CN103757109B - Primer composition and multiple-gene detection kit for guiding administration of thiazine diuresis drugs and application method thereof - Google Patents
Primer composition and multiple-gene detection kit for guiding administration of thiazine diuresis drugs and application method thereof Download PDFInfo
- Publication number
- CN103757109B CN103757109B CN201410014297.7A CN201410014297A CN103757109B CN 103757109 B CN103757109 B CN 103757109B CN 201410014297 A CN201410014297 A CN 201410014297A CN 103757109 B CN103757109 B CN 103757109B
- Authority
- CN
- China
- Prior art keywords
- gene
- primer
- pcr
- amplimer
- thiazide diuretic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Pathology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a primer composition and multiple-gene detection kit for guiding the administration of thiazine diuresis drugs and an application method thereof. The primer composition comprises ultrapure water, an X solution, a 10*PCR buffer solution, a PCR primer, a 25mM magnesium chloride solution, a DNA polymerase and a positive reference substance and is characterized in that the PCR primer comprises the following ten forward/reverse amplification primers and reaction reference forward/reverse amplification primers of different gene types on 15 SNP sites on the gene related to the administration of thiazine diuresis drugs, wherein the gene sequences are shown by the SEQ ID No.1 to No.46. The application method comprises the following steps: collecting the samples and extracting nucleic acid; performing a PCR reaction by taking the extracted nucleic acid as a template; and finally, performing capillary electrophoretic separation of the samples with the GeXP genetic analyzer. The primer composition has the advantages of strong specificity, high accuracy, high flux, high reliability, low cost and no false negative result.
Description
Technical field
The present invention relates to a kind of multiple gene detection kit and detection method thereof, especially relate to a kind of Primer composition, multiple gene detection kit and the using method thereof that instruct thiazide diuretic medication.
Background technology
Thiazide diuretic is one of five kind of one line depressor, mainly through three kinds of mechanisms play effects: suppress distal convoluted tubule leading portion and proximal convoluted tubule to the absorption of sodium-chlor, increase the Na of distal convoluted tubule and collecting tubule
+-K
+exchange, promote K
+secretion; Suppress the activity of phosphodiesterase, reduce uriniferous tubules to the picked-up of lipid acid and plastosome oxygen consumption, suppress uriniferous tubules to Na
+, Cl
-active heavily absorb; Because uriniferous tubules is to water, Na
+absorption reduce, uriniferous tubules internal pressure raise, flow through water and the Na of distal convoluted tubule
+increase, impel macula densa to be reflected by Guan Yiqiu, in kidney, feritin, Angiotensin secretion increase, and uriniferous tubules shrinks, renal blood flow declines, and renal glomerulus goal and efferent glomerular arteriole shrink, and glomerular filtration rate(GFR also declines thereupon.Although thiazide diuretic is for a long time as a line antihypertensive drug, in clinical application, but there is the problem that treated effect is low and side effect is large, and there is significant individual difference, some patients benefits, and some patients resistance also occurs serious toxic side effect.Research shows, individual difference and the single nucleotide polymorphism (SNP) of crowd's parathiazine class hydragog(ue) are closely related.Hyperpietic is before accepting thiazide diuretic treatment, carry out the monitoring of thiazide diuretic related SNP gene locus, formulate chemotherapy regimen according to monitoring result, improve the specific aim of hypertension clinical treatment, reduce the generation of poisonous side effect of medicine, save the valuable treatment time.
Existing SNP detection method is mainly gene chips, quantitative fluorescent PCR (qPCR) and Sanger sequencing.
(1) qPCR detection method: adopt fluorescent quenching and two end-labelling, for the specific probe of SNP site variation design.Its advantage be highly sensitive, accuracy is strong.Its shortcoming is that (1) flux is low: the detection being not suitable for many SNP site; Be difficult to arrange internal control gene.(2) cost is higher: probe mark cost is high; If need obtain all related SNP information, need carry out multiple detection experiment, superposition cost costly.
