiomorphism quick detection.
Description
Technical field
The present invention relates to biology field, and in particular to a kind of MTHFR-A1298C, RS1801131 gene pleiomorphism
Primer, molecular beacon, kit and its detection method of quick detection.
Background technology
Nucleotide polymorphisms (Single Nucleotide Polymorphism, SNP) are primarily referred to as in genomic level
On as the DNA sequence dna caused by single nucleotide acid (A, T, C, G) variation polymorphism.It is related to many diseases, decide people
The neurological susceptibility of class disease and the otherness of drug response.Therefore, SNP analyzing and diagnosing, clinical examination, medical jurisprudence, Pathogen test,
There is important application value in terms of genetic disease and new drug development.
Molecular beacon (molecular beacon) is a kind of oligonucleotide chain of fluorescence labeling.Its 5 ' and 3 ' ends from
The stem ring double labelling oligonucleotide molecules beacon of the hairpin structure of body one 8 base of formation or so, the nucleotide sequence at two ends is mutual
Recruit pair, therefore the fluorophor of mark at one end is close to being marked at the quenching group of the other end.According to Foerster
Theory, 6 powers of center fluorescence energy transfer efficiency and both distances are inversely proportional.So only fluorophor and quenching group it
Between reach fluorescence can be just produced during a certain distance.During free state, molecular beacon be in hair fastener type structure so that fluorophor and
Quenching group is at a distance of relatively near (about 7~10nm).Now occur FRET, the fluorescence that fluorophor is sent is quenched
Go out and group absorptions and distribute in the form of heat, fluorescence is almost quenched completely, and autofluorescent background is extremely low.When molecular beacon and target molecule
With reference to when, the distance between fluorophor and quenching group are increased so that, the fluorescence of molecular beacon almost 100% recovers.And
Detected fluorescence intensity is directly proportional to target amount in solution.Molecular beacon has background signal low, and sensitivity is high, special knowledge
Other property is strong, simple to operate, it is not necessary to separates and can detect in real time with unreacted molecular beacon, the advantages of available for in-vivo analysis.
In biochemical analysis, have a wide range of applications value in biomedical research and clinical diagnosis.
Folic acid (folic acid) be also FA.Participate in many important metabolic responses of body.Folic acid is most important
Function be exactly to manufacture white blood cell and red blood cell, immunocompetence can be strengthened, once lack folic acid, severe anemia can be produced, therefore,
Folic acid is also known as " hematopoiesis vitamin ".Folic acid is even more important to pregnant woman, and demand is higher than normal person 4 times.Pregnant early stage is fetus device
Official's system break up and placentation critical period, now folic acid deficiency can cause fetal anomaly.Shaw and his colleagues exist
Filial generation can be substantially reduced by women is just reported at 1995 taking B B-complex between 1-2 months after gestation starts
The probability of heart efferent tract deformity.It is reported that the incidence of early stage pregnant woman's folic acid deficiency is 19.23%, this incidence is although low
In the countries such as Europe, the U.S. (16%-60%), but higher than domestic 1986 (9.9%) report.Research it has also been found that people N5,
N10- methylenetetrahydrofolate reductases (MTHFR) gene code is the key enzyme of folic acid metabolism.Its function is mainly and thymus gland
Pyrimidine synzyme collective effect facilitates deoxyuridine sour (dump) to receive the first that 5-methyltetrahydrofolate (5mTHF) is provided
Base is transformed into deoxythymidine acid (dTMP), and then participates in DNA synthesis.The mutation in mthfr gene site all can
Causing the activity reduction of corresponding enzyme can prevent homocysteine to be converted into methionine, can cause low folic acid mass formed by blood stasis.MTHFR
(A1298C, rs1801131) has tri- kinds of genotype of A/A, A/C, C/C, and its site is A (adenine) → C (cytimidine) mutation,
The glutamic acid (Glu) in the 429th site in the MTHFR amino acid sequences of its coding is caused to be replaced by alanine (Ala), so as to influence
The activity of MTHFR enzymes.The activity of final influence metabolic enzyme.
There are many kinds currently for SNP detection method, according to whether the height of gel electrophoresis and automaticity,
Two major classes can be substantially divided into, i.e., the higher SNP inspections of SNP detection method and high flux, the automaticity based on gel electrophoresis
Survey method.SNP detection method based on gel electrophoresis includes single-strand conformation polymorphism (SSCP), denaturing gradient gel electrophoresis, enzyme
Cut amplification polymorphism sequence (CAPS), ApoE gene (AS-PCR).Generally speaking, these methods are to equipment requirement
It is not high, and input cost is low, but speed is slow, as a result there is high-throughout SNP detections uncertain and difficult to realize.High flux, from
The higher SNP detection method of dynamicization degree has direct sequencing, and this method expense is expensive and is difficult parting to heterozygote;Genetic chip
Method, although this method is rapidly and efficiently, hybridization conditions and DNA G/C content are closely related, it is necessary to find a kind of generality
Hybridization conditions, while influence of the repetitive sequence to the hybridization degree of accuracy need to be solved;Chip involves great expense;Denaturing high-performance chromatography
(DHPLC), this method automaticity and Detection accuracy are high, but the requirement to kit environment is higher, it is impossible to detect pure
Close mutation;High-resolution solubility curve method, this method flux is high, and cost is low, as a result accurate but have to the temperature uniformity of equipment
Strict requirements.And above method all needs extraction DNA to be detected.Time-consuming, complex operation.
