CN103757109A - Primer composition and multiple-gene detection kit for guiding administration of thiazine diuresis drugs and application method thereof - Google Patents
Primer composition and multiple-gene detection kit for guiding administration of thiazine diuresis drugs and application method thereof Download PDFInfo
- Publication number
- CN103757109A CN103757109A CN201410014297.7A CN201410014297A CN103757109A CN 103757109 A CN103757109 A CN 103757109A CN 201410014297 A CN201410014297 A CN 201410014297A CN 103757109 A CN103757109 A CN 103757109A
- Authority
- CN
- China
- Prior art keywords
- pcr
- primer
- gene
- amplimer
- solution
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Pathology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a primer composition and multiple-gene detection kit for guiding the administration of thiazine diuresis drugs and an application method thereof. The primer composition comprises ultrapure water, an X solution, a 10*PCR buffer solution, a PCR primer, a 25mM magnesium chloride solution, a DNA polymerase and a positive reference substance and is characterized in that the PCR primer comprises the following ten forward/reverse amplification primers and reaction reference forward/reverse amplification primers of different gene types on 15 SNP sites on the gene related to the administration of thiazine diuresis drugs, wherein the gene sequences are shown by the SEQ ID No.1 to No.46. The application method comprises the following steps: collecting the samples and extracting nucleic acid; performing a PCR reaction by taking the extracted nucleic acid as a template; and finally, performing capillary electrophoretic separation of the samples with the GeXP genetic analyzer. The primer composition has the advantages of strong specificity, high accuracy, high flux, high reliability, low cost and no false negative result.
Description
Technical field
The present invention relates to a kind of multiple gene detecting kit and detection method thereof, especially relate to a kind of primer sets compound of thiazide diuretic medication, multiple gene detecting kit and using method thereof of instructing.
Background technology
Thiazide diuretic is one of five kind of one line depressor, mainly by three kinds of mechanism, plays a role: suppress distal convoluted tubule leading portion and the absorption of proximal convoluted tubule to sodium-chlor, increase the Na of distal convoluted tubule and collecting tubule
+-K
+exchange, promotes K
+secretion; Suppress the activity of phosphodiesterase, reduce picked-up and the plastosome oxygen consumption of uriniferous tubules to lipid acid, suppress uriniferous tubules to Na
+, Cl
-active heavily absorb; Because uriniferous tubules is to water, Na
+absorption reduce, uriniferous tubules internal pressure raise, the water of the distal convoluted tubule of flowing through and Na
+increase, impel macula densa to reflect by Guan Yiqiu, in kidney, feritin, Angiotensin secretion increase, and uriniferous tubules shrinks, renal blood flow declines, and renal glomerulus goal and efferent glomerular arteriole shrink, and glomerular filtration rate(GFR also declines thereupon.Although thiazide diuretic is for a long time as a line antihypertensive drug, in clinical application, but there is the low and large problem of side effect of treated effect, and have significant individual difference, some patients were benefits, and also there is serious toxic side effect in some patients were resistance.Research shows, individual difference and the single nucleotide polymorphism (SNP) of crowd's parathiazine class hydragog(ue) are closely related.Hyperpietic is before accepting thiazide diuretic treatment, carry out the monitoring of thiazide diuretic related SNP gene locus, according to monitoring result, formulate chemotherapy regimen, improve the specific aim of hypertension clinical treatment, reduce the generation of poisonous side effect of medicine, save the valuable treatment time.
Existing SNP detection method is mainly gene chips, quantitative fluorescent PCR (qPCR) and Sanger sequencing.
(1) qPCR detection method: adopt fluorescent quenching and two end-labelling, design specific probe for SNP Mutation.Its advantage be highly sensitive, accuracy is strong.Its shortcoming is that (1) flux is low: be not suitable for the detection in many SNP site; Be difficult to arrange internal control gene.(2) cost is higher: probe mark cost is high; If need, obtain all related SNP information, need carry out multiple detection tests, stack cost is more expensive.