(2) gene chips: gene chip passes through micro-processing technology, by ten hundreds of and even 1,000,000 the DNA fragmentation (gene probe) of particular sequence, arrangement is fixed on the upholder such as silicon chip, slide regularly, the two-dimentional DNA probe array formed, utilize the biological sample of this kind of chip and mark to hybridize, fast qualitative and quantitative analysis can be carried out to the gene expression profile bioinformation of sample.DNA chip: because the advantages such as high-throughput are widely applied in SNP detects, relies on the difference of wild-type and mutated genes hybridization kinetics to detect mutational site.Its advantage is: (1) high-flux parallel detects; (2) fast easy and simple to handle: whole detection only needs 4-8 hour substantially can go out result.Shortcoming: the hybridization kinetics difference 1) between different SNP site is different, when carrying out multidigit point and detect simultaneously, condition is difficult to control; 2) technical costs is expensive, complicated: each sample needs a chip, and cost great Yu $1000/ sample, is unfavorable for large-scale promotion; The synthesis of probe and fixing more complicated, particularly make highdensity probe array, is main rate-limiting step; 3) poor repeatability, accuracy is low, easily occurs false positive false negative result; 4) sensitivity is lower: chip method needs nucleic acid amount comparatively large, generally first must do multiplexed PCR amplification, because primer is more, easily self produces dimer, hairpin structure, or due to Tm value difference, and cause amplification object fragment efficiency different, and then the sensitivity that impact detects; 5) kind due to chip is more, is difficult to the quality control standard that formulation one is unified.
(3) Sanger(dideoxy chain termination) sequencing: Sanger method starts at a certain fixing point according to Nucleotide, stop at some specific base places at random, and after each base, carry out fluorescent mark, a series of Nucleotide of four groups of different lengthss that generation terminates with A, T, C, G, then in urea-denatured PAGE glue, electrophoresis detects, thus obtains visible DNA base sequence.Its advantage is snp analysis gold standard, can find known SNP, also can find unknown SNP.Shortcoming is that each site of each sample all needs through pcr amplification, runs glue, then cuts glue purification, then check order.Step is many and disperse, and cost is higher, and workload is large, and the cycle is long, and it is relatively costly that multiple SNP site detects accumulative price.
Multiple SNP site detection method is based on multiplex PCR and capillary electrophoresis (CE) isolation technique.Adopt multiple PCR method, add in same reaction tubes >=1 pair of specific gene amplimer and reaction internal reference primer simultaneously, size capillary electrophoresis separation according to gene amplification fragment analyzes multiple SNP site and genotype, can fast and effeciently detect multiple SNP site, overcome the defect that traditional method exists, there is following advantage:
1, high-throughput: native system realizes a single reaction detection 30-40 site.
2, accuracy is strong: adopt CE to be separated PCR primer, non-specific amplification product, primer dimer can be separated with specific amplification products, at utmost reduce false positive;
3, susceptibility is high, and result is reproducible: the deviation that the unequal amplification that native system overcomes conventional PCR amplification method causes, and improves and carries out speed and susceptibility qualitatively to a set of goal gene, adopts laser induced fluorescence(LIF)-PMT, has hypersensitivity;
4, method is easy, uses economy: the invention provides from a complete set of experimental programs such as reagent, multiple PCR primer design, interpretations of result; The testing cost Shao Yu $50 of each sample, is beneficial to large-scale promotion;
5, handiness is strong: the target gene that can adjust detection at any time according to demand.
6, easily be automated.
At present, also the test kit of thiazide diuretic medication and the relevant report of using method thereof is not instructed about the multiple SNP detection based on multiplex PCR and CE both at home and abroad.
Summary of the invention
Technical problem to be solved by this invention is to provide a kind of high specificity, highly sensitive, flux is high, reliability is strong, cost is low, without the Primer composition of the SNP detection system based on multiplex PCR and electrocapillary phoresis of false negative result.
Technical problem to be solved by this invention is also that providing package contains multiple gene detection kit and the using method thereof of above-mentioned Primer composition.
