CN103849681B - A kind of Primer composition, multiple gene detection kit and using method thereof instructing medicine of glonoin and health to drink - Google Patents
A kind of Primer composition, multiple gene detection kit and using method thereof instructing medicine of glonoin and health to drink Download PDFInfo
- Publication number
- CN103849681B CN103849681B CN201410014274.6A CN201410014274A CN103849681B CN 103849681 B CN103849681 B CN 103849681B CN 201410014274 A CN201410014274 A CN 201410014274A CN 103849681 B CN103849681 B CN 103849681B
- Authority
- CN
- China
- Prior art keywords
- pcr
- health
- glonoin
- medicine
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of Primer composition, multiple gene detection kit and the using method thereof that instruct medicine of glonoin and health to drink, comprise ultrapure water, X solution, 10 × PCR damping fluid, PCR primer, 25mM magnesium chloride solution, archaeal dna polymerase and positive reference substance, feature is that PCR primer comprises forward and reverse amplimer of the different genotype in 22 SNP site of drinking on genes involved with medicine of glonoin and health and reacts forward and reverse amplimer of internal reference, and its gene order is as shown in SEQ ID NO.1 ~ NO.8; Its using method comprises collecting sample and extracts the step of nucleic acid; With the nucleic acid extracted for template carries out the step of PCR reaction; The step of last electrocapillary phoresis sample separation, advantage is high specificity, accuracy is high, flux is high, reliability is strong, cost is low, without false negative result.
Description
Technical field
The present invention relates to a kind of multiple gene detection kit and detection method thereof, especially relate to a kind of Primer composition, multiple gene detection kit and the using method thereof that instruct medicine of glonoin and health to drink.
Background technology
Pannonit is nitro vasodilator, is one of special efficacy common drug of control coronary heart disease and angina pectoris.Pannonit and other all can produce active NO free radical in vivo containing nitro medicine (as Sodium Nitroprusside), thus activate the guanylate cyclase of unstriated muscle and its hetero-organization, increase the synthesis of cGMP.CGMP activates the protein kinase that cGMP relies on, and changes the phosphorylation of different albumen in unstriated muscle, makes myosin (myosin) light chain dephosphorylation.The phosphorylation of known myosin light chain is relevant with the contraction schedule maintaining unstriated muscle, and experimental evidence shows that the pharmacology of nitrovasodilators is identical with blood pressure Endothelium derived relaxing factor (EDRF) (having proved NO or the material containing NO) with biochemical action.It is closely related that research finds that ALDH2 gene and pannonit are converted into NO.If but in patient ALDH2 gene, there is Glu504Lys sudden change, the esterase activity of ALDH2 will be affected, pannonit biotransformation is in vivo obstructed, thus can not effective metabolism pannonit, cause nitrogen protoxide to reduce and even cannot produce nitrogen protoxide, medicine is also just difficult to effectively play a role, and long-time irrelievable stenocardia may develop into Acute Myocardial Infarction, causes life danger.The gook of about 1/3rd has ALDH2 gene Glu504Lys and suddenlys change, and can scientifically instruct patient with angina pectoris to select medicine to the diagnosis of ALDH2 gene pleiomorphism.
Meanwhile, ALDH2 is also one of key gene in alcohol metabolism approach.Alcohol enters after in body, first through ethanol dehydrogenase 1B(ADH1B) catalysis, metabolism is acetaldehyde.Acetaldehyde can be converted into acetic acid further under the effect of aldehyde dehydrogenase 2 (ALDH2), and the final metabolism of acetic acid generates CO2 and water, excretes.Acetaldehyde is unstable and easily produce free radical.Acetaldehyde accumulation will cause many tissues and organ such as liver, kidney, the heart, brain grievous injury, and also possibility is carcinogenic, as liver cancer, cancer of the stomach etc.World Health Organization's Agency for Research on Cancer was classified as one-level procarcinogen (at the same level with flavacin) in 2009 alcohol metabolite acetaldehyde.After Glu504Lys sudden change occurs ALDH2 gene, what coding obtained is do not have activated albumen, and converting acetaldehyde is that acetic acid is obstructed, and acetaldehyde can be caused to pile up.After Arg48His sudden change occurs ADH1B gene, ethanol conversion becomes the speed of acetaldehyde to be 40 to 100 times of wild-type, and acetaldehyde can be caused to produce rapidly.Can health of people be scientifically instructed to drink to the diagnosis of ALDH2 and ADH1B gene pleiomorphism.