The content of the invention
The technical problem to be solved in the present invention is to provide a kind of simple to operate, cost is low and detection is quick, the time is short
Primer, molecular beacon, kit and its detection involved by MTHFR-A1298C, RS1801131 gene pleiomorphism quick detection
Method.
In order to solve the above-mentioned technical problem, the present invention provides following technical scheme:MTHFR-A1298C, RS1801131 base
Because of the kit of polymorphism quick detection, including PCR reaction solutions, the raw material of PCR reaction solutions and final concentration of,
Archaeal dna polymerase 2.05U/ μ L;
dNTPs 0.1-0.5mM;
5X PCR buffer solutions 0.5-1.5X;
MgCl2 1-2.5mM;
Lauryl sodium sulfate 0.0005-0.015% (w/v);
Triton X-100 0.001-0.03% (w/v);
0.2-0.7 μM of sense primer;
0.2-0.7 μM of anti-sense primer;
0.2-0.7 μM of mutant molecules beacon;
0.2-0.7 μM of wild type molecular beacon;
And it is used to detect cell sample.
Using the kit of MTHFR-A1298C, RS1801131 gene pleiomorphism quick detection of technical solution of the present invention,
Using cell as sample, based on fluorescent molecular bacon method, MTHFR-A1298C, RS1801131 are entered with reference to cell pyrolysis liquid
Row detection and analysis.Directly split during the course of the reaction with cell pyrolysis liquid (lauryl sodium sulfate, Triton X-100)
Solution cell simultaneously discharges DNA in nucleus.In existing PCR reactions, the PCR with cell directly as template reacts, generally
Can not thorough cell lysis, and cell fragment and some cellular contents (such as protease) after cracking has suppression to PCR reactions
System, it is unstable to ultimately result in genotyping result, or even failure.Therefore, not plus in the case of lysate, it is directly added into cell conduct
Template, can cause cell cracking not thorough, and the cell fragment and some protease after cell cracking can be anti-to PCR
It should cause to hinder, cause the failure of an experiment.The cell pyrolysis liquid of the present invention can be directly dissolved between cytoplasm and cell membrane, saboteur
Many faint chemical bonds, decompose some protease, the influence that the impurity produced after reduction cell cracking is reacted PCR.Cause
This also eliminates the part inhibition that other compositions are reacted PCR in cell while maximum released dna.
From experiment, the final concentration scope of the raw materials of PCR reaction solutions, specific primer and molecular beacon is above range
When testing result it is correct.Wherein, 5X reaction buffers 1X raw material is 5X reaction buffers, and it is 5 times to refer to initial concentration
Reaction buffer, the final concentration for the application that 1X refers to.
The time of detection is not only greatlyd save by this inventive point, the time of operation can be controlled in 1-1.5h, also kept away
The DNA pollution that troublesome operation may be brought is exempted from.
Further, the raw material of described PCR reaction solutions is final concentration of:
Archaeal dna polymerase 2.05U/ μ L;
dNTPs 0.2mM;
5X PCR buffer solutions 1.1X;
MgCl22.5mM;
Lauryl sodium sulfate 0.005% (w/v);
Triton X-100 0.01% (w/v);
0.7 μM of sense primer
0.7 μM of anti-sense primer;
0.7 μM of mutant molecules beacon;
0.6 μM of wild type molecular beacon.
From experiment, testing result is most accurate when the raw material final concentration scope of PCR reaction solutions is above range, success rate
Highest.
Further, described cell sample is mucous membrane of mouth cast-off cells.The present invention is taken off with the mucous membrane of mouth directly scraped
Fall cell for sample, it is easy to operate.
Further, human genome DNA's gene order of purification is also included.Kit includes quality-control product, for purification
Human genome DNA's gene order, be determine when in order to do parallel test, to determine the validity of reagent result.