The present invention solves the problems of the technologies described above adopted technique means: a kind of instruct thiazide diuretic medication Primer composition, comprise following 10 with forward and reverse amplimer of the different genotype in 15 SNP site on thiazide diuretic medication genes involved and the forward and reverse amplimer reacting internal reference, its nucleotide sequence is as shown in table 1 below:
Table 1
On above-mentioned SLC12A3 gene, the reverse amplimer of C type gene of rs13306673 fragment and the reverse amplimer of T-shaped gene are nucleic acid sequence SEQ ID NO.3:GTCAGAGCTGAGCCTGGAT;
On above-mentioned NOS3 gene, the reverse amplimer of G type gene of rs1799983 fragment and the reverse amplimer of T-shaped gene are nucleic acid sequence SEQ ID NO.6:CCCAGTCAATCCCTTTGGTG;
On above-mentioned NOS3 gene, the reverse amplimer of the T-shaped gene of rs2070744 fragment and the reverse amplimer of C type gene are nucleic acid sequence SEQ ID NO.9:TAGACACAAAAGAGCAGGAAGC:
On ADRB2 gene, the reverse amplimer of the G type gene of rs2400707 fragment and the reverse amplimer of A type gene are nucleic acid sequence SEQ ID NO.12:ACTCTTGAGAGTGTGGCATC;
On above-mentioned SLC22A6 gene, the reverse amplimer of the G type gene of rs10792367 fragment and the reverse amplimer of C type gene are nucleic acid sequence SEQ ID NO.15:GTGAGGCGACTTCCACTG;
On above-mentioned YEATS4 gene, the reverse amplimer of C type gene of rs7297610 fragment and the reverse amplimer of T-shaped gene are nucleic acid sequence SEQ ID NO.18:TGTCTGACGGATCCAAAGTT;
On above-mentioned ACE gene, the forward amplimer of the ins type gene of rs1799752 fragment and the forward amplimer of del type gene are nucleic acid sequence SEQ ID NO.19:ATCCTTTCTCCCATTTCTCTAGAC, and the reverse amplimer of ins type gene and the reverse amplimer of del type gene are nucleic acid sequence SEQ ID NO.20:ACAGGTCTTCATATTTCCGGG;
On above-mentioned CYP11B2 gene, the forward amplimer of the G type gene of rs1799998 fragment and the forward amplimer of A type gene are nucleic acid sequence SEQ ID NO.21:CCCAGCCAAAGGTAGATGAAG;
On above-mentioned ADD1 gene, the forward amplimer of the T-shaped gene of rs4961 fragment and the forward amplimer of G type gene are nucleic acid sequence SEQ ID NO.24:CTAGGGCTACAGAACTGGCTA;
On above-mentioned NEDD4L gene, the forward amplimer of the G type gene of rs4149601 fragment and the forward amplimer of A type gene are nucleic acid sequence SEQ ID NO.27:AGGAAGCCATTTCCAGAGAG;
On above-mentioned WNK1 gene, the forward amplimer of the G type gene of rs1159744 fragment and the forward amplimer of C type gene are nucleic acid sequence SEQ ID NO.30:TGGGAGTAATTATAGTACCTATTCA;
On above-mentioned WNK1 gene, the forward amplimer of the T-shaped gene of rs880054 fragment and the forward amplimer of C type gene are nucleic acid sequence SEQ ID NO.33:TTGTCTATGGAAGGGTCCTCT;
On above-mentioned WNK1 gene, the forward amplimer of the T-shaped gene of rs2277869 fragment and the forward amplimer of C type gene are nucleic acid sequence SEQ ID NO.36:AGGTGCTTTGTGAATGGACT;
On above-mentioned WNK1 gene, the forward amplimer of the T-shaped gene of rs2286007 fragment and the forward amplimer of C type gene are nucleic acid sequence SEQ ID NO.39:TGTGAACCTCCATTTTGTGATT;
On above-mentioned WNK1 gene, the forward amplimer of the T-shaped gene of rs2107614 fragment and the forward amplimer of C type gene are nucleic acid sequence SEQ ID NO.42:ACAGAACACTGGATTAGAAGCA.
Instruct a multiple gene detection kit for thiazide diuretic medication, comprise above-mentioned Primer composition, PCR reaction solution and positive reference substance; Described PCR reaction solution comprises following component: ultrapure water, X solution, 10 × PCR damping fluid, 25mM magnesium chloride solution, archaeal dna polymerase.
Described X solution is for comprising triphosphate deoxy-nucleotide (dNTPs) and universal primer, and described universal primer forward amplimer sequence is AGGTGACACTATAGAATA, as shown in SEQ IDNO.47; Reverse amplimer sequence is GTACGACTCACTATAGGGA, as shown in SEQID NO.48; Described universal primer forward amplimer band fluorescent mark.
Described positive reference substance is above-mentioned 10 and clones gained DNA fragmentation with the primer of the different genotype in 15 SNP site on thiazide diuretic medication genes involved.