(2) gene chips: gene chip is to pass through micro-processing technology, by the DNA fragmentation of the particular sequence of ten hundreds of and even 1,000,000 (gene probe), arrange and be fixed on the upholders such as silicon chip, slide regularly, the two-dimentional DNA probe array forming, utilize the biological sample of this class chip and mark to hybridize, can carry out fast qualitative and quantitative analysis to the gene expression profile bioinformation of sample.DNA chip: because the advantages such as high-throughput are widely applied in SNP detects, rely on the difference of wild-type and mutated genes hybridization kinetics to detect mutational site.Its advantage is: (1) high-flux parallel detects; (2) easy and simple to handle quick: whole detection only needs substantially can go out for 4-8 hour result.Shortcoming: 1) the hybridization kinetics difference difference between different SNP site, carry out multidigit point while detecting simultaneously condition be difficult to control; 2) technical costs costliness, complexity: each sample needs a chip, and cost great Yu $1000/ sample, is unfavorable for large-scale promotion; Synthetic and the fixing more complicated of probe, particularly make highdensity probe array, is main rate-limiting step; 3) poor repeatability, accuracy is low, is prone to false positive false negative result; 4) sensitivity is lower: chip method needs nucleic acid amount larger, generally must first do multiplex PCR amplification, because primer is more, easily self produces dimer, hairpin structure, or because Tm value is different, and the object fragment efficiency difference that causes increasing, and then the sensitivity of impact detection; 5), because the kind of chip is more, be difficult to formulate a unified quality control standard.
(3) Sanger(dideoxy chain termination) sequencing: Sanger method is to start at a certain fixing point according to Nucleotide, at some specific bases place, stop at random, and after each base, carry out fluorescent mark, a series of Nucleotide of four groups of different lengthss that generation finishes with A, T, C, G, then on urea-denatured PAGE glue, electrophoresis detects, thereby obtains visible DNA base sequence.Its advantage is snp analysis gold standard, can find known SNP, also can find unknown SNP.Shortcoming is that each site of each sample all needs through pcr amplification, runs glue, then cuts glue purification, then checks order.Step, disperse, cost is higher more, and workload is large, and the cycle is long, and it is relatively costly that accumulative total price is detected in multiple SNP site.
Multiple SNP loci detection method is based on multiplex PCR and capillary electrophoresis (CE) isolation technique.Adopt multiple PCR method, simultaneously add in the same reaction tubes >=1 pair of specific gene amplimer and reaction internal reference primer, according to the size of gene amplification fragment, by capillary electrophoresis separation, analyze multiple SNP site and genotype, can fast and effeciently detect multiple SNP site, overcome the defect that traditional method exists, there is following advantage:
1, high-throughput: native system is realized a single reaction detection 30-40 site.
2, accuracy is strong: adopt CE to separate PCR product, can, by Fen Li to non-specific amplification product, primer dimer and specific amplification products, at utmost reduce false positive;
3, susceptibility is high, and result is reproducible: native system has overcome the deviation that the unequal amplification of normal PCR amplification method causes, and has improved a set of goal gene is carried out to speed and susceptibility qualitatively, adopts laser induced fluorescence(LIF)-PMT, has hypersensitivity;
4, method is easy, uses economical: the invention provides from a complete set of experimental programs such as reagent, multiple PCR primer design, interpretations of result; The testing cost Shao Yu $50 of each sample, is beneficial to large-scale promotion;
5, handiness is strong: the target gene that can adjust according to demand at any time detection.
6, easily be automated.
At present, also about the multiple SNP based on multiplex PCR and CE, do not detect and instruct the test kit of thiazide diuretic medication and the relevant report of using method thereof both at home and abroad.
Summary of the invention
Technical problem to be solved by this invention is to provide a kind of high specificity, highly sensitive, flux is high, reliability is strong, cost is low, without the primer sets compound of the SNP detection system based on multiplex PCR and electrocapillary phoresis of false negative result.
Technical problem to be solved by this invention is also to provide the multiple gene detecting kit and the using method thereof that comprise above-mentioned primer sets compound.