The application also proposes MTHFR-A1298C, RS1801131 gene in another technical scheme, kit of the present invention
The primer of polymorphism quick detection,
The gene order of sense primer 5 ' -3 ' is:CTTCTACCTGAAGAGCAAGTCC;
The gene order of anti-sense primer 5 ' -3 ' is:CAGCATCACTCACTTTGTGACC;
The application also proposes MTHFR-A1298C, RS1801131 base of primer detection in another technical scheme, kit
Because of the molecular beacon of polymorphism quick detection, 5 ' -3 ' gene order of wild type molecular beacon is: CGCCAGTCAAAGA+
CA+CTT+T+CTTCACTCTGGCG;
5 ' -3 ' gene order of mutant molecules beacon is: CGCCAGTTCAAAGACACT+T+G+
CTTCACCTGGCG;
And 5 ' the ends or 3 ' ends of wild type molecular beacon and mutant molecules beacon gene order are respectively equipped with fluorophor
With the quenching group coordinated with fluorophor;+ the base modified for lock nucleic acid.
The technical program has used molecular beacon, and molecular beacon itself can be formed by 5-8 to be a kind of in 5 ' and 3 ' ends
The double labelling oligonucleotide molecules beacon of the hairpin structure of base composition.The gene order and structure of as above-mentioned molecular beacon.
During free state, two ends of hairpin structure make fluorescence molecule with quencher molecule close to (about 7-10nm).Now occur glimmering
Photoresonance energy transfer, the fluorescence for sending fluorescence molecule is quenched molecule absorption and distributed in the form of heat, and fluorescence is almost complete
It is quenched entirely.When the target sequence of molecular beacon and the gene order complete complementary of cell combines to form double-stranded hybrid, stem
The base-pair in complementary structure area is separated, and distance increases between fluorescence molecule and quencher molecule, and at this moment the fluorescence of molecular beacon is several
100% recovers.This design can effectively increase the specificity of molecular beacon, improve to MTHFR-A1298C, RS1801131
The correctness of detection.
The principle of detection is:In MTHFR-A1298C, rs1801131 gene mutation site both sides, conservative region is designed a pair
Primer, and two molecular beacons of design at the sequence of mutational site, mutant molecules beacon and wild type molecular beacon, wild type
Molecular beacon is combined with unmutated sequence, and mutant molecules beacon is combined with mutational site sequence.Wild type molecular beacon 5 ' is held
It can be marked with 6-FAM or Alexa Fluor 594 or the fluoresceins of Cal Fluor Red 610, and mutant molecules beacon 5 ' is held
It can be marked with Alexa Fluor 594 or Cal Fluor Red 610 or 6-FAM fluoresceins, the molecular beacon of 6-FAM marks
3 ' ends are marked with BHQ1 quenching groups, and the molecular beacon 3 ' that Alexa Fluor 594 or Cal Fluor Red 610 are marked is held
All marked with BHQ2 quenching groups.In PCR annealing stages, wild type molecular beacon is combined with unmutated sequence, and saltant type
Molecular beacon is combined with the sequence for having mutational site, after bonding, and fluorophor is away from quenching group, the fluorescence quilt now sent
Real time fluorescent quantitative detector is recorded, so as to can determine whether out to detect the genotype of gene by the color of fluorescence.
Further, described fluorophor is 6-Fam labelling groups, and described quenching group is BHQ1 labelling groups;
Or fluorophor is the labelling groups of Alexa Fluor 594, described quenching group is BHQ2 labelling groups.For
Two kinds of fluorophors and quenching group used in the present invention, certainly, it is also possible to other fluorophors and with quenching that it coordinates
The group that goes out is replaced, and does not influence testing result.
The application also proposes another technical scheme, is carried out using above-mentioned primer, molecular beacon and kit
MTHFR-A1298C, RS1801131 gene pleiomorphism quick determination method, operating method is,
(1) gargled before sampling with water 2 times, be more than 5 seconds every time, swallowed 2-3 times after gargling;
(2) cheek wall in the nearly 90 ° of contacts oral cavity in sampling portion of sampler is taken, uniformly scrapes 5 times, is up and down 1 time;
(3) the sampling portion of sampler is inserted in PCR reaction solutions after sampling, mixed;
(4) the DNA gene orders for taking 1 μ L to purify are added in another PCR reaction solution, are mixed;
(5) the PCR reaction solutions for completing sample-adding are put into quantitative PCR apparatus, run response procedures.
Further, the response procedures of quantitative PCR apparatus are:
A, pre-degeneration:95 DEG C of temperature, 5min, 1 circulation;
B, denaturation:95 DEG C, 8s;
C, annealing and extension:55 DEG C, 35s;
D, B and c program operate 50 circulations.
Further, described quantitative PCR apparatus is binary channels, and excitation wavelength is respectively 450-500nm and 550-600nm.