The above-mentioned using method instructing the multiple gene detection kit of thiazide diuretic medication, specifically comprises the following steps:
(1) collecting sample extract nucleic acid
Gather patient's buccal swab or blood sample, therefrom extract nucleic acid;
(2) with the nucleic acid extracted for template carries out PCR reaction
Get DNA sample 2 μ L, the magnesium chloride 3.4 μ L of 10 × PCR damping fluid 2 μ L, 25mM, PCR primer solution 2 μ L, archaeal dna polymerase 0.6 μ L, X solution 2 μ L, ultrapure water 10 μ L joins the reaction of 96 hole sample panel enterprising performing PCR after mixing, reaction conditions: 95 DEG C 1 minute; 94 DEG C of 30 second, 60 DEG C of 30 second, 70 DEG C 1 minute, circulate 35 times; 70 DEG C 1 minute; 4 DEG C until collect PCR primer; Wherein said X solution is for comprising triphosphate deoxy-nucleotide (dNTPs) and universal primer, and described universal primer forward amplimer sequence is AGGTGACACTATAGAATA, as shown in SEQ ID NO.47; Reverse amplimer sequence is GTACGACTCACTATAGGGA, as shown in SEQ ID NO.48; Described universal primer forward amplimer band fluorescent mark; In PCR primer solution, each PCR primer concentration is 200nM, described PCR primer comprise following 10 with forward and reverse amplimer of the different genotype in 15 SNP site on thiazide diuretic medication genes involved and the forward and reverse amplimer reacting internal reference, gene order is as shown in SEQ ID NO.1 ~ NO.46 in sequence table;
(3) electrocapillary phoresis sample separation
Get PCR primer 0.1-1 μ L, sample-loading buffer 38.75 μ L, DNA standard substance 0.5 μ L, join after one, mineral oil mixes on 96 hole parting liquid plates and carry out electrocapillary phoresis sample separation, the collection of illustrative plates obtain the software of genetic analyzer and standard diagram contrast, and obtain the allelotype instructing the SNP site of thiazide diuretic medication genes involved.
The present invention compared with prior art, it has following beneficial effect: a kind of Primer composition instructing thiazide diuretic medication of the present invention, multiple gene detection kit and using method thereof, based on multiplex PCR and electrocapillary phoresis technology, utilize the PCR specific amplification fragment of different lengths to identify and distinguish different genes, found a kind of synchronous detection SLC12A3, NOS3, ADRB2, SLC22A6, YEATS4, ACE, CYP11B2, ADD1, NEDD4L, the detection scheme of the different genotype in 15 SNP site of WNK1 ten genes, to instruct the clinical application of thiazide diuretic, present method optimizes multi-PRC reaction system, specific amplification is carried out to DNA sample to be measured, pcr amplification product is separated to differentiate different genes and genotype again by electrocapillary phoresis method, the detection of 192 Patient Sample A can be completed within one sky, both production cost and testing cost had been saved, turn improve detection efficiency and shorten the time, the use of reaction internal reference can be used for the efficiency of monitoring whole reactive system, PCR reaction, avoids false negative.
Mentioned reagent box can instruct the clinical application of thiazide diuretic, specifically as shown in table 2:
Table 2. thiazide diuretic medication guide multiple gene detects target site
In sum, the present invention instructs the Primer composition of thiazide diuretic medication, multiple gene detection kit and using method thereof based on multiplex PCR-CE, synchronously the different genotype in 15 SNP site on 10 and thiazide diuretic medication genes involved is detected, detection sensitivity is high, specificity is good, reduces the false positive rate of standard PCR amplification; Have Noncompetitive internal comparison system, reliability is strong, without false negative result; There is sensitive, accurate, quick, high-throughout technical superiority, be the clinical molecular diagnosis method that a kind of superior low cost is provided, contribute to thiazide diuretic and use safely and effectively.
Accompanying drawing explanation
Fig. 1 is the electrocapillary phoresis separating resulting that test kit positive control of the present invention detects.There are 31 characteristic peaks altogether: wherein SLC12A3, NOS3, ADRB2, SLC22A6, YEATS4, ACE, CYP11B2, ADD1, NEDD4L and 5 WNK1(WNK1_1, WNK1_2, WNK1_3, WNK1_4, WNK1_5 in figure) be the gene locus detected, DNA clt is reaction internal reference.The CE fragment length of each characteristic peak is listed in table 6, such as: NOS3_1G(142nt), NOS3_1T(145nt), WNK1_1G(153nt), WNK1_1C(156nt) etc.