The present invention solves the problems of the technologies described above adopted technique means: a kind of instruct thiazide diuretic medication primer sets compound, comprise following 10 with forward and reverse amplimer of the different genotype on 15 SNP sites on thiazide diuretic medication genes involved and react forward and reverse amplimer of internal reference, its nucleotide sequence is as shown in table 1 below:
Table 1
On above-mentioned SLC12A3 gene, the reverse amplimer of C type gene of rs13306673 fragment and the reverse amplimer of T-shaped gene are nucleic acid sequence SEQ ID NO.3:GTCAGAGCTGAGCCTGGAT;
On above-mentioned NOS3 gene, the reverse amplimer of G type gene of rs1799983 fragment and the reverse amplimer of T-shaped gene are nucleic acid sequence SEQ ID NO.6:CCCAGTCAATCCCTTTGGTG;
On above-mentioned NOS3 gene, the reverse amplimer of the reverse amplimer of the T-shaped gene of rs2070744 fragment and C type gene is nucleic acid sequence SEQ ID NO.9:TAGACACAAAAGAGCAGGAAGC:
On ADRB2 gene, the reverse amplimer of the G type gene of rs2400707 fragment and the reverse amplimer of A type gene are nucleic acid sequence SEQ ID NO.12:ACTCTTGAGAGTGTGGCATC;
On above-mentioned SLC22A6 gene, the reverse amplimer of the G type gene of rs10792367 fragment and the reverse amplimer of C type gene are nucleic acid sequence SEQ ID NO.15:GTGAGGCGACTTCCACTG;
On above-mentioned YEATS4 gene, the reverse amplimer of C type gene of rs7297610 fragment and the reverse amplimer of T-shaped gene are nucleic acid sequence SEQ ID NO.18:TGTCTGACGGATCCAAAGTT;
On above-mentioned ACE gene, the forward amplimer of the ins type gene of rs1799752 fragment and the forward amplimer of del type gene are nucleic acid sequence SEQ ID NO.19:ATCCTTTCTCCCATTTCTCTAGAC, and the reverse amplimer of the reverse amplimer of ins type gene and del type gene is nucleic acid sequence SEQ ID NO.20:ACAGGTCTTCATATTTCCGGG;
On above-mentioned CYP11B2 gene, the forward amplimer of the G type gene of rs1799998 fragment and the forward amplimer of A type gene are nucleic acid sequence SEQ ID NO.21:CCCAGCCAAAGGTAGATGAAG;
On above-mentioned ADD1 gene, the forward amplimer of the forward amplimer of the T-shaped gene of rs4961 fragment and G type gene is nucleic acid sequence SEQ ID NO.24:CTAGGGCTACAGAACTGGCTA;
On above-mentioned NEDD4L gene, the forward amplimer of the G type gene of rs4149601 fragment and the forward amplimer of A type gene are nucleic acid sequence SEQ ID NO.27:AGGAAGCCATTTCCAGAGAG;
On above-mentioned WNK1 gene, the forward amplimer of the G type gene of rs1159744 fragment and the forward amplimer of C type gene are nucleic acid sequence SEQ ID NO.30:TGGGAGTAATTATAGTACCTATTCA;
On above-mentioned WNK1 gene, the forward amplimer of the forward amplimer of the T-shaped gene of rs880054 fragment and C type gene is nucleic acid sequence SEQ ID NO.33:TTGTCTATGGAAGGGTCCTCT;
On above-mentioned WNK1 gene, the forward amplimer of the forward amplimer of the T-shaped gene of rs2277869 fragment and C type gene is nucleic acid sequence SEQ ID NO.36:AGGTGCTTTGTGAATGGACT;
On above-mentioned WNK1 gene, the forward amplimer of the forward amplimer of the T-shaped gene of rs2286007 fragment and C type gene is nucleic acid sequence SEQ ID NO.39:TGTGAACCTCCATTTTGTGATT;
On above-mentioned WNK1 gene, the forward amplimer of the forward amplimer of the T-shaped gene of rs2107614 fragment and C type gene is nucleic acid sequence SEQ ID NO.42:ACAGAACACTGGATTAGAAGCA.
Instruct a multiple gene detecting kit for thiazide diuretic medication, comprise above-mentioned primer sets compound, PCR reaction solution and positive reference substance; Described PCR reaction solution comprises following component: ultrapure water, X solution, 10 × PCR damping fluid, 25mM magnesium chloride solution, archaeal dna polymerase.