Brief description of the drawings
Fig. 1 is first sample detection amplification curve diagram of the embodiment of the present invention one;
Fig. 2 is first sample detection amplification curve diagram of the embodiment of the present invention two;
Fig. 3 is first sample detection amplification curve diagram of the embodiment of the present invention three;
Fig. 4 is second sample detection amplification curve diagram of the embodiment of the present invention one;
Fig. 5 is second sample detection amplification curve diagram of the embodiment of the present invention two;
Fig. 6 is second sample detection amplification curve diagram of the embodiment of the present invention three;
Fig. 7 is the 3rd sample detection amplification curve diagram of the embodiment of the present invention one;
Fig. 8 is the 3rd sample detection amplification curve diagram of the embodiment of the present invention two;
Fig. 9 is the 3rd sample detection amplification curve diagram of the embodiment of the present invention three;
Figure 10 is first sample detection amplification curve diagram of the embodiment of the present invention four;
Figure 11 is second sample detection amplification curve diagram of the embodiment of the present invention four;
Figure 12 is the 3rd sample detection amplification curve diagram of the embodiment of the present invention four.
Embodiment
The following is each implementation in MTHFR-A1298C, RS1801131 gene pleiomorphism quick detection kit of the present invention
The raw material final concentration of example, as shown in table 1:
Table 1
It is the concrete operations mode of MTHFR-A1298C, RS1801131 gene pleiomorphism quick detection of the present invention below:
First, the preparation of cell pyrolysis liquid
Cell pyrolysis liquid concentration of component in table 1 is the ultimate density in PCR reaction systems, and this concentration is too small, can cause
The inaccuracy of sample-adding.Therefore in configuration, final concentration can be expanded, then dilute.
The superclean bench of all preparation of reagents after sterilization is carried out.
(1) in embodiment one 200X cell pyrolysis liquids preparation
The collocation method of lysate:Using 1.5ml centrifuge tube, 10ul lauryl sodium sulfate SDS and 1.88ul are added
Triton X-100 Triton X-100, add the water of 988.12ul nuclease frees to cumulative volume 1000ul, make SDS
Final concentration reach 0.1%, TritonX-100 final concentration is reached 0.2%, as 200x cell pyrolysis liquid, Ran Houzhen
Swing mixing, -4 DEG C of preservations.
(2) in embodiment two, example IV 200X cell pyrolysis liquids preparation
The collocation method of lysate:Using 1.5ml centrifuge tube, 100ulSDS and 18.78ulTriton X-100 are added,
The water of 881.22ul nuclease frees is added to cumulative volume 1000ul, SDS final concentration is reached 1%, makes TritonX-100
Final concentration reach 2%, as 200x cell pyrolysis liquid, then concussion is mixed, -4 DEG C of preservations.
(3) in embodiment three 200X cell pyrolysis liquids preparation
Using 1.5ml centrifuge tube, 300ul lauryl sodium sulfate SDS and 56.34ul polyethylene glycol octyl phenyls are added
Ether Triton X-100, add the water of 643.66ul nuclease frees to cumulative volume 1000ul, SDS final concentration is reached 3%,
TritonX-100 final concentration is set to reach 6%, as 200x cell pyrolysis liquid, then concussion mixing, -4 DEG C of preservations.
The gene order of sense primer 5 ' -3 ' is:CTTCTACCTGAAGAGCAAGTCC;
The gene order of anti-sense primer 5 ' -3 ' is:CAGCATCACTCACTTTGTGACC;
The gene order of wild type molecular beacon 5 ' -3 ' is:
6-Fam marks-CGCCAGTCAAAGA+CA+CTT+T+CTTCACTCTGGCG-BHQ1 is marked;
The gene order of mutant molecules beacon 5 ' -3 ' is:
Alexa Fluor 594 mark-CGCCAGTTCAAAGACACT+T+G+CTTCACCTGGCG-BHQ2 to mark;
Above-mentioned raw materials, in addition to specific primer, molecular beacon, cell pyrolysis liquid, are purchased from Shanghai Pu Luomaige biology systems
Product Co., Ltd.Specific primer is synthesized by Shanghai Zhan Biao bio tech ltd;Molecular beacon is by the biological skill of Shanghai English fine horse
Art Co., Ltd synthesizes.
Two .PCR reaction solutions are prepared
The addition of each raw material is as shown in table 2.The superclean bench of all preparations after sterilization is carried out.
Table 2
3rd, MTHFR-A1298C, RS1801131 genotype detection;
MTHFR-A1298C, RS1801131 genotype quick detection kit are made up of 9 Reagent Tubes dispensed, often
Individual measured detects 3 repetitions (a by-reaction liquid), often tests 9 reagents, while testing a quality-control product, quality-control product is
For human genome DNA's gene order of purification, parallel testing is used as.The quality-control product is prominent for MTHFR-A1298C, RS1801131
Become heterozygous, when result is as shown in figure 12, show that reagent can effectively carry out parting, represent that other reagent test results are same
It is credible.