Embodiment
In order to understand content of the present invention better, be described further below in conjunction with specific embodiments and the drawings.Should be understood that these embodiments only for the present invention is further described, and be not used in and limit the scope of the invention.In addition should be understood that, after having read content of the present invention, person skilled in art makes some nonessential change or adjustment to the present invention, still belongs to protection scope of the present invention.
Embodiment 1
The present invention is a kind of multiple gene detection kit instructing thiazide diuretic medication, blood samples of patients or mouth swab sample extraction nucleic acid is gathered during use, with patient's nucleic acid for template enters PCR reaction, final by electrocapillary phoresis method sample separation, concrete steps are as follows:
1, the multiple gene detection kit of thiazide diuretic medication guide is produced, the component that test kit comprises:
1) PCR primer (PCR Primer Mix):
2) 25mM magnesium chloride (MgCl2)
3) archaeal dna polymerase (Taq DNA Polymerase)
4) X solution (Solution X)
5) PCR damping fluid (PCR Buffer)
6) positive control (Positive Control)
7) ultrapure water (ddH
2o)
Above-mentioned PCR primer comprise following 10 with forward and reverse amplimer of the different genotype in 15 SNP site on thiazide diuretic medication genes involved and the forward and reverse amplimer reacting internal reference, its gene order is as table 1(or see SEQ ID NO.1 ~ 46 in sequence table) shown in.
Described X solution is for comprising triphosphate deoxy-nucleotide (dNTPs) and universal primer, and described universal primer forward amplimer sequence is AGGTGACACTATAGAATA, as shown in SEQ IDNO.47; Reverse amplimer sequence is GTACGACTCACTATAGGGA, as shown in SEQID NO.48; Described universal primer forward amplimer band fluorescent mark.
2, collecting sample extract nucleic acid
Gather tumour patient buccal swab or blood sample and extract nucleic acid.
3, with the patient's nucleic acid extracted for template carries out PCR reaction
1) on 96 hole sample panel/eight connecting legs, add reagent and sample (PCR plate is in table 3) in following ratio, and a positive control reaction be set:
Table 3PCR reaction reagent and sample mix ratio
| PCR reaction reagent | Amount/hole |
| ddH 2O | 8 |
| 25mM MgCl 2 | 3.4 |
| 10 × PCR damping fluid | 2 |
| PCR primer solution | 2 |
| X solution | 2 |
| DNA sample/positive control | 2 |
| Archaeal dna polymerase | 0.6 |
| Total | 20μL |
Note: positive control is 10 and clones gained DNA fragmentation with the primer of the different genotype in 15 SNP site on thiazide diuretic medication genes involved. consumption is that 1 μ L/ reacts.
2) thermal cycle reaction (see table 4) is carried out by following temperature after mixing:
Table 4PCR reaction conditions
4, electrocapillary phoresis sample separation
1) CE sample (see table 5) is prepared:
Table 5CE sample mix ratio
| Title | Amount/hole |
| Sample-loading buffer | 38.75μL |
| DNA size criteria 400 | 0.5μL |
| PCR primer | 0.1-1μL |
| Mineral oil | 1 |
2) CE sample separation
Sample is added in the hole of proper number on 96 hole capillary electrophoresis separation plates; Capillary electrophoresis separation is a class is split tunnel with kapillary, take high-voltage dc as the Novel liquid-phase isolation technique of motivating force, specific procedure is 90 DEG C of sex change 120 seconds, sample introduction voltage 2kv, 30 seconds, separation voltage 6kv, 35 minutes.
5, interpretation of result (concrete grammar is shown in genetic analyzer specification sheets)
The CE analyzing this test kit detects data, according to SLC12A3, NOS3, ADRB2, SLC22A6, YEATS4, ACE, CYP11B2, ADD1, NEDD4L and 5 WNK1(WNK1_1, WNK1_2, WNK1_3, WNK1_4, WNK1_5) gene expression characteristics peak occur position and quantity (please refer to table 6), determine genotype.For SLC12A3 gene: only occur SLC12A3_C(CE fragment length 169nt) time, result is SLC12A3C homozygote; Only there is SLC12A3_T(CE fragment length 172nt) time, result is SLC12A3T homozygote; SLC12A3_C peak and SLC12A3_T peak occur simultaneously, and result is SLC12A3 heterozygote.The result decision method of other gene is identical with SLC12A3 gene.