Existingly be mainly gene chip, quantitative fluorescent PCR and Sanger sequencing for single nucleotide polymorphism (SNP) detection method.
(1) qPCR detection method: adopt fluorescent quenching and two end-labelling, for the specific probe of SNP site variation design.Its advantage be highly sensitive, accuracy is strong.Its shortcoming is that (1) flux is low: the detection being not suitable for many SNP site; Be difficult to arrange internal control gene.(2) cost is higher: probe mark cost is high; If need obtain all related SNP information, need carry out multiple detection experiment, superposition cost costly.
(2) gene chips: gene chip passes through micro-processing technology, by ten hundreds of and even 1,000,000 the DNA fragmentation (gene probe) of particular sequence, arrangement is fixed on the upholder such as silicon chip, slide regularly, the two-dimentional DNA probe array formed, utilize the biological sample of this kind of chip and mark to hybridize, fast qualitative and quantitative analysis can be carried out to the gene expression profile bioinformation of sample.DNA chip: because the advantages such as high-throughput are widely applied in SNP detects, relies on the difference of wild-type and mutated genes hybridization kinetics to detect mutational site.Its advantage is: (1) high-flux parallel detects; (2) fast easy and simple to handle: whole detection only needs 4-8 hour substantially can go out result.Shortcoming: the hybridization kinetics difference 1) between different SNP site is different, when carrying out multidigit point and detect simultaneously, condition is difficult to control; 2) technical costs is expensive, complicated: each sample needs a chip, and cost great Yu $1000/ sample, is unfavorable for large-scale promotion; The synthesis of probe and fixing more complicated, particularly make highdensity probe array, is main rate-limiting step; 3) poor repeatability, accuracy is low, easily occurs false positive false negative result; 4) sensitivity is lower: chip method needs nucleic acid amount comparatively large, generally first must do multiplexed PCR amplification, because primer is more, easily self produces dimer, hairpin structure, or due to Tm value difference, and cause amplification object fragment efficiency different, and then the sensitivity that impact detects; 5) kind due to chip is more, is difficult to the quality control standard that formulation one is unified.
(3) Sanger(dideoxy chain termination) sequencing: Sanger method starts at a certain fixing point according to Nucleotide, stop at some specific base places at random, and after each base, carry out fluorescent mark, a series of Nucleotide of four groups of different lengthss that generation terminates with A, T, C, G, then in urea-denatured PAGE glue, electrophoresis detects, thus obtains visible DNA base sequence.Its advantage is snp analysis gold standard, can find known SNP, also can find unknown SNP.Shortcoming is that each site of each sample all needs through pcr amplification, runs glue, then cuts glue purification, then check order.Step is many and disperse, and cost is higher, and workload is large, and the cycle is long, and it is relatively costly that multiple SNP site detects accumulative price.
Multiple SNP site detection method is based on multiplex PCR and capillary electrophoresis (CE) isolation technique.Adopt multiple PCR method, add in same reaction tubes >=1 pair of specific gene amplimer and reaction internal reference primer simultaneously, size capillary electrophoresis separation according to gene amplification fragment analyzes multiple SNP site and genotype, can fast and effeciently detect multiple SNP site, overcome the defect that traditional method exists, there is following advantage:
1, high-throughput: native system realizes a single reaction detection 30-40 site.
2, accuracy is strong: adopt CE to be separated PCR primer, non-specific amplification product, primer dimer can be separated with specific amplification products, at utmost reduce false positive;
3, susceptibility is high, and result is reproducible: the deviation that the unequal amplification that native system overcomes conventional PCR amplification method causes, and improves and carries out speed and susceptibility qualitatively to a set of goal gene, adopts laser induced fluorescence(LIF)-PMT, has hypersensitivity;
4, method is easy, uses economy: the invention provides from a complete set of experimental programs such as reagent, multiple PCR primer design, interpretations of result; The testing cost Shao Yu $50 of each sample, is beneficial to large-scale promotion;
5, handiness is strong: the target gene that can adjust detection at any time according to demand.
6, easily be automated.
At present, also the test kit of thiazide diuretic medication and the relevant report of using method thereof is not instructed about the multiple SNP detection be separated with CE based on multiplex PCR both at home and abroad.
Summary of the invention
Technical problem to be solved by this invention is to provide a kind of high specificity, accuracy is high, flux is high, reliability is strong, cost is low, without the Primer composition instructing medicine of glonoin and health to drink based on multiple SNP detection system of false negative result.
Technical problem to be solved by this invention is also that providing package contains test kit and the using method thereof of above-mentioned Primer composition.
The present invention solves the problems of the technologies described above adopted technique means: a kind of Primer composition instructing medicine of glonoin and health to drink, comprise forward and reverse amplimer of forward and reverse amplimer of the different genotype in following 22 SNP site of drinking on genes involved with medicine of glonoin and health and react forward and reverse amplimer of internal reference, its nucleotide sequence is as shown in table 1 below:
Table 1
On above-mentioned ALDH2 gene, the reverse amplimer of the G type gene of rs671 fragment and the reverse amplimer of A type gene are nucleic acid sequence SEQ ID NO.3:CGGCAGGTCCTGAACCTCTG; On ADH1B gene, the reverse amplimer of the G type gene of rs1229984 fragment and the reverse amplimer of A type gene are nucleic acid sequence SEQ ID NO.6:ATATTTAGGAATAGTAGGGATTAGTA.
Instruct the multiple gene detection kit that medicine of glonoin and health are drunk, comprise the Primer composition as above described in table 1, PCR reaction solution and positive reference substance; Described PCR reaction solution comprises following component: ultrapure water, X solution, 10 × PCR damping fluid, 25mM magnesium chloride solution, archaeal dna polymerase.
Described X solution is for comprising triphosphate deoxy-nucleotide (dNTPs) and universal primer, and described universal primer forward amplimer sequence is AGGTGACACTATAGAATA, as shown in SEQ ID NO.9; Reverse amplimer sequence is GTACGACTCACTATAGGGA, as shown in SEQ ID NO.10; Described universal primer forward amplimer band fluorescent mark.
Described positive reference substance is that the primer of different genotype in above-mentioned 22 SNP site of drinking on genes involved with medicine of glonoin and health clones gained DNA fragmentation.
The using method of above-mentioned a kind of multiple gene detection kit instructing medicine of glonoin and health to drink, specifically comprises the following steps:
(1) collecting sample extract nucleic acid
Gather the isolated culture of patient's buccal swab or blood sample, from isolated culture, extract nucleic acid;
(2) with the nucleic acid extracted for template carries out PCR reaction
Get DNA sample 2 μ L, the magnesium chloride 3.4 μ L of 10 × PCR damping fluid 2 μ L, 25mM, PCR primer solution 2 μ L, archaeal dna polymerase 0.6 μ L, X solution 2 μ L, ultrapure water 10 μ L joins the reaction of 96 hole sample panel enterprising performing PCR after mixing, reaction conditions: 95 DEG C 2 minutes; 94 DEG C of 30 second, 55 DEG C of 30 second, 70 DEG C 1 minute, circulate 35 times; 70 DEG C 1 minute; 4 DEG C until collect PCR primer; Wherein said X solution is for comprising triphosphate deoxy-nucleotide (dNTPs) and universal primer, and described universal primer forward amplimer sequence is AGGTGACACTATAGAATA, as shown in SEQ ID NO.9; Reverse amplimer sequence is GTACGACTCACTATAGGGA, as shown in SEQ ID NO.10; Described universal primer forward amplimer band fluorescent mark; In PCR primer solution, each PCR primer concentration is 200nM, described PCR primer comprises forward and reverse amplimer of the different genotype in following 22 SNP site of drinking on genes involved with medicine of glonoin and health and reacts forward and reverse amplimer of internal reference, and gene order is as shown in SEQ ID NO.1 ~ NO.8 in sequence table;
(3) electrocapillary phoresis sample separation
Get PCR primer 0.1-1 μ L, sample-loading buffer 38.75 μ L, DNA Marker0.5 μ L, join after one, mineral oil mixes on 96 hole parting liquid plates and carry out electrocapillary phoresis sample separation, collection of illustrative plates and standard diagram that genetic analyzer software obtains are contrasted, acquisition instructs medicine of glonoin and health to drink the allelotype of SNP site of genes involved.
The present invention compared with prior art, it has following beneficial effect: the present invention is the Primer composition instructing medicine of glonoin and health to drink, multiple gene detection kit and using method thereof, Primer composition of the present invention, multiple gene detection kit and using method are based on multiplex PCR and electrocapillary phoresis technology, utilize the PCR specific amplification fragment of different lengths to identify and distinguish different genes, found the detection scheme of the different genotype in two SNP site of a kind of synchronous detection ALDH2 and ADH1B two genes, drink to instruct medicine of glonoin and health, present method optimizes multi-PRC reaction system, specific amplification is carried out to DNA sample to be measured, pcr amplification product is separated to differentiate different genes and genotype again by electrocapillary phoresis method, the detection of 192 Patient Sample A can be completed within one sky, both production cost and testing cost had been saved, turn improve detection efficiency and shorten the time, the use of reaction internal reference can be used for the efficiency of monitoring whole reactive system, PCR reaction, avoids false negative.
Different genotype in 2 SNP site (2 SNP site are respectively rs671 and rs1229984) that mentioned reagent box can synchronously be drunk on genes involved to 2 and medicine of glonoin and health detects, the PCR specific amplification fragment of different lengths is utilized to identify the allelotype distinguishing SNP site, to instruct medicine of glonoin and health to drink, specifically as shown in table 2:
Table 2 medicine of glonoin and health drink multiple gene detect detect target site
In sum, the present invention is based on the Primer composition instructing medicine of glonoin and health to drink of multiplex PCR-CE, multiple gene detection kit and using method thereof, different genotype in 2 SNP site of synchronously drinking on genes involved to 2 and medicine of glonoin and health detects, detection sensitivity is high, specificity is good, reduce the false positive rate of standard PCR amplification, effectively can also solve the easy pollution problem of Standard PCR; There is Noncompetitive internal comparison system, reliability is strong, without false negative result, the method of the present invention's application multiplex PCR and electrocapillary phoresis, there is the technical superioritys such as flux is large, accuracy is high, sensitivity is good, the polymorphism of all genes involveds in sample can be detected with single reaction rapidly and accurately, be the clinical molecular diagnosis method that a kind of superior low cost is provided, contribute to instructing medicine of glonoin and health to drink.
Accompanying drawing explanation
Fig. 1, be the multiple gene detection kit electrocapillary phoresis sample separation result that a human DNA samples uses medicine of glonoin and health to drink.
Embodiment
In order to understand content of the present invention better, be described further below in conjunction with specific embodiments and the drawings.Should be understood that these embodiments only for the present invention is further described, and be not used in and limit the scope of the invention.In addition should be understood that, after having read content of the present invention, person skilled in art makes some nonessential change or adjustment to the present invention, still belongs to protection scope of the present invention.
Embodiment 1
A kind of multiple gene detection kit instructing medicine of glonoin and health to drink of the present invention, blood samples of patients or mouth swab sample extraction nucleic acid is gathered during use, with patient's nucleic acid for template enters PCR reaction, final by electrocapillary phoresis method sample separation, concrete steps are as follows:
1, operation instruction medicine of glonoin and the health multiple gene detection kit of drinking, the component that test kit comprises:
1) PCR primer (PCR Primer Mix):
2) 25mM magnesium chloride (MgCl
2)
3) archaeal dna polymerase (Taq DNA Polymerase)
4) X solution (Solution X)
5) PCR damping fluid (PCR Buffer)
6) positive control (Positive Control)
7) ultrapure water (ddH
2o)
Above-mentioned PCR primer comprise following 2 with forward and reverse amplimer of the different genotype in 2 SNP site instructing medicine of glonoin and health to drink on genes involved and the forward and reverse amplimer reacting internal reference, its nucleotide sequence is as table 1(or see sequence table SEQ ID NO.1 ~ 8) shown in.
Wherein, described X solution is for comprising triphosphate deoxy-nucleotide (dNTPs) and universal primer, and described universal primer forward amplimer sequence is AGGTGACACTATAGAATA, as shown in SEQ ID NO.9; Reverse amplimer sequence is GTACGACTCACTATAGGGA, as shown in SEQ ID NO.10; Described universal primer forward amplimer band fluorescent mark.
2, collecting sample extract nucleic acid
Gather human oral swab or blood sample and extract nucleic acid.
3, with the patient's nucleic acid extracted for template carries out PCR reaction
1) on 96 hole sample panel/eight connecting legs, add reagent and sample (PCR plate is in table 3) in following ratio, and a positive control reaction be set:
Table 3PCR reaction reagent and sample mix ratio
| PCR reaction reagent | Amount/hole |
| ddH 2O | 8 |
| 25mM MgCl 2 | 3.4 |
| 10 × PCR damping fluid | 2 |
| PCR primer solution | 2 |
| X solution | 2 |
| DNA sample | 2 |
| Archaeal dna polymerase | 0.6 |
| Total | 20μL |
Note: positive reference substance is that the primer of different genotype in 2 SNP site that in above-described embodiment 1,2 are drunk on genes involved with medicine of glonoin and health clones gained DNA fragmentation.
2) thermal cycle reaction (see table 4) is carried out by following temperature after mixing:
Table 4PCR reaction conditions
| Step | Temperature | Time |
| 1 | 95℃ | 2 minutes |
| 2 | 94℃ | 30 seconds |
| 3 | 55℃ | 30 seconds |
| 4 | 70℃ | 1 minute |
| 5 | N/A | Repeat 2-4 step 34 time (totally 35 times) |
| 6 | 70℃ | 1 minute |
| 7 | 4℃ | Continue: until collect PCR primer |
4, electrocapillary phoresis sample separation
1) CE sample (see table 5) is prepared:
Table 5CE sample mix ratio
| Title | Amount/hole |
| Sample-loading buffer | 38.75μL |
| DNA size criteria 400 | 0.5μL |
| PCR primer | 0.1-1μL |
| Mineral oil | 1 |
2) electrocapillary phoresis sample separation
PCR primer is added in the hole of proper number on 96 hole capillary electrophoresis separation plates; Capillary electrophoresis separation is a class is split tunnel with kapillary, take high-voltage dc as the Novel liquid-phase isolation technique of motivating force, specific procedure is 90 DEG C of sex change 120 seconds, sample introduction voltage 2kv, 30 seconds, separation voltage 6kv, 35 minutes.
5, interpretation of result
The CE analyzing this test kit detects data, and the position occurred according to each characteristic peak and quantity, determine genotype.For ALDH2 gene: only occur ALDH2_G(CE fragment length 199nt) time, result is ALDH2G homozygote; Only there is ALDH2_A(CE fragment length 204nt) time, result is ALDH2A homozygote; ALDH2_G peak and ALDH2_A peak occur simultaneously, and result is ALDH2 heterozygote.The result decision method of ADH1B gene is identical with ALDH2 gene.
The CE fragment length of the gene locus that this test kit of table 6. detects, reaction internal reference
Note: ALDH2 and ADH1B in table 6, Fig. 1 is the gene locus detected, pcDNA is reaction internal reference.
Fig. 1 is the multiple gene detection kit electrocapillary phoresis sample separation result that a human DNA samples uses medicine of glonoin and health to drink.Altogether occur 5 characteristic peak: ALDH2G(199nt), ALDH2A(204nt), ADH1B G(220nt), ADH1B A(225nt), pcDNA(166nt).Analytical results: ALDH2G(199nt), ALDH2A(204nt) occur simultaneously, illustrate that ALDH2 is heterozygote; ADH1B G(220nt), ADH1B A(225nt) occur simultaneously, illustrate that ADH1B is heterozygote; PcDNA is reaction internal reference, illustrates that PCR reacts successfully.This Fig. 1 also can as standard diagram, and when measuring other sample genotype, the collection of illustrative plates obtained by genetic analyzer software contrasts with this standard diagram, and acquisition instructs medicine of glonoin and health to drink the allelotype of SNP site of genes involved.
Embodiment 2
Detection reagent specificity analyses: substance pcr amplification is detected as the unimodal of target fragment size through capillary electrophoresis.
Above-mentioned explanation is not limitation of the present invention, and the present invention is also not limited to above-mentioned citing.Those skilled in the art are in essential scope of the present invention, and the change made, remodeling, interpolation or replacement, also should belong to protection scope of the present invention.
Claims (3)
1. the Primer composition instructing medicine of glonoin and health to drink, it is characterized in that, comprise forward and reverse amplimer of the different genotype in following 22 SNP site of drinking on genes involved with medicine of glonoin and health and react forward and reverse amplimer of internal reference, its nucleotide sequence is as follows:
2. instruct the multiple gene detection kit that medicine of glonoin and health are drunk, it is characterized in that, comprise Primer composition as claimed in claim 1, PCR reaction solution and positive reference substance; Described PCR reaction solution comprises following component: ultrapure water, X solution, 10 × PCR damping fluid, 25mM magnesium chloride solution, archaeal dna polymerase, and the using method of described test kit is:
(1) collecting sample extract nucleic acid
Gather the isolated culture of patient's buccal swab or blood sample, from isolated culture, extract nucleic acid;
(2) with the nucleic acid extracted for template carries out PCR reaction
Get DNA sample 2 μ L, the magnesium chloride 3.4 μ L of 10 × PCR damping fluid 2 μ L, 25mM, PCR primer solution 2 μ L, archaeal dna polymerase 0.6 μ L, X solution 2 μ L, ultrapure water 10 μ L joins the reaction of 96 hole sample panel enterprising performing PCR after mixing, reaction conditions: 95 DEG C 2 minutes; 94 DEG C of 30 second, 55 DEG C of 30 second, 70 DEG C 1 minute, circulate 35 times; 70 DEG C 1 minute; 4 DEG C until collect PCR primer; Wherein said X solution is for comprising triphosphate deoxy-nucleotide (dNTPs) and universal primer, and described universal primer forward amplimer sequence is AGGTGACACTATAGAATA, as shown in SEQ ID NO.9; Reverse amplimer sequence is GTACGACTCACTATAGGGA, as shown in SEQ ID NO.10; Described universal primer forward amplimer band fluorescent mark; In PCR primer solution, each PCR primer concentration is 200nM, described PCR primer comprises forward and reverse amplimer of the different genotype in following 22 SNP site of drinking on genes involved with medicine of glonoin and health and reacts forward and reverse amplimer of internal reference, and gene order is as shown in SEQ ID NO.1 ~ NO.8 in sequence table;
(3) electrocapillary phoresis sample separation
Get PCR primer 0.1-1 μ L, sample-loading buffer 38.75 μ L, DNA Marker 0.5 μ L, join after one, mineral oil mixes on 96 hole parting liquid plates and carry out electrocapillary phoresis sample separation, collection of illustrative plates and standard diagram that genetic analyzer software obtains are contrasted, acquisition instructs medicine of glonoin and health to drink the allelotype of SNP site of genes involved.
3. a kind of multiple gene detection kit instructing medicine of glonoin and health to drink according to claim 2, is characterized in that: described positive reference substance is that the primer of different genotype in above-mentioned 22 SNP site of drinking on genes involved with medicine of glonoin and health clones gained DNA fragmentation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410014274.6A CN103849681B (en) | 2014-01-13 | 2014-01-13 | A kind of Primer composition, multiple gene detection kit and using method thereof instructing medicine of glonoin and health to drink |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410014274.6A CN103849681B (en) | 2014-01-13 | 2014-01-13 | A kind of Primer composition, multiple gene detection kit and using method thereof instructing medicine of glonoin and health to drink |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103849681A CN103849681A (en) | 2014-06-11 |
| CN103849681B true CN103849681B (en) | 2015-09-16 |
Family
ID=50857802
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410014274.6A Active CN103849681B (en) | 2014-01-13 | 2014-01-13 | A kind of Primer composition, multiple gene detection kit and using method thereof instructing medicine of glonoin and health to drink |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103849681B (en) |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105803052A (en) * | 2014-12-31 | 2016-07-27 | 天津华大基因科技有限公司 | Method and kit for detecting ethanol resistance gene |
| CN104878119A (en) * | 2015-06-26 | 2015-09-02 | 上海美吉生物医药科技有限公司 | Human ALDH 2 gene detection kit |
| CN105524987A (en) * | 2015-12-30 | 2016-04-27 | 广州金域检测科技股份有限公司 | Primers and method for simultaneously detecting ALDH2 gen *2 polymorphism and ADH1B gene *2 polymorphism |
| CN106987623B (en) * | 2017-03-20 | 2021-01-26 | 杭州迪安医学检验中心有限公司 | Primer for detecting alcohol metabolism gene by pyrosequencing combined sequencing method and application thereof |
| CN107058549B (en) * | 2017-05-02 | 2020-11-20 | 天津市康婷生物工程集团有限公司 | Gene detection kit for alcohol capacity assessment |
| CN107267652A (en) * | 2017-08-11 | 2017-10-20 | 踏石生物科技（苏州）有限公司 | Using the site GG types of people ADH2*2 genes 143 as the positive reference product of template |
| CN107326086A (en) * | 2017-08-11 | 2017-11-07 | 踏石生物科技（苏州）有限公司 | A kind of ADH2*2 genotype detections kit and its detection method |
| CN107267651A (en) * | 2017-08-11 | 2017-10-20 | 踏石生物科技（苏州）有限公司 | Using the site AA types of people ADH2*2 genes 143 as the positive reference product of template |
| CN108977530A (en) * | 2018-08-17 | 2018-12-11 | 青岛大学 | For detecting primer sets, reagent, kit and the detection method and application of aldehyde dehydrogenase 2 Genotyping |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102549171A (en) * | 2009-10-07 | 2012-07-04 | 学校法人武库川学院 | Genotype determination method |
| CN103074436A (en) * | 2013-01-25 | 2013-05-01 | 海尔施生物医药股份有限公司 | Multi-gene detection kit for guiding administration of 5-fluorouracil and detection method of multi-gene detection kit |
-
2014
- 2014-01-13 CN CN201410014274.6A patent/CN103849681B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102549171A (en) * | 2009-10-07 | 2012-07-04 | 学校法人武库川学院 | Genotype determination method |
| CN103074436A (en) * | 2013-01-25 | 2013-05-01 | 海尔施生物医药股份有限公司 | Multi-gene detection kit for guiding administration of 5-fluorouracil and detection method of multi-gene detection kit |
Non-Patent Citations (1)
| Title |
|---|
| Polymorphisms in Alcohol Metabolism Genes ADH1B and ALDH2, Alcohol Consumption and Coloretal Cancer;Marta Crous-Bou等;《Plos One》;20131125;第8卷(第11期);1-8 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103849681A (en) | 2014-06-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103849681B (en) | A kind of Primer composition, multiple gene detection kit and using method thereof instructing medicine of glonoin and health to drink | |
| CN103074434B (en) | CYP2C19 gene polymorphyism detection kit and detection method thereof | |
| CN103074436B (en) | Multi-gene detection kit for guiding administration of 5-fluorouracil and detection method of multi-gene detection kit | |
| JP6320041B2 (en) | Methods, kits and compositions for detection of MRSA | |
| CN108251510A (en) | A kind of kit, detection method and its application of folic acid metabolism ability Genotyping | |
| CN105525010B (en) | A kind of loop-stem structure combination probe and its application | |
| CN105463122A (en) | MTHFR, MTRR and RFC1 gene polymorphism detection primer combination and kit and application of MTHFR, MTRR and RFC1 gene polymorphism detection kit | |
| CN111088329B (en) | Fluorescence composite amplification system, kit and application thereof | |
| CN108411008A (en) | The application of 72 SNP sites and relevant primer in identifying or assisting identification human groups | |
| CN103045717B (en) | Pyrosequencing techniques detects the method for mycobacterium tuberculosis detection of rifampin resistant | |
| CN103074435B (en) | Kit for synchronously detecting related gene expression levels of 14 antineoplastic drugs and detection method of kit | |
| CN103757109B (en) | Primer composition and multiple-gene detection kit for guiding administration of thiazine diuresis drugs and application method thereof | |
| CN105624315A (en) | Primers and reagent kit for detecting polymorphism of ALDH2 gene c.1510 locus | |
| CN103045716B (en) | Method for detecting isoniazid drug resistance of mycobacterium tuberculosis by using pyrosequencing technology | |
| CN103740831B (en) | Primer combination for guiding application of beta-receptor blocker, multi-gene detection kit and using method thereof | |
| US20100112563A1 (en) | Multiplex analysis of nucleic acids | |
| Lin et al. | Detection of BCR–ABL using one step reverse transcriptase-polymerase chain reaction and microchip electrophoresis | |
| CN106319079A (en) | Method for detecting 22q11.2 copy number deletion | |
| CN103074437B (en) | Multi-gene detection kit for guiding administration of platinum drugs and detection method of multi-gene detection kit | |
| CN104946735A (en) | Kit and method for determining genotype of predetermined SNP site of DNA sample to be tested | |
| CN108517364A (en) | Forensic medicine composite detection kit based on 56 Y chromosome SNP genetic markers | |
| CN103305600B (en) | Kit for synchronously detecting related gene expression level of 14 antitumor drugs by using paraffin embedding biopsy sample, and detection method thereof | |
| CN103725775A (en) | Method for fast detecting BRAF gene mutation with allele RNA (ribonucleic acid) isothermal amplification method | |
| CN102676661B (en) | Fluorescent polarization based homogeneous phase detection method of single nucleotide polymorphism of codon118 of ERCC1 (excision repair cross-complementing 1) gene | |
| CN110079596A (en) | A kind of multiple gene detection kit and its application method for antimanic agents medication guide |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CP01 | Change in the name or title of a patent holder |
Address after: No.396, Mingzhu Road, science and Technology Park, Ningbo City, Zhejiang Province Patentee after: Ningbo Haier Shi Gene Technology Co.,Ltd. Address before: No.396, Mingzhu Road, science and Technology Park, Ningbo City, Zhejiang Province Patentee before: Ningbo Health Gene Technologies Co.,Ltd. |
|
| CP01 | Change in the name or title of a patent holder |