Each embodiment respectively prepares 36 reagents according to 23.5ul reaction system, and final concentration indicated above refers to each group
Divide the concentration in 23.5ul systems, ul/ branch refers to content of each component in Reagent Tube, and -20 DEG C are kept in dark place;
(1) gargled before sampling with clear water 2 times, be no less than 5 seconds every time, swallowed 2-3 times after gargling, oral cavity wall is avoided as far as possible
Remain saliva;
(2) disposable sterile swab (license notification number is taken out:CN205359515U) and reaction solution, pull out anti-
Answer liquid plug and swab end cap;
(3) cheek wall in the nearly 90 ° of contacts oral cavity in swab end is made, it (is up and down 1 that embodiment one, two, three, four, which uniformly scrapes 5 times,
It is secondary), embodiment five uniformly scrapes 3 respectively, 5,7 times (being up and down 1 time), and dynamics prominent is advisable so that cheek is micro-;
(4) immediately by swab intercalation reaction liquid after sampling, pressing top makes itself and the reagent seal of tube, and lucifuge is kept in, and
After flick Reagent Tube and sample is fully mixed with reaction solution;
Step (1)~(4) complete operation in 20s, are sure not to interrupt;
(5) take 1 μ L quality-control products to be added in another by-reaction liquid with pipettor, flick Reagent Tube and mix;
(6) reaction solution for completing sample-adding is put into OM-1000 type fluorescent PCR instrument (license notification numbers:
CN103820306B in), and the Program of table 3.
Table 3
(7) amplification curve and fluorescence color, analysis result are obtained.
4th, interpretation of result:
Because human genome is diploid, two allele are contained on each gene locus.As a result three kinds are had, point
Wei not " AA ", " CC ", " AC ".Wherein negative findings is " AA ", and positive findings is " AC ", " CC ".
The result of embodiment one is:
As shown in Figure 1:Only A lines have exponential increase, and C lines do not have exponential increase, therefore testing result is wild type AA,
Prompting detects that gene expression or activity may be normal, and the genotype is eubolism type;
As shown in Figure 2:Only C lines have exponential increase, and A lines do not have exponential increase, and it is homozygosis variation to represent testing result
Type CC, points out to detect that gene activity is decreased obviously or may lost, and its activity decrease or forfeiture may cause folic acid metabolism
It is low;
As shown in Figure 3:C lines and A lines have exponential increase, represent that testing result is heterozygous variance type CA, point out to be detected
Gene activity may decline, and the genotype belongs to medium metabolic type;
Thus, the genotype for drawing MTHFR (A1298C, rs1801131) can be analyzed from Fig. 1, Fig. 2 and Fig. 3, so as to
Draw, metabolic type of the patient to folic acid.
The result of embodiment two is:
As shown in Figure 4:Only A lines have exponential increase, and C lines do not have exponential increase, therefore testing result is wild type AA,
Prompting detects that gene expression or activity may be normal, and the genotype is eubolism type;
As shown in Figure 5:Only C lines have exponential increase, and A lines do not have exponential increase, and it is homozygosis variation to represent testing result
Type CC, points out to detect that gene activity is decreased obviously or may lost, and its activity decrease or forfeiture may cause folic acid metabolism
It is low;
As shown in Figure 6:C lines and A lines have exponential increase, represent that testing result is heterozygous variance type CA, point out to be detected
Gene activity may decline, and the genotype belongs to medium metabolic type;
Thus, the genotype for drawing MTHFR (A1298C, rs1801131) can be analyzed from Fig. 4, Fig. 5 and Fig. 6, so as to
Draw, metabolic type of the patient to folic acid.
The result of embodiment three is:
As shown in Figure 7:Only A lines have exponential increase, and C lines do not have exponential increase, therefore testing result is wild type AA,
Prompting detects that gene expression or activity may be normal, and the genotype is eubolism type;
As shown in Figure 8:Only C lines have exponential increase, and A lines do not have exponential increase, and it is homozygosis variation to represent testing result
Type CC, points out to detect that gene activity is decreased obviously or may lost, and its activity decrease or forfeiture may cause folic acid metabolism low;
As shown in Figure 9:C lines and A lines have exponential increase, represent that testing result is heterozygous variance type CA, point out to be detected
Gene activity may decline, and the genotype belongs to medium metabolic type;
Thus, the genotype for drawing MTHFR (A1298C, rs1801131) can be analyzed from Fig. 7, Fig. 8 and Fig. 9, so as to
Draw, metabolic type of the patient to folic acid.
Can be seen that by above three embodiment result, three embodiments can Correct Analysis go out MTHFR (A1298C,
Rs1801131 genotype), but two or three kinds of genotype fluorescent values of embodiment are significantly better than that embodiment one and embodiment three.Therefore
It is optimal to determine the PCR reaction systems in embodiment two.
The result of example IV is:
As shown in Figure 10:Only A lines have exponential increase, and C lines do not have exponential increase, therefore testing result is wild type
AA, points out to detect that gene expression or activity may be normal, the genotype is eubolism type;
As shown in Figure 11:Only C lines have exponential increase, and A lines do not have exponential increase, and it is homozygosis variation to represent testing result
Type CC, points out to detect that gene activity is decreased obviously or may lost, and its activity decrease or forfeiture may cause folic acid metabolism low;
As shown in Figure 12:C lines and A lines have exponential increase, represent that testing result is heterozygous variance type CA, point out to be detected
Gene activity may decline, and the genotype belongs to medium metabolic type;
Thus, the genotype for drawing MTHFR (A1298C, rs1801131) can be analyzed from Figure 10, Figure 11 and Figure 12, from
And can draw, patient is to the metabolic type of folic acid, and as a result reliable and stable, accuracy is 100%.
Nucleotides sequence list is as follows:
<110>Chongqing Jing Yin biotechnologies Co., Ltd
<120>The primer of MTHFR-A1298C, RS1801131 gene pleiomorphism quick detection, molecular beacon, kit and
Its detection method
<160>4
<210>1
<211>22
<212>DNA
<213>Artificial sequence
<220>
<221>prim_bind
<400>1
CTTCTACCTGAAGAGCAAGTCC
<210>2
<211>22
<212>DNA
<213>Artificial sequence
<220>
<221>prim_bind
<400>2
CAGCATCACTCACTTTGTGACC
<210>3
<211>36
<212>RNA
<213>Artificial sequence
<220>
<221>misc_binding
<400>3
CGCCAGTCAAAGA+CA+CTT+T+CTTCACTCTGGCG
<210>4
<211>35
<212>DNA
<213>Artificial sequence
<220>
<221>misc_binding
<400>4
CGCCAGTTCAAAGACACT+T+G+CTTCACCTGGCG。
For those skilled in the art, on the premise of technical solution of the present invention is not departed from, if can also make
Dry modification and improvement, these should also be considered as protection scope of the present invention, these effects implemented all without the influence present invention and
Practical applicability.
<110>Chongqing Jing Yin biotechnologies Co., Ltd
<120>Primer, molecular beacon, kit and its inspection of MTHFR-A1298C, RS1801131 gene pleiomorphism quick detection
Survey method
<160>4
<210>1
<211>22
<212>DNA
<213>Artificial sequence
<220>
<221>prim_bind
<400>1
CTTCTACCTGAAGAGCAAGTCC
<210>2
<211>22
<212>DNA
<213>Artificial sequence
<220>
<221>prim_bind
<400>2
CAGCATCACTCACTTTGTGACC
<210>3
<211>36
<212>RNA
<213>Artificial sequence
<220>
<221>misc_binding
<400>3
CGCCAGTCAAAGA+CA+CTT+T+CTTCACTCTGGCG
<210>4
<211>35
<212>DNA
<213>Artificial sequence
<220>
<221>misc_binding
<400>4
CGCCAGTTCAAAGACACT+T+G+CTTCACCTGGCG。
Claims (10)
1.MTHFR-A1298C, the kit of RS1801131 gene pleiomorphism quick detections, it is characterised in that including PCR reaction
Liquid, the raw material of PCR reaction solutions and final concentration of,
The U/ μ L of archaeal dna polymerase 2.05;
dNTPs 0.1-0.5mM;
5X PCR buffer solution 0.5-1.5 X;
MgCl2 1-2.5mM;
Lauryl sodium sulfate 0.0005-0.015%(w/v);
Triton X-100 0.001-0.03%(w/v);
0.2-0.7 μM of sense primer;
0.2-0.7 μM of anti-sense primer;
0.2-0.7 μM of mutant molecules beacon;
0.2-0.7 μM of wild type molecular beacon;
And it is used to detect cell sample.
2. the kit of MTHFR-A1298C, RS1801131 gene pleiomorphism quick detection according to claim 2, its
It is characterised by:The raw material of described PCR reaction solutions is final concentration of:
The U/ μ L of archaeal dna polymerase 2.05;
dNTPs 0.2mM;
5X PCR buffer solutions 1.1X;
MgCl22.5mM;
Lauryl sodium sulfate 0.005%(w/v);
Triton X-100 0.01%(w/v);
0.7 μM of sense primer
0.7 μM of anti-sense primer;
0.7 μM of mutant molecules beacon;
0.6 μM of wild type molecular beacon.
3. the kit of MTHFR-A1298C, RS1801131 gene pleiomorphism quick detection according to claim 3, its
It is characterised by:Described cell sample is mucous membrane of mouth cast-off cells.
4. the kit of MTHFR-A1298C, RS1801131 gene pleiomorphism quick detection according to claim 4, its
It is characterised by:Also include human genome DNA's gene order of purification.
5. MTHFR-A1298C, RS1801131 gene pleiomorphism in the kit according to claim 1 ~ 4 any one
The primer of quick detection, it is characterised in that
The gene order of sense primer 5 ' -3 ' is:CTTCTACCTGAAGAGCAAGTCC;
The gene order of anti-sense primer 5 ' -3 ' is:CAGCATCACTCACTTTGTGACC.
6. utilize MTHFR-A1298C, RS1801131 gene pleiomorphism with primer detection in the kit described in claim 5
The molecular beacon of quick detection, it is characterised in that:
5 ' -3 ' gene order of wild type molecular beacon is:
CGCCAGTCAAAGA+CA+CTT+T+CTTCACTCTGGCG;
5 ' -3 ' gene order of mutant molecules beacon is:
CGCCAGTTCAAAGACACT+T+G+CTTCACCTGGCG;
And 5 ' ends of wild type molecular beacon and mutant molecules beacon gene order and 3 ' hold be respectively equipped with fluorophor and with
The quenching group that fluorophor coordinates;+ the base modified for lock nucleic acid.
7. the molecular beacon of MTHFR-A1298C, RS1801131 gene pleiomorphism quick detection according to claim 6,
It is characterized in that:Described fluorophor is 6-Fam labelling groups, and described quenching group is BHQ1 labelling groups;
Or fluorophor is the labelling groups of Alexa Fluor 594, described quenching group is BHQ2 labelling groups.
8. MTHFR-A1298C, RS1801131 for being carried out using the primer described in claim 6 or 7, molecular beacon and kit
Gene pleiomorphism quick determination method, it is characterised in that:Operating method is,
(1)Gargled before sampling with water 2 times, be more than 5 seconds every time, swallowed 2-3 times after gargling;
(2)Cheek wall in the nearly 90 ° of contacts oral cavity in sampling portion of sampler is taken, is uniformly scraped 5 times, upper and lower is 1 time;
(3)The sampling portion of sampler is inserted in PCR reaction solutions after sampling, mixed;
(4)The DNA gene orders for taking 1 μ L to purify are added in another PCR reaction solution, are mixed;
(5)The PCR reaction solutions for completing sample-adding are put into quantitative PCR apparatus, response procedures are run.
9. MTHFR-A1298C, RS1801131 base carried out using the primer described in claim 8, molecular beacon and kit
Because of polymorphism quick determination method, it is characterised in that:The response procedures of quantitative PCR apparatus are:
A, pre-degeneration:95 DEG C of temperature, 5min, 1 circulation;
B, denaturation:95 DEG C, 8s;
C, annealing and extension:55 DEG C, 35s;
D, B and c program operate 50 circulations.
10. MTHFR-A1298C, RS1801131 gene pleiomorphism quick determination method as claimed in claim 9, its feature exists
In:Described quantitative PCR apparatus is binary channels, and excitation wavelength is respectively 450-500nm and 550-600nm.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710615435.0A CN107299140A (en) | 2017-07-25 | 2017-07-25 | MTHFR A1298C gene pleiomorphism quick detections primer, molecular beacon, kit and detection method |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710615435.0A CN107299140A (en) | 2017-07-25 | 2017-07-25 | MTHFR A1298C gene pleiomorphism quick detections primer, molecular beacon, kit and detection method |
Publications (1)
Publication Number | Publication Date |
---|---|
CN107299140A true CN107299140A (en) | 2017-10-27 |
Family
ID=60133056
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201710615435.0A Pending CN107299140A (en) | 2017-07-25 | 2017-07-25 | MTHFR A1298C gene pleiomorphism quick detections primer, molecular beacon, kit and detection method |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN107299140A (en) |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2015031842A1 (en) * | 2013-08-30 | 2015-03-05 | University Of Utah Research Foundation | A quantum method for fluorescence background removal in dna melting analysis |
CN104673915A (en) * | 2015-02-13 | 2015-06-03 | 重庆京因生物科技有限责任公司 | Rapid detection kit for gene single-nucleotide polymorphism site and method for rapid detection kit |
CN104830992A (en) * | 2015-05-29 | 2015-08-12 | 沈阳优吉诺生物科技有限公司 | Primer and kit for detecting methylenetetrahydrofolate reductase C677T polymorphic sites and PCR (polymerase chain reaction) method of primer and kit |
CN105256019A (en) * | 2015-10-14 | 2016-01-20 | 武汉海吉力生物科技有限公司 | MTHFR and MTRR gene polymorphism detection primer group and kit |
-
2017
- 2017-07-25 CN CN201710615435.0A patent/CN107299140A/en active Pending
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2015031842A1 (en) * | 2013-08-30 | 2015-03-05 | University Of Utah Research Foundation | A quantum method for fluorescence background removal in dna melting analysis |
CN104673915A (en) * | 2015-02-13 | 2015-06-03 | 重庆京因生物科技有限责任公司 | Rapid detection kit for gene single-nucleotide polymorphism site and method for rapid detection kit |
CN104830992A (en) * | 2015-05-29 | 2015-08-12 | 沈阳优吉诺生物科技有限公司 | Primer and kit for detecting methylenetetrahydrofolate reductase C677T polymorphic sites and PCR (polymerase chain reaction) method of primer and kit |
CN105256019A (en) * | 2015-10-14 | 2016-01-20 | 武汉海吉力生物科技有限公司 | MTHFR and MTRR gene polymorphism detection primer group and kit |
Non-Patent Citations (4)
Title |
---|
HEE NAM KIM等: ""Polymorphisms involved in the folate metabolizing pathway and risk of multiple myeloma"", 《AMERICAN JOURNAL OF HEMATOLOGY》 * |
THEODORE FRIEDMANN等: "《Advances in Genetics》", 31 December 2013, ELSEVIER * |
WEIBO CAI: "《Engineering in Translational Medicine》", 31 December 2014, SPRINGER * |
周国华等: "《SNP检测技术与个体化药物治疗》", 28 February 2015, 苏州:苏州大学出版社 * |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN106591473B (en) | A kind of people MTHFR and MTRR genetic polymorphism detections primer, probe, kit and method | |
CN103468818B (en) | A kind of test kit and method detecting CYP2C19 gene pleiomorphism | |
CN101838683B (en) | Detection method of nucleotide mutation points of KRAS gene and/or BRAF gene | |
CN109554448B (en) | A kind of multiplex PCR-SBT the methods of genotyping and reagent of human erythrocyte's blood group system ABO antigen | |
CN105002275A (en) | Specific sequence specific primers-polymerase chain reaction primers and kit for human MTHFR and MTRR gene polymorphism detection | |
US10519484B2 (en) | Lytic composition and application thereof, kit, method for preparing nucleic acid by utilizing lytic composition, and nucleic acid analysis method | |
CN105463122A (en) | MTHFR, MTRR and RFC1 gene polymorphism detection primer combination and kit and application of MTHFR, MTRR and RFC1 gene polymorphism detection kit | |
CN107227371A (en) | Primer, molecular beacon, kit and its detection method of CYP2C9*3 gene pleiomorphism quick detections | |
CN106811533A (en) | A kind of hereditary hearing impairment gene detecting kit | |
CN111118138A (en) | Kit and method for detecting polymorphism of folate metabolism ability genes MTHFR and MTRR | |
CN108441553A (en) | It is a kind of it is accurate detection ALDH2 gene pleiomorphisms kit and its application | |
CN109593846A (en) | Detect primer, probe and the kit of folic acid metabolism ability related gene | |
WO2019127928A1 (en) | Kit for detecting genetic variation in human chromosome 15q11-13 and application thereof | |
CN108265113A (en) | ALDH2 genetic polymorphism detection kits | |
CN104711345A (en) | Quick detection kit for the CYP2C19*2 genetype and detection method thereof | |
CN107227372A (en) | Primer, molecular beacon, kit and its detection method of ALDH2 gene pleiomorphism quick detections | |
CN111944912B (en) | Skin gene detection method | |
CN115029444A (en) | Molecular marker related to sheep growth traits and application thereof | |
CN108165615A (en) | A kind of method and kit with the relevant Genotyping of folic acid metabolism | |
CN108949929A (en) | For detecting the product and its methods and applications of MTHFR and MTRR gene pleiomorphism simultaneously | |
CN107446998A (en) | MTHFR C677T, rs1801133 single nucleotide polymorphisms quick detections primer, molecular beacon, kit and its detection method | |
CN110878351A (en) | Method for detecting MTHFR gene polymorphism by fluorescent quantitative PCR | |
CN107287283A (en) | A kind of the high flux detection kit and its application method of many SNP sites related to children's susceptibility to disease | |
CN103757109B (en) | Primer composition and multiple-gene detection kit for guiding administration of thiazine diuresis drugs and application method thereof | |
CN107299140A (en) | MTHFR A1298C gene pleiomorphism quick detections primer, molecular beacon, kit and detection method |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
CB02 | Change of applicant information |
Address after: 400084 Chongqing, Dadukou District Chunhui Road, 101 Cui Bo Road 4 4 2-1, 2-9 Applicant after: CHONGQING JINGYIN BIOTECHNOLOGY CO., LTD. Address before: 400051 9, LONCIN international office 5, 2 Shiping bridge, Kowloon Po, Chongqing. Applicant before: CHONGQING JINGYIN BIOTECHNOLOGY CO., LTD. |
|
CB02 | Change of applicant information | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20171027 |
|
RJ01 | Rejection of invention patent application after publication |