The CE fragment length of the gene locus that this test kit of table 6. detects, reaction internal reference
Note: SLC12A3, NOS3, ADRB2, SLC22A6, YEATS4, ACE, CYP11B2, ADD1, NEDD4L in table 6, Fig. 1 and 5 WNK1(WNK1_1, WNK1_2, WNK1_3, WNK1_4, WNK1_5) be the gene locus detected, DNA clt is reaction internal reference.
Fig. 1 is the electrocapillary phoresis separating resulting that this test kit positive control detects, there are 31 characteristic peaks altogether: wherein SLC12A3, NOS3, ADRB2, SLC22A6, YEATS4, ACE, CYP11B2, ADD1, NEDD4L and 5 WNK1(WNK1_1, WNK1_2, WNK1_3, WNK1_4, WNK1_5 in figure) be the gene locus detected, DNA clt is reaction internal reference.The CE fragment length of each characteristic peak is listed in table 6, such as: NOS3_1G(142nt), NOS3_1T(145nt), WNK1_1G(153nt), WNK1_1C(156nt) etc.This Fig. 1 also can as standard diagram, and when measuring other sample genotype, the collection of illustrative plates obtain the software of genetic analyzer and standard diagram contrast, and obtains the allelotype instructing the SNP site of thiazide diuretic medication genes involved.
Embodiment 2
Detection kit specificity analyses: substance pcr amplification is detected as the unimodal of target fragment size through capillary electrophoresis.
Above-mentioned explanation is not limitation of the present invention, and the present invention is also not limited to above-mentioned citing.Those skilled in the art are in essential scope of the present invention, and the change made, remodeling, interpolation or replacement, also should belong to protection scope of the present invention.
Claims (3)
1. one kind instruct thiazide diuretic medication Primer composition, it is characterized in that, comprise following 10 with forward and reverse amplimer of the different genotype in 15 SNP site on thiazide diuretic medication genes involved and the forward and reverse amplimer reacting internal reference, its nucleotide sequence is as follows:
2. instruct a multiple gene detection kit for thiazide diuretic medication, it is characterized in that, comprise Primer composition as claimed in claim 1, PCR reaction solution and positive reference substance; Described PCR reaction solution comprises following component: ultrapure water, X solution, 10 × PCR damping fluid, 25mM magnesium chloride solution, archaeal dna polymerase;
Described X solution is for comprising dNTPs and universal primer, and described universal primer forward amplimer sequence is AGGTGACACTATAGAATA, as shown in SEQ ID NO.47; Reverse amplimer sequence is GTACGACTCACTATAGGGA, as shown in SEQ ID NO.48; Described universal primer forward amplimer band fluorescent mark.
3. a kind of multiple gene detection kit instructing thiazide diuretic medication according to claim 2, is characterized in that: described positive reference substance is above-mentioned 10 and clones gained DNA fragmentation with the primer of the different genotype in 15 SNP site on thiazide diuretic medication genes involved.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410014297.7A CN103757109B (en) | 2014-01-13 | 2014-01-13 | Primer composition and multiple-gene detection kit for guiding administration of thiazine diuresis drugs and application method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410014297.7A CN103757109B (en) | 2014-01-13 | 2014-01-13 | Primer composition and multiple-gene detection kit for guiding administration of thiazine diuresis drugs and application method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103757109A CN103757109A (en) | 2014-04-30 |
| CN103757109B true CN103757109B (en) | 2015-03-25 |
Family
ID=50524424
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410014297.7A Active CN103757109B (en) | 2014-01-13 | 2014-01-13 | Primer composition and multiple-gene detection kit for guiding administration of thiazine diuresis drugs and application method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103757109B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105861514B (en) * | 2016-05-27 | 2019-05-21 | 山东省立医院 | The new mutation Disease-causing gene SLC12A3 of Gitelman syndrome and its coding albumen and application |
| CN107435076A (en) * | 2017-09-08 | 2017-12-05 | 银川安龙基因科技有限公司 | A kind of hypertension medication genetic test Solid phase PCR kit |
| CN109897895A (en) * | 2019-01-11 | 2019-06-18 | 江苏百世诺医疗科技有限公司 | A kind of TaqMan-MGB probe technique detection influences the development of methodology of antihypertensive drugs curative effect gene |
-
2014
- 2014-01-13 CN CN201410014297.7A patent/CN103757109B/en active Active
Non-Patent Citations (4)
| Title |
|---|
| Physiological interaction between alpha-adducin and WNK1-NEDD4L pathways on sodium-related blood pressure regulation;Manunta P. et al.;《Hypertension》;20081231;第52卷(第2期);第366-367页 * |
| 抗高血压药的基因组学研究进展;谢宇等;《中国药房》;20101231;第21卷(第2期);第171-174页 * |
| 遗传药理学与高血压药物治疗进展;沈杰等;《中国临床药理学与治疗学》;20100630;第15卷(第6期);第705-714页 * |
| 高血压药物基因治疗研究进展;张永莉;《中华老年心脑血管病杂志》;20131031;第15卷(第10期);第1106-1108页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103757109A (en) | 2014-04-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103849681B (en) | A kind of Primer composition, multiple gene detection kit and using method thereof instructing medicine of glonoin and health to drink | |
| CN103074434B (en) | CYP2C19 gene polymorphyism detection kit and detection method thereof | |
| CN103074436B (en) | Multi-gene detection kit for guiding administration of 5-fluorouracil and detection method of multi-gene detection kit | |
| CN104818320B (en) | Primer, probe, detection architecture and the kit of disposable detection lung cancer multiple gene | |
| CN107828870A (en) | One kind detects MTHFR and MTRR gene pleiomorphisms kit and method simultaneously using molecular beacon probe melting curve method | |
| CN104745679A (en) | Method and kit for non-invasive detection of EGFR (epidermal growth factor receptor) gene mutation | |
| CN105463122A (en) | MTHFR, MTRR and RFC1 gene polymorphism detection primer combination and kit and application of MTHFR, MTRR and RFC1 gene polymorphism detection kit | |
| CN102925562B (en) | Kit and method for detecting aminoglycoside drug-induced deafness-sensitive gene | |
| CN105296619A (en) | Kit for SNP typing of obesity-prone genes of Chinese population and using method of kit | |
| CN103757091A (en) | Rapid gene detection kit and rapid gene detection method for sudden cardiac death | |
| CN103757109B (en) | Primer composition and multiple-gene detection kit for guiding administration of thiazine diuresis drugs and application method thereof | |
| CN105463116A (en) | Forensic medicine composite detection reagent kit based on 20 triallelic SNP genetic markers and detection method | |
| CN103074435B (en) | Kit for synchronously detecting related gene expression levels of 14 antineoplastic drugs and detection method of kit | |
| CN103074438B (en) | Multi-gene detection kit for guiding administration of warfarin and detection method of multi-gene detection kit | |
| CN104293932A (en) | Method for detecting HLA-B * 5801 allele based on real-time fluorescence PCR | |
| CN105238861A (en) | Kit for Chinese pediatric asthma susceptibility gene SNP (single nucleotide polymorphism) genotyping and application method of kit for Chinese pediatric asthma susceptibility gene SNP genotyping | |
| CN105331623A (en) | MTB (mycobacterium tuberculosis) rpoB mutant gene and application thereof | |
| CN103540676B (en) | Kit for detecting mutations of A-G at 1555th site and C-T at 1494th site of mitochondrial gene | |
| CN111235261B (en) | Kit for detecting human platelet-specific antigen HPA 1-29 genotyping | |
| CN107641649B (en) | Primer pair, kit and method for detecting stability of NR27 locus of microsatellite | |
| CN103740831B (en) | Primer combination for guiding application of beta-receptor blocker, multi-gene detection kit and using method thereof | |
| CN102251046A (en) | Method for detecting tumor mutant gene in blood | |
| CN105316349A (en) | Mycobacterium tuberculosis KatG mutant gene and application thereof | |
| CN104232774A (en) | Primers for detecting breast cancer susceptibility gene SNP (single nucleotide polymorphism), fluorescent probes and applications | |
| CN103215356A (en) | Assay kit for detecting human leukocyte antigen-B (HLA-B)*57:01 and HLA complex P5 (HCP5) alleles |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |