CN103725775A - Method for fast detecting BRAF gene mutation with allele RNA (ribonucleic acid) isothermal amplification method - Google Patents

Abstract

A method for fast detecting BRAF gene mutation with an allele RNA (ribonucleic acid) isothermal amplification method comprises the following steps: cell lysis treatment is performed; RNA reverse transcription treatment is performed; cDNA (complementary deoxyribonucleic acid) is generated and serves as an RNA amplification template; and RNA amplicon is quantified through regular monitoring for a fluorescence signal. According to the method, an isothermal reaction method is adopted for fixed-point specific detection of a V600E mutation site of the BRAF, the detection is performed at the isothermal temperature of 41 DEG C, test conditions are mild, chemical compounds for reaction are common, the operation is simple, the specificity is high, and only an instrument capable of detecting a fluorescent probe is required. A higher amplification coefficient is provided, a billion RNAs which are complementary with the target RNA are produced with two specific primers aiming at targeted RNA as well as three enzymes in 1.5 hours, and BRAF mutation information with as low as 0.1% of content is read through detection of the fluorescent probe and used for targeted drug use instruction for a tumor patient.

Description

A kind of method that adopts allelotrope RNA isothermal duplication method to carry out rapid detection BRAF transgenation

Technical field

The present invention relates to a kind of detection method of transgenation, specifically a kind of method that adopts allelotrope RNA isothermal duplication method to carry out rapid detection BRAF transgenation.

Background technology

BRAF gene is by Ikawa etc., first in mankind's ewing's sarcoma, to find and clone confirmation in 1988, is an energy rotaring copolymering NIH 3 T 3 cell and activated DNA sequence dna, because itself and CRAF and ARAF have quite high homology, therefore be called BRAF.The BRAF albumen of BRAF oncogene coding is protein kinase/extracellular signal-regulated kinase (MAPK/ERK) pathway protein of mitogen activation, it is the most efficient phosphoric acid agent in mapk kinase family, in apoptosis and breeding, play an important role, be positioned at MAPK path ingress, it is connected with ERK the acceptor of cell surface by MEK with RAS albumen with the transcription factor in core, regulate growth, the growth of cell.Recently research finds there is BRAF transgenation in many malignant tumours of the mankind, and BRAF is serving as key player as molecule marker in the developing of kinds of tumors.The scientist Davies of Britain's Oncogenome plan etc. carries out examination to coming from the genomic dna of 530 different tumor cell lines, and result confirms have 43 strain cells that BRAF transgenation has occurred.Investigation demonstration, the BRAF mutant in the malignant tumour Yu Gai families such as nearly 65% colorectal cancer, ovarian cancer is relevant.After BRAF sudden change, persistence activates MAPK path, and mitotic division ability is strengthened, and causes abnormal cell proliferation and differentiation.

RAF protein family contains three member: aRAF, bRAF, cRAF, they are conservative specificity protein serine/threonine of a class of expressing at extracellular matrix, participated in extracellular signal-regulated kinase (Extracellular Regulated Kinase, ERK) and the signal cascade pathway of mitogen activated protein kinase (Mitogen-Activated Protein Kinase, MAPK).The downstream of RAF zymogenesis and RAS, its function is phosphorylation and activates MAPK/ERK kinase activity (MEK).By activating or suppressing Ras-Raf-MAPK/ERK signal path, can regulate and control due to somatomedin, cytokine and hormone-mediated cell proliferation and cell survival.Therefore, to the unsuitable activation of this path and/or lasting activation, can cause abnormal cytodifferentiation, proliferation and apoptosis, and can lead oncogenic generation.

People, by BRAF being checked order in a large amount of different malignant tumor tissues, identify the sudden change of 30 above single-point disappearance meanings, and major part all occur in kinases region.In malignant melanoma and thyroid papillary carcinoma, have 50% to contain bRAF sudden change, in low potential malignancy ovarian cancer, have 30%, in colorectal carcinoma, there is 15%, BRAF sudden change to be also present in (http://www.sanger.ac.uk/genetics/CGP/cosmic/) in more cancer.And wherein 90% BRAF sudden change is all 600 phenomenons (V600E) that exist α-amino-isovaleric acid to be substituted by L-glutamic acid, such sudden change has activated BRAF kinases, and has caused that cell proliferation out of control and cancer occur.

After having it is found that this point, just start research and development and produce the medicine that some can suppress BRAF sudden change, and in application, obtained important achievement clinically, such as Wei Luofeini sheet (vemurafenib), can play extraordinary effect to the patient of those tumours expression proto-oncogenes BRAF.On the other hand, before the anti-BRAF medicine of clinical use, carrying out the genotypic evaluation of BRAF in tumor tissues is a very important thing.The gold standard of the sudden change of patient BRAF gene is detected to the collection that comprises tumor tissues sample, the order-checking of Sanger method or specific primer PCR method.

The research of transgenation has become one of focus of current life science, and detection method also develops rapidly thereupon.Before 1985, utilize Southern blotting, can filter out the mutant forms such as disappearance, insertion and frameshit restructuring of gene.But this method has certain limitation, more often can relate to more complicated, time-consuming determined dna sequence analytical method.Polymerase chain reaction,PCR (polymerase chain reaction, PCR) technology is the major progress in mutation research, make detection in Gene Mutation technology have significant progress, the molecular diagnostic techniques of at present nearly all detection in Gene Mutation is all to build on the basis of PCR, and the novel method being derived by PCR constantly occurs, has reached at present more than 20 and has planted, and level of automation is also more and more high, greatly shorten analysis time, and precision of analysis also has very greatly very raising.Comprising single strand conformation polymorphism (single-strand comformational polymorphism, SSCP) and Heteroduplex analysis (heteroduplex analysis, HA).Below several PCR deriving technologies and classical sudden change detection method.

1, PCR-SSCP method:

PCR-SSCP method is on non-this property polyacrylamide gel, and short single stranded DNA is different with RNA molecule Yi Qi street basic sequence and form not isomorphic map, and the change of a base will affect its conformation and causes its translational speed on gel to change.Its ultimate principle is that single stranded DNA can form secondary structure under neutrallty condition, and this secondary structure depends on its based composition, though the difference of a base, also can form different secondary structures and go out thorn with mobility.Because this method is simple and quick, thereby be widely used in the detection that unknown gene suddenlys change.While being less than the PCR product of 200bp with the detection of PCR-SSCP method, sudden change recall rate can reach 70%-95%, and when fragment is greater than 400bp, recall rate is only 50% left and right, and this method may exist 1% false positive rate.Application PCR-SSCP method should be noted the top condition of electrophoresis, and general mutation type is on the sensitivity detecting without large impact, and this method can not be measured the accurate site of sudden change simultaneously, also needs to determine by sequential analysis.Sarkar etc. think for the fragment that is greater than 200bp, be SSCP can improve its sensitivity with its RNA molecule.The sudden change of application PCR-SSCP check point has been shown in and has been reported in the most tumor tissues of the mankind or cell, as mammary cancer, the esophageal carcinoma, lung cancer, cancer of the stomach, liver cancer, carcinoma of the pancreas etc.The gene detecting comprises multiple oncogene and cancer suppressor gene, is also to detect the most frequently used method of mutation of p 53 tumor suppressor gene, only detects 5-8 exon and can find more than 85% p53 transgenation.Because this method is easy fast, be particularly suitable for the screening operation of large tissue samples transgenation research.

2, Heteroduplex analysis (HA):

HA method is the saltant type one wild-type DNA double chain of separated hybridization on denaturant gel directly.The allos heteroduplex DNA forming due to sudden change and wild-type DNA can form a projection in its mispairing place, in native gel, during electrophoresis, can produce the mobility different from corresponding homology couple DNA.This method is similar to SSCP, difference be SSCP separation be single stranded DNA, the separation of HA method be double-stranded DNA, be also only suitable for the analysis in small segment.But the sudden change that HA can not detect with SSCP some has complementary action, and both are combined with, the recall rate that can make to suddenly change brings up to nearly 100%.

3, Mutant-enriched PCR (mutant-enriched PCR):

The ultimate principle of this law is to utilize certain codon position of ras gene family to have known restriction endonuclease sites, and as the BstN I site of K-ras gene the 12nd codon, the 13rd codon has Bgl II site.With the nest-type PRC of the continuous secondary of chain, increase and comprise the DNA fragmentation of K-ras the 12nd, 13 codons, between twice amplified reaction with the DNA fragmentation of corresponding restriction endonuclease digest amplification, wild-type can not enter pcr amplification for the second time because of digested, and saltant type can completely enter pcr amplification for the second time and obtain the enrichment of product.

4, denaturing gradient gel electrophoresis (denaturing gradient electrophoresis, DGGE):

DGGE method is analyzed PCR product, if sudden change occurs in the DNA region of unwinding at first, recall rate can reach 100%, detects fragment and can reach 1kb, and the suitableeest scope is 100bp-500bp.Ultimate principle when proceeding to the gel location consistent with DNA sex change humidity in denaturing gradient gel when double-stranded DNA, DNA generating unit is divided and is unwind, electrophoretic mobility declines, while having a sequence change in the DNA chain unwinding, can unwind in the different time, separated because affecting the journey of electrophoretic velocity variation.Because this law is to utilize temperature and gradient gel mobility to detect, need the electrophoresis apparatus of a set of special use, synthetic PCR primer is preferably in the GC folder that 5` end adds one section of 40bp-50bp, is beneficial to detect the sudden change that betides high-melting-point district.On the basis of DGGE, developed again the TGGE method (temperature gradient gel elec-trophoresis (TGGE) temperature gradient gel electrophoresis, TGGE) that replaces chemical denaturant by moisture gradient.DGGE and TGGE all have commercial electrophoresis apparatus, and this method is once foundation, operate also easylier, are suitable for the detection screening of large tissue samples.

5, chemical chop mispairing method (chemical cleavage ofmismatch, CCM):

The technology that detect sudden change of CCM for developing on the basis of Maxam-Gilbert sequencing, its accuracy that detects sudden change can be similar with DNA sequencing.Its ultimate principle is hybridized for will be to be measured mixing sex change containing DNA fragmentation and corresponding wild-type DNA fragmentation or DNA and RNA fragment, in the double chain acid molecule of allos heterozygosis, the C of mispairing can be cut by azanol or piperidines, the T of mispairing can be cut by perosmic anhydride, through denaturing gel electrophoresis, can determine whether to exist sudden change.This method recall rate is very high, is also inspection fragment the longest method, and existing reporting achievement detected 1.7kb fragment, if aligned, antisense strand analyzes simultaneously, recall rate can reach 100%.Application fluorescence detecting system can strengthen susceptibility, 1 mutant cell in 10 cells can be detected.Chemical reagent in this method is poisonous, has developed again carbodiimide detection method (catodiimide, CDI), and CDI is non-toxic substance, also can detect the point mutation of large fragment DNA.

6, allele specific oligonucleotide analytical method (allele-specific oligonucleotide, ASO):

ASO a kind ofly be take hybridization as the detection technique of basis to known mutations.With PCR and ASO, combine, design the oligonucleotide fragment of one section of 20bp left and right, wherein comprised the position of undergoing mutation, as probe, with the hybridization of the sample DNA through pcr amplification being fixed on film.Can be with the oligonucleotide probe of various mutation types, take wild-type probe as contrast simultaneously, as there is positive hybrid belt, and being illustrated in sample and existing and the corresponding point mutation of this ASO probe, ASO needs strict control hybridization conditions and standard control is set to avoid false positive and false negative.At present existing commercial detection box test section oncogene ASO sudden change.

7, DNA chip technology (DNA chip):

DNA chip technology is the DNA analysis new technology developing after the nineties, and it has gathered the modern techniquies such as IC computer, laser confocal scanning, fluorescence labeling probe and DNA synthesize.Can be used for the structure of the assignment of genes gene mapping, DNA sequencing, physical map and genetic map etc.Aspect detection in Gene Mutation, DNA chip also holds out broad prospects, its ultimate principle is for to be arranged in the oligonucleotide DNA of many known arrays on 1 surface-mounted integrated circuit, overlapping 1 base each other, and cover the gene of whole required detections, by fluorescently-labeled normal DNA and mutant DNA respectively with 2 DNA chip hybridizations, owing at least there being the difference of 1 base, DNA normal and sudden change will obtain different hybridization collection of illustrative plates, through copolymerization collection microscope, detect respectively the fluorescent signal that two kinds of DNA moleculars produce, can determine whether to exist sudden change, the method is simple fast, level of automation is high, there is very large development potentiality, to bring into play at detection in Gene Mutation center very important effect.

8, ligase chain reaction (ligase chain reaction, LCR):

With other nucleic acid amplification technologies comparisons, its maximum feature be for can accurately distinguishing in gene order individual gene sudden change, by Landegree in first Application in 1988 in the molecular diagnosis of sickle-cell anaemia.LCR is connected to basis with DNA ligase by the 5`-phosphoric acid of a certain DNA chain and another adjacent chain 3`-hydroxyl, apply two pairs of complementary primers, double-stranded DNA is after heat denatured, the two pairs of primers respectively with template renaturation, if complete complementary,, under the effect of ligase enzyme, makes the 5`-phosphoric acid of adjacent two primers form phosphodiester bond with 3`-hydroxyl and be connected, previous connection product, again as the template of circulating reaction next time, if the base of pairing exists sudden change, can not connect and increase.It is that after denaturing gel electrophoresis separation, radioautograph is identified by this 32p mark upstream primer 3` end at first that LCR product detects, and its detection sensitivity reaches 200 target molecules.Also can design 1 across the detection probes of two primers, with it and LCR product, carry out hybridization check.In recent years there are the non-isotope labeling methods such as application fluorescein, digoxin.Batt has developed a kind of more succinct method, microwell plate sandwich hybridization in 1994.Due to quick, the special and responsive characteristic of LCR, and the ability that can detect single base mutation, be therefore applied to the molecular diagnosis of oncogene sudden change, and be combined to improve its susceptibility with PCR.

9, allele specific amplification method (Allele-specific amplification, ASA):

ASA set up in 1989, it is the development of round pcr application, also claim amplification refractory mutation system (amplification refractory mutation system, ARMS), allelotrope characteristic PCR (allele-specific PCR, ASPCR) etc., for known mutations gene is detected.This method is by two 5` end primers of design, one complementary with normal DNA, and one complementary with mutant DNA, for homozygosity, suddenlys change, add respectively these two kinds of primers and 3` end primer to carry out two parallel PCR, only have with the primer of the complete complementation of mutant DNA just extensible and obtain pcr amplification product.If mispairing is positioned at the 3` end of primer, cause PCR not extend, be called ARMS.ARMS and ASPCR use for reference multiplex PCR principle, can in same system, detect two or more allelic mutation sites simultaneously.The recall rate of ASA method depends on optimization and contingent primer and the wrong timing mispairing extension of target DNA of reaction conditions, particularly when base mismatch is G:T, at this moment can be by regulation experiment condition as primer target DNA, the concentration of Taq archaeal dna polymerase etc. obtains higher specificity.In reaction system, add methane amide also can reduce non-specific amplification.Also can introduce a base mismatch by second base at primer 3` end, make it and template between form dual mispairing to stop mistake to be extended.

10, RNaseA patterning method (RNase A cleavage):

Under certain condition, the base mismatch in amino source double chain acid molecule RNA:RNA or RNA:DNA can be cut by RNaseA, and cleaved products can be separated by denaturing gel electrophoresis.When on rna probe, the base of mispairing is purine, RNaseA is very low at the cutting efficiency of mispairing place, not even cutting, and when base mismatch is pyrimidine, its cutting efficiency is higher.If therefore only analyze a bar chain of tested DNA, sudden change recall rate only has 30%, as time analyze justice and two chains of antisense, recall rate can reach 70%.This method need to be prepared rna probe, has increased the complicacy of operation, but the large fragment that can be used for 1-2kb detects, and can determine mutational site.Between the existence of these superiority, it is still used as a kind of classical way for unknown mutation is analyzed.

11, Chromosomal in situ hybridization (In situ hybridization of chronosome):

Karyomit(e) finds that, apart from the history of modern existing more than 150 year, karyomit(e) detects the cytogenetical study that is widely used in animal and plant and the mankind, the development that divides technology and Protocols in Molecular Biology along with karyomit(e).Chromosome research scope also constantly expands, especially for tumour molecular diagnosis.It is very general phenomenon that the karyomit(e) of tumour cell changes, and can be divided into former and secondary two classes.Aspect swollen neoplastic Basic of Biology, idiopathic karyomit(e) changes relevant with the immediate cause that causes tumour, in tumour cell, can find various forms of chromosome aberrations, as disappearance, repetition, transposition, rearrangement, monomer fracture and endoreduplication etc.; It is mainly the change of tumour cell caryogram that Secondary cases changes.Chromosomal detection is for the aspects such as the diagnosis of tumour, differential diagnosis, biological behaviour differentiation significance all.Chromosomal detection method makes much progress, and the accurate rate of detection also improves constantly, here article fluorescence in situ hybridization and PRINS method.

12, fluorescence in situ hybridization technique (fluorescent in situ hybridization, FISH):

Be created in 1986.First Gall in 1969 and Pardue apply isotope labeling Nucleotide and prepare probe, by radioautograph, detect hybridization signal.Apply single copy target nucleotide sequences that its susceptibility of isotopically labeled probe can detect hundreds of base on Metaphase Chromosome, though susceptibility is high, locate accurate not.FISH has that probe is stable, operational safety, can be fast, the advantages such as hybridization signal of a plurality of different probes of multicolor displaying.The sensitive sense of FISH is relevant with detecting instrument performance with probe mark method, and the modified nucleotide ratio of mixing during probe mark directly affects hybridization signal intensity.FISH probe generally adopts random priming or otch translation method, as round pcr introduced to FISH probe mark, can make its sensitivity bring up to 0.25kb.Application slow sweep CCD coordinates image processing software, strengthen signal to noise ratio, be conducive to detect feeble signal, as application TSA system ((Tyramide Signal Amplification, TSA) hybridization signal can be amplified to 1000 times again, can be used for the location of single copy gene.FISH resolving power is approximately 1-3Mb, if application strong denaturant is processed karyomit(e), allows DNA molecular separate from protein, and make two DNA full extension and stick on slide, after treatment, resolution 1-2kb.Also can adopt to metaphase karyomit(e) carry out micro-dissection (microdissect) method to improve resolving power.Another feature of FISH is to combine the multiple Mk systems such as celebrating digoxin, vitamin H, once in hybridization, can detect position and mutual relationship between probe, i.e. polychrome FISH or the many target FISH of multiple probe on karyomit(e).FISH technology has been widely used in the detection of gene amplification, translocation rearrangement and disappearance etc. in tumor research, all significant at aspects such as diagnosing tumor and differential diagnosis, prognosis and treatment monitoring.

13, Klch equals to have invented for 1989 Oligonucleolide primers original position DNA synthetic technology on karyomit(e) (oligonucleotide primed in situ DNA synthesis, PRINS), and is successfully used to the special satellite DNA Label of karyomit(e).Its ultimate principle is to hybridize specifically with target sequence on cold Oligonucleolide primers homologous chromosomes, under archaeal dna polymerase effect, when primer extension, mixes the core of mark and removes from office acid certification mark site directly or indirectly.The advantage of PRINS technology is not need clone gene to make probe, and because hybridization is front, after being marked at, therefore non-specific background is low.Shortcoming is that a little less than signal, sensitivity is low, for overcoming this system, narrows, and Terkelsen etc. have set up repeated-PRINS technology (repeated PRINS), repeats PRINS reaction, and strength of signal is obviously improved.Principle based on FISH, has developed multicolor-PRINS (multicolor PRINS), can measure the mutual position of two above target sequences on DNA molecular, and specificity is also higher than FISH.

14, DNA sequence analysis (DNA sequencing) is applied the transgenation that various sudden change detection techniques detect, and finally all needs could determine mutation type and sudden change position with sequential analysis, and its efficiency can reach 100%.Present sequence measurement has had very large differently from classical method, though its ultimate principle is still two deoxidation cessation method, level of automation greatly improves, and operate easylier, and the order-checking time is shortening greatly also.Along with round pcr is combined use with order-checking, do not need through M13 subclone step, therefore be called direct sequencing (direct sequencing, DS).The template of DS method order-checking is mainly derived from PCR, application asymmetric PCR (asymmetric PCR) and genome amplification are transcribed synchronous sequencing (genomic amplification with transcript sequencing, GAWTS) etc., single stranded product is increased greatly.In recent years, the foundation of PCR cycle sequencing, makes template amplification carry out with synchronizeing, the fluorescent mark of four kinds of distinct colors for primer, four sequencing reactions of each sample can be carried out in a reaction tubes and a swimming lane, greatly improved the level of automation recording.PE company pushes away with the automatic dna sequencer going out and has developed into 96 swimming lanes at present, and is still updating.These supermatic sequence measurements are more satisfactory gene mutation analysis technology, but its its use range of expensive expense, so to some small org samples or for the tissue samples analysis of some specific purpose, still carry out classical manual order-checking.

15, the detection method of mutator gene is varied, and after particularly round pcr is born, many detection techniques are all derivative on PCR basis.The template amount of wanting due to pcr amplification South Africa is few, make the mutation analysis of tumour can be as accurate as unicellular, as the unicellular gene mutation analysis of the R-S cell of Hodgkin's disease.In addition, applied microanatomy method (microdissection) can more accurately be selected the target spot that needs detection on tissue slice, and its advantage is to overcome interstitial or all mixing of organizing of cancer in tumor tissues, improves accuracy.Except the method for above-mentioned introduction, also has several different methods also for the Molecular Detection of transgenation, as enzymatic mismatch cleavag method (the enzyme mismate cleavage that unknown mutation gene is analyzed, EMC), cutting fragment length polymorphism (cleavage fragment length polymor phism, CEFLP), dideoxy fingerprinting spectrometry (dideoxy finger printing, ddF), mispairing adaptor protein matter brachymemma method of testing (protein truncation test, PTT) etc.What known mutations gene was analyzed has a primer extension (primer extension, PEX), oligonucleotide link detection method (oligonucleotiide ligation assay, OLA), the method such as capillary electrophoresis (capillary electrophoresis, CE).

Summary of the invention

The object of the present invention is to provide a kind of method that adopts allelotrope RNA isothermal duplication method to carry out rapid detection BRAF transgenation, the method equipment requirements is simple, easy to implement the method, energy rapid, high volume amplifies the single stranded RNA of sudden change, specificity is high, sensitivity can reach 0.1%, has solved the problems such as the detection difficulty of BRAF transgenation is large, and speed is slow.

Existing BRAF detection technique mainly adopts the method for QPCR, wherein detect and need in complicated instrument, carry out, need complicated temperature variation, high to equipment requirements, the present invention mainly adopts isothermal reaction method, can effectively and stably test fast, to the V600E mutational site of the BRAF specific detection of fixing a point, wherein 41 ℃ of temperature isothermals carry out, and test conditions is gentle, and compound of reaction is common, simple to operate, specificity is high, does not need expensive qPCR instrument, only needs to detect the instrument of fluorescent probe.It has a higher scale-up factor, can be with 2 Auele Specific Primers for targeted rna and three enzymes within 1.5 hours, reversed transcriptive enzyme (Reverse transcriptase, RT), the RNA polymerase (T7DNA-dependent RNA polymerase) that RNA enzyme H (RNase H) and T7DNA rely on, produce 1,000,000,000 RNA with target RNA complementation, by the detection of fluorescent probe, read the BRAF abrupt information that is low to moderate 0.1% content, for the medication guide of tumour patient targeted drug (EGFR-TKI etc.).

For achieving the above object, the invention provides following technical scheme:

Adopt allelotrope RNA isothermal duplication method to carry out a method for rapid detection BRAF transgenation, comprise the following steps:

(1) detect and prepare:

1. tissue samples: gather fresh surgical tumor tissues sample; If detected immediately, use fine needle aspiration tissue samples, by the circulating tumor cell in blood, or the tumour cell in body fluid for detection of; If do not detected immediately, tissue samples is placed in the temperature of-70 ℃ and preserves;

2. clone and cell cultures: HT29 clone is with saltant type BRAF V600E, and 293 clones, with wild-type BRAF, are cultivated these two kinds of clones; From two kinds of clones, extract respectively total RNA, and with carrying out quantitatively; Then saltant type BRAF V600E is mixed with after wild-type BRAF dilution; Described V600E refers to that on the 600th site, amino acid sports E by normal V;

3. DNA primer and probe:

The forward primer sequence of corresponding saltant type BRAF V600E used is:

5-GTGATTTTGGTCTAGCTACAGA-3；

The forward primer sequence of corresponding wild-type BRAF used is:

5-GTGATTTTGGTCTAGCTACAGT-3；

The reverse primer sequence of BRAF used is:

5-biotin-TTAATTCTAATACGACTCACTATAGGGCTGGTCCCTGTTGTTGAT；

The calmodulin binding domain CaM that contains RNA polymerase in the reverse primer sequence of BRAF used is:

AATTCTAATACGACTCACTATAGGG；

The sequence of molecular beacon used is:

5-FLUOROPHORE-GCGAGAAGTCATCAGAATGCACTCGC-QUENCHER-3；

(3) trace routine:

1. tissue samples is placed in to 1.5ml centrifuge tube, adds 100 μ l lysates, vibration 30s, then centrifugal treating 5min at 4 ℃, obtains tissue samples supernatant liquor;

2. prepare following detection reaction mixture, system 20 μ l comprise:

In described 5 * primer mixed solution, contain 75% dimethyl sulfoxide (DMSO) and forward primer and each 1mM of reverse primer;

3. reaction mixture is joined in micrometering prospect hole and (do not add sample), every hole 19 μ l;

4. getting 1 μ l supernatant liquor of tissue samples to be detected or total RNA1 μ l that the separated concentration obtaining is 10-100ng/ μ l adds in micrometering prospect hole; Reaction mixture is hatched 5min at 65 ℃, is then cooled to 41 ℃ to hatch 5min, adds 5 μ l enzyme mixtures, then at 41 ℃, hatches 90min;

In described enzyme mixture, contain: sorbyl alcohol, bovine serum albumin, ribonuclease H, t7 rna polymerase, AMV reversed transcriptive enzyme;

5. by monitoring fluorescent signal, RNA amplicon is carried out quantitatively; Analyze the slope of each reaction, by the slope ratio of contrast tissue samples and standard rna, carry out to determine the content of saltant type BRAF V600E or wild-type BRAF.

As the further scheme of the present invention: step (1) if 1. in tissue samples do not detect immediately, tissue samples is placed in the temperature of-70 ℃ and preserves.

As the further scheme of the present invention: step (1) 2. in from two kinds of clones, extract respectively total RNA, and carry out quantitatively with spectrophotometer; Then saltant type BRAF V600E is mixed to (saltant type RNA: wild type rna): 100%, 10%, 1%, 0.1% with wild-type BRAF according to following thinning ratio.

As the further scheme of the present invention: step (2) 1. in tissue samples is placed in to 1.5ml centrifuge tube, add 100pl lysate, vibration 30s, then centrifugal treating 5min at 4 ℃, obtains tissue samples supernatant liquor.

As the further scheme of the present invention: step (2) 1. described in contain pH=8.5 in lysate 10mM Tris-HCl damping fluid, 50mM ethylenediamine tetraacetic acid (EDTA), 0.2% sodium laurylsulfonate, 200mM NaCl, 0.1mg/mL Proteinase K and water.

As the present invention's scheme further: step (2) 2. in prepare following detection reaction mixture:

The reaction mixture that a hole of each 96 orifice plate comprises 20 μ l systems, as follows:

Wherein, in 5 described * reaction buffer, contain:

200mM Tris-HCl damping fluid, pH=8.5

60mM?MgCl ₂

350mM?KCl

2.5mM dithiothreitol (DTT)

5mM?of?each?dNTP

10mM?each?of?ATP，UTP?and?CTP

7.5mM?GTP

2.5mM?ITP。

As the further scheme of the present invention: step (2) 4. in get 1 μ l supernatant liquor of tissue samples to be detected or total RNA1 μ l that the separated concentration obtaining is 10-100ng/ μ l adds in micrometering prospect hole; Reaction mixture is hatched 5min at 65 ℃, is then cooled to 41 ℃ to hatch 5min, adds 5 μ l enzyme mixtures, then at 41 ℃, hatches 90min;

In described enzyme mixture, contain:

As the further scheme of the present invention: micrometering prospect hole described in step (2) is with the micrometering prospect hole in 96 hole PCR plates of sealing membrane; 5. by 5 to 10min monitoring interval periodic monitoring fluorescent signals, instrument is the instrument of various detection fluorescent signals, comprises qPCR instrument.

Compared with prior art, the invention has the beneficial effects as follows:

(1) do not need complicated thermal cycling to control step, plant and instrument requires low, can simple realization.

(2) speed is fast, and cost is low.This technology has higher scale-up factor, can be with 2 Auele Specific Primers for targeted rna and three enzymes within 1.5 hours, reversed transcriptive enzyme (Reverse transcriptase, RT), the RNA polymerase (T7DNA-dependent RNA polymerase) that relies on of RNA enzyme H (RNase H) and T7DNA, produce 1,000,000,000 RNA with target RNA complementation;

(3) susceptibility is high, and forward primer is the allele-specific primers for sudden change, carries the patient of BRAF transgenation, also simultaneously with BRAF wild-type, present method mutator gene part that increases targetedly, has improved sensitivity greatly, can reach 0.1%.

Embodiment

Below in conjunction with the embodiment of the present invention, the technical scheme in the embodiment of the present invention is clearly and completely described, obviously, described embodiment is only the present invention's part embodiment, rather than whole embodiment.Embodiment based in the present invention, those of ordinary skills, not making the every other embodiment obtaining under creative work prerequisite, belong to the scope of protection of the invention.

In the embodiment of the present invention, a kind of method that adopts allelotrope RNA isothermal duplication method to carry out rapid detection BRAF transgenation, comprises the following steps:

(1) detect and prepare:

1. tissue samples: gather fresh surgical tumor tissues sample; If detected immediately, use fine needle aspiration tissue samples, by the circulating tumor cell in blood, or the tumour cell in body fluid for detection of; If do not detected immediately, tissue samples is placed into rapidly in the temperature of-70 ℃ and preserves;

2. clone and cell cultures: HT29 clone is with saltant type BRAF V600E, and 293 clones, with wild-type BRAF, are cultivated these two kinds of clones according to standard conditions; From two kinds of clones, extract respectively total RNA, and carry out quantitatively with spectrophotometer; Then saltant type BRAF V600E is mixed to (saltant type RNA: wild type rna): 100%, 10%, 1%, 0.1% with wild-type BRAF according to following thinning ratio; Described V600E refers to that on the 600th site, amino acid sports E