Described X solution is for comprising triphosphate deoxy-nucleotide (dNTPs) and universal primer, and described universal primer forward amplimer sequence is AGGTGACACTATAGAATA, as shown in SEQ ID NO.47; Oppositely amplimer sequence is GTACGACTCACTATAGGGA, as shown in SEQ ID NO.48; Described universal primer forward amplimer band fluorescent mark.
Described positive reference substance be above-mentioned 10 with thiazide diuretic medication genes involved on 15 SNP sites on the primer clone gained DNA fragmentation of different genotype.
The using method of the above-mentioned multiple gene detecting kit that instructs thiazide diuretic medication, specifically comprises the following steps:
(1) collecting sample extract nucleic acid
Gather patient's buccal swab or blood sample, therefrom extract nucleic acid;
(2) take the nucleic acid that extracts as template, carry out PCR reaction
Get DNA sample 2 μ L, 10 × PCR damping fluid, 2 μ L, the magnesium chloride 3.4 μ L of 25mM, PCR primer solution 2 μ L, archaeal dna polymerase 0.6 μ L, X solution 2 μ L, after ultrapure water 10 μ L mix, join the reaction of the enterprising performing PCR of 96 hole sample panel, reaction conditions: 95 ℃ 1 minute; 94 ℃ of 30 second, 60 ℃ of 30 second, 70 ℃ 1 minute, circulate 35 times; 70 ℃ 1 minute; 4 ℃ until collect PCR product; Wherein said X solution is for comprising triphosphate deoxy-nucleotide (dNTPs) and universal primer, and described universal primer forward amplimer sequence is AGGTGACACTATAGAATA, as shown in SEQ ID NO.47; Oppositely amplimer sequence is GTACGACTCACTATAGGGA, as shown in SEQ ID NO.48; Described universal primer forward amplimer band fluorescent mark; In PCR primer solution, each PCR primer concentration is 200nM, described PCR primer comprise following 10 with forward and reverse amplimer of the different genotype on 15 SNP sites on thiazide diuretic medication genes involved and react forward and reverse amplimer of internal reference, gene order is as shown in SEQ ID NO.1~NO.46 in sequence table;
(3) electrocapillary phoresis sample separation
Get PCR product 0.1-1 μ L, sample-loading buffer 38.75 μ L, DNA standard substance 0.5 μ L, after one, mineral oil mixes, join on 96 hole parting liquid plates and carry out electrocapillary phoresis sample separation, the collection of illustrative plates that the software of genetic analyzer is obtained and standard diagram contrast, the allelotype in the SNP site of thiazide diuretic medication genes involved is instructed in acquisition.
The present invention compared with prior art, it has following beneficial effect: a kind of primer sets compound that instructs thiazide diuretic medication of the present invention, multiple gene detecting kit and using method thereof, based on multiplex PCR and electrocapillary phoresis technology, utilize the PCR specific amplification fragment of different lengths to identify the gene that differentiation is different, founded a kind of synchronous detection SLC12A3, NOS3, ADRB2, SLC22A6, YEATS4, ACE, CYP11B2, ADD1, NEDD4L, the detection scheme of the different genotype on 15 SNP sites of ten genes of WNK1, to instruct the clinical application of thiazide diuretic, present method is optimized multi-PRC reaction system, DNA sample to be measured is carried out to specific amplification, by electrocapillary phoresis method, separate pcr amplification product to differentiate different genes and genotype again, within one sky, can complete the detection of 192 patient's samples, both production cost and testing cost had been saved, improved again detection efficiency and shortened the time, the use of reaction internal reference can be used for monitoring the efficiency of whole reactive system, PCR reaction, avoids false negative.
Mentioned reagent box can instruct the clinical application of thiazide diuretic, specifically as shown in table 2:
The multiple gene test of table 2. thiazide diuretic medication guide detects target site
In sum, the present invention is based on the primer sets compound that instructs thiazide diuretic medication of multiplex PCR-CE, multiple gene detecting kit and using method thereof, synchronously to 10 with thiazide diuretic medication genes involved on 15 SNP sites on different genotype detect, detection sensitivity is high, specificity is good, has reduced the false positive rate of conventional pcr amplification; Have Noncompetitive internal comparison system, reliability is strong, without false negative result; There is sensitive, accurate, quick, high-throughout technical superiority, for clinical, provide a kind of superior molecular diagnosis method cheaply, contribute to thiazide diuretic to use safely and effectively.
Accompanying drawing explanation
Fig. 1 is the electrocapillary phoresis separating resulting that test kit positive control of the present invention detects.In figure, there are altogether 31 characteristic peaks: wherein SLC12A3, NOS3, ADRB2, SLC22A6, YEATS4, ACE, CYP11B2, ADD1, NEDD4L and 5 WNK1(WNK1_1, WNK1_2, WNK1_3, WNK1_4, WNK1_5) gene locus for detecting, DNA clt is reaction internal reference.The CE fragment length of each characteristic peak is listed in table 6, for example: NOS3_1G(142nt), NOS3_1T(145nt), WNK1_1G(153nt), WNK1_1C(156nt) etc.
Embodiment
In order to understand better content of the present invention, below in conjunction with specific embodiments and the drawings, be described further.Should be understood that these embodiment, only for the present invention is further described, limit the scope of the invention and be not used in.In addition should be understood that and reading after content of the present invention, person skilled in art makes some nonessential change or adjustment to the present invention, still belongs to protection scope of the present invention.
The present invention is a kind of multiple gene detecting kit that instructs thiazide diuretic medication, during use, gather blood samples of patients or buccal swab sample extraction nucleic acid, take patient's nucleic acid as template, enter PCR reaction, finally use electrocapillary phoresis method sample separation, concrete steps are as follows:
1, produce the multiple gene detecting kit of thiazide diuretic medication guide, the component that test kit comprises:
1) PCR primer (PCR Primer Mix):
2) 25mM magnesium chloride (MgCl2)
3) archaeal dna polymerase (Taq DNA Polymerase)
4) X solution (Solution X)
5) PCR damping fluid (PCR Buffer)
6) positive control (Positive Control)
7) ultrapure water (ddH
2o)
Above-mentioned PCR primer comprise following 10 with forward and reverse amplimer of the different genotype on 15 SNP sites on thiazide diuretic medication genes involved and react forward and reverse amplimer of internal reference, its gene order is as table 1(or referring to SEQ ID NO.1~46 in sequence table) as shown in.
Described X solution is for comprising triphosphate deoxy-nucleotide (dNTPs) and universal primer, and described universal primer forward amplimer sequence is AGGTGACACTATAGAATA, as shown in SEQ ID NO.47; Oppositely amplimer sequence is GTACGACTCACTATAGGGA, as shown in SEQ ID NO.48; Described universal primer forward amplimer band fluorescent mark.
2, collecting sample extract nucleic acid
Gather tumour patient buccal swab or blood sample and extract nucleic acid.
3, take patient's nucleic acid of extracting as template, carry out PCR reaction
1) in following ratio, on 96 hole sample panel/eight connecting legs, add reagent and sample (PCR plate is in Table 3), and a positive control reaction be set:
Table 3PCR reaction reagent and sample mix ratio
PCR reaction reagent | Amount/hole |
ddH 2O | 8 |
25mM?MgCl 2 | 3.4 |
10 × |
2 |
PCR primer solution | 2 |
|
2 |
DNA sample/ |
2 |
Archaeal dna polymerase | 0.6 |
Total | 20μL |
Note: positive control be 10 with the primer clone gained DNA fragmentation of the different genotype on 15 SNP sites on thiazide diuretic medication genes involved. consumption is that 1 μ L/ reacts.
2) by following temperature, carry out thermal cycle reaction (in Table 4) after mixing:
Table 4PCR reaction conditions
4, electrocapillary phoresis sample separation
1) prepare CE sample (in Table 5):
Table 5CE sample mix ratio
Title | Amount/hole |
Sample-loading buffer | 38.75μL |
DNA size criteria 400 | 0.5μL |
PCR product | 0.1- |
Mineral oil | |
1 |
2) CE sample separation
Sample is added in the hole of proper number on 96 hole capillary electrophoresis separation plates; Capillary electrophoresis separation is the Novel liquid-phase isolation technique of a class take kapillary as split tunnel, take high-voltage dc as motivating force, and specific procedure is 90 ℃ of sex change 120 seconds, sample introduction voltage 2kv, 30 seconds, separation voltage 6kv, 35 minutes.
5, interpretation of result (concrete grammar is shown in genetic analyzer specification sheets)
The CE that analyzes this test kit detects data, according to SLC12A3, NOS3, ADRB2, SLC22A6, YEATS4, ACE, CYP11B2, ADD1, NEDD4L and 5 WNK1(WNK1_1, WNK1_2, WNK1_3, WNK1_4, WNK1_5) position and quantity (please refer to table 6) that gene expression characteristics peak occurs, determine genotype.Take SLC12A3 gene as example: only occur SLC12A3_C(CE fragment length 169nt) time, result is SLC12A3C homozygote; Only there is SLC12A3_T(CE fragment length 172nt) time, result is SLC12A3T homozygote; SLC12A3_C peak and SLC12A3_T peak occur simultaneously, and result is SLC12A3 heterozygote.The result decision method of other gene is identical with SLC12A3 gene.
The gene locus that this test kit of table 6. detects, the CE fragment length of reaction internal reference
Note: SLC12A3, NOS3 in table 6, Fig. 1, ADRB2, SLC22A6, YEATS4, ACE, CYP11B2, ADD1, NEDD4L and 5 WNK1(WNK1_1, WNK1_2, WNK1_3, WNK1_4, WNK1_5) gene locus for detecting, DNA clt is reaction internal reference.
Fig. 1 is the electrocapillary phoresis separating resulting that this test kit positive control detects, in figure, there are altogether 31 characteristic peaks: wherein SLC12A3, NOS3, ADRB2, SLC22A6, YEATS4, ACE, CYP11B2, ADD1, NEDD4L and 5 WNK1(WNK1_1, WNK1_2, WNK1_3, WNK1_4, WNK1_5) gene locus for detecting, DNA clt is reaction internal reference.The CE fragment length of each characteristic peak is listed in table 6, for example: NOS3_1G(142nt), NOS3_1T(145nt), WNK1_1G(153nt), WNK1_1C(156nt) etc.This Fig. 1 also can be used as standard diagram, while measuring other sample gene type, and the collection of illustrative plates that the software of genetic analyzer is obtained and standard diagram contrast, the allelotype in the SNP site of thiazide diuretic medication genes involved is instructed in acquisition.
Detection kit specificity analyses: it is the unimodal of target fragment size that substance pcr amplification detects through capillary electrophoresis.
Above-mentioned explanation is not limitation of the present invention, and the present invention is also not limited to above-mentioned giving an example.Those skilled in the art are in essential scope of the present invention, and variation, remodeling, interpolation or the replacement made, also should belong to protection scope of the present invention.
Claims (5)
- One kind instruct thiazide diuretic medication primer sets compound, it is characterized in that, comprise following 10 with forward and reverse amplimer of the different genotype on 15 SNP sites on thiazide diuretic medication genes involved and react forward and reverse amplimer of internal reference, its nucleotide sequence is as follows:
- 2. a multiple gene detecting kit that instructs thiazide diuretic medication, is characterized in that, comprises primer sets compound as claimed in claim 1, PCR reaction solution and positive reference substance; Described PCR reaction solution comprises following component: ultrapure water, X solution, 10 × PCR damping fluid, 25mM magnesium chloride solution, archaeal dna polymerase.
- 3. a kind of multiple gene detecting kit that instructs thiazide diuretic medication according to claim 2, it is characterized in that: described X solution is for comprising triphosphate deoxy-nucleotide (dNTPs) and universal primer, described universal primer forward amplimer sequence is AGGTGACACTATAGAATA, as shown in SEQ ID NO.47; Oppositely amplimer sequence is GTACGACTCACTATAGGGA, as shown in SEQ ID NO.48; Described universal primer forward amplimer band fluorescent mark.
- 4. a kind of multiple gene detecting kit that instructs thiazide diuretic medication according to claim 3, is characterized in that: described positive reference substance be above-mentioned 10 with thiazide diuretic medication genes involved on 15 SNP sites on the primer clone gained DNA fragmentation of different genotype.
- 5. the using method of the above-mentioned multiple gene detecting kit that instructs thiazide diuretic medication, is characterized in that, specifically comprises the following steps:(1) collecting sample extract nucleic acidGather patient's buccal swab or blood sample, therefrom extract nucleic acid;(2) take the nucleic acid that extracts as template, carry out PCR reactionGet DNA sample 2 μ L, 10 × PCR damping fluid, 2 μ L, the magnesium chloride 3.4 μ L of 25mM, PCR primer solution 2 μ L, archaeal dna polymerase 0.6 μ L, X solution 2 μ L, after ultrapure water 10 μ L mix, join the reaction of the enterprising performing PCR of 96 hole sample panel, reaction conditions: 95 ℃ 1 minute; 94 ℃ of 30 second, 60 ℃ of 30 second, 70 ℃ 1 minute, circulate 35 times; 70 ℃ 1 minute; 4 ℃ until collect PCR product; Wherein said X solution is for comprising triphosphate deoxy-nucleotide (dNTPs) and universal primer, and described universal primer forward amplimer sequence is AGGTGACACTATAGAATA, as shown in SEQ ID NO.47; Oppositely amplimer sequence is GTACGACTCACTATAGGGA, as shown in SEQ ID NO.48; Described universal primer forward amplimer band fluorescent mark; In PCR primer solution, each PCR primer concentration is 200nM, described PCR primer comprise following 10 with forward and reverse amplimer of the different genotype on 15 SNP sites on thiazide diuretic medication genes involved and react forward and reverse amplimer of internal reference, gene order is as shown in SEQ ID NO.1~NO.46 in sequence table;(3) electrocapillary phoresis sample separationGet PCR product 0.1-1 μ L, sample-loading buffer 38.75 μ L, DNA standard substance 0.5 μ L, after one, mineral oil mixes, join on 96 hole parting liquid plates and carry out electrocapillary phoresis sample separation, the collection of illustrative plates that the software of genetic analyzer is obtained and standard diagram contrast, the allelotype in the SNP site of thiazide diuretic medication genes involved is instructed in acquisition.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410014297.7A CN103757109B (en) | 2014-01-13 | 2014-01-13 | Primer composition and multiple-gene detection kit for guiding administration of thiazine diuresis drugs and application method thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410014297.7A CN103757109B (en) | 2014-01-13 | 2014-01-13 | Primer composition and multiple-gene detection kit for guiding administration of thiazine diuresis drugs and application method thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN103757109A true CN103757109A (en) | 2014-04-30 |
CN103757109B CN103757109B (en) | 2015-03-25 |
Family
ID=50524424
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201410014297.7A Active CN103757109B (en) | 2014-01-13 | 2014-01-13 | Primer composition and multiple-gene detection kit for guiding administration of thiazine diuresis drugs and application method thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN103757109B (en) |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105861514A (en) * | 2016-05-27 | 2016-08-17 | 山东省立医院 | New mutant pathogenic gene SLC12A3 of Gitelman syndrome as well as encoded protein and application thereof |
CN107435076A (en) * | 2017-09-08 | 2017-12-05 | 银川安龙基因科技有限公司 | A kind of hypertension medication genetic test Solid phase PCR kit |
CN109897895A (en) * | 2019-01-11 | 2019-06-18 | 江苏百世诺医疗科技有限公司 | A kind of TaqMan-MGB probe technique detection influences the development of methodology of antihypertensive drugs curative effect gene |
-
2014
- 2014-01-13 CN CN201410014297.7A patent/CN103757109B/en active Active
Non-Patent Citations (4)
Title |
---|
MANUNTA P. ET AL.: "Physiological interaction between alpha-adducin and WNK1-NEDD4L pathways on sodium-related blood pressure regulation", 《HYPERTENSION》 * |
张永莉: "高血压药物基因治疗研究进展", 《中华老年心脑血管病杂志》 * |
沈杰等: "遗传药理学与高血压药物治疗进展", 《中国临床药理学与治疗学》 * |
谢宇等: "抗高血压药的基因组学研究进展", 《中国药房》 * |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105861514A (en) * | 2016-05-27 | 2016-08-17 | 山东省立医院 | New mutant pathogenic gene SLC12A3 of Gitelman syndrome as well as encoded protein and application thereof |
CN105861514B (en) * | 2016-05-27 | 2019-05-21 | 山东省立医院 | The new mutation Disease-causing gene SLC12A3 of Gitelman syndrome and its coding albumen and application |
CN107435076A (en) * | 2017-09-08 | 2017-12-05 | 银川安龙基因科技有限公司 | A kind of hypertension medication genetic test Solid phase PCR kit |
CN109897895A (en) * | 2019-01-11 | 2019-06-18 | 江苏百世诺医疗科技有限公司 | A kind of TaqMan-MGB probe technique detection influences the development of methodology of antihypertensive drugs curative effect gene |
Also Published As
Publication number | Publication date |
---|---|
CN103757109B (en) | 2015-03-25 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN103074436B (en) | Multi-gene detection kit for guiding administration of 5-fluorouracil and detection method of multi-gene detection kit | |
CN103074434B (en) | CYP2C19 gene polymorphyism detection kit and detection method thereof | |
CN104818320B (en) | Primer, probe, detection architecture and the kit of disposable detection lung cancer multiple gene | |
CN103849681B (en) | A kind of Primer composition, multiple gene detection kit and using method thereof instructing medicine of glonoin and health to drink | |
CN108220413B (en) | Fluorescent multiplex amplification kit for combined detection of human Y chromosome STR and Indel loci and application thereof | |
CN105463122B (en) | A kind of MTHFR, MTRR and RFC1 genetic polymorphism detection Primer composition, kit and its application | |
CN105296619A (en) | Kit for SNP typing of obesity-prone genes of Chinese population and using method of kit | |
CN103757091A (en) | Rapid gene detection kit and rapid gene detection method for sudden cardiac death | |
CN103667514A (en) | Kit for detecting polymorphism of interleukin 28B gene by utilizing fluorescence PCR (Polymerase Chain Reaction) technology | |
CN103757109B (en) | Primer composition and multiple-gene detection kit for guiding administration of thiazine diuresis drugs and application method thereof | |
CN103074435B (en) | Kit for synchronously detecting related gene expression levels of 14 antineoplastic drugs and detection method of kit | |
CN103074438B (en) | Multi-gene detection kit for guiding administration of warfarin and detection method of multi-gene detection kit | |
CN104293932A (en) | Method for detecting HLA-B * 5801 allele based on real-time fluorescence PCR | |
CN105238861A (en) | Kit for Chinese pediatric asthma susceptibility gene SNP (single nucleotide polymorphism) genotyping and application method of kit for Chinese pediatric asthma susceptibility gene SNP genotyping | |
CN103540676B (en) | Kit for detecting mutations of A-G at 1555th site and C-T at 1494th site of mitochondrial gene | |
CN107641649B (en) | Primer pair, kit and method for detecting stability of NR27 locus of microsatellite | |
CN103074437B (en) | Multi-gene detection kit for guiding administration of platinum drugs and detection method of multi-gene detection kit | |
CN109777867B (en) | Method for detecting deafness susceptibility gene mutation by combining overlap extension PCR with Sanger sequencing | |
CN103740831B (en) | Primer combination for guiding application of beta-receptor blocker, multi-gene detection kit and using method thereof | |
CN102251046A (en) | Method for detecting tumor mutant gene in blood | |
CN111690736A (en) | Warfarin medication gene detection kit and use method thereof | |
CN108504721A (en) | A kind of novel individualized treatment gene tester | |
CN103525906A (en) | Speed or explosive power relative gene-ACTN3 (Alpha-Actinin 3) polymorphism rapid detection kit and detection method | |
CN114480614B (en) | Primer set and kit for detecting HLA-DQ alpha 1:160D coding genes | |
CN103290118A (en) | Real-time fluorescent PCR (polymerase chain reaction) detection kit for non-deletion type alpha thalassemia |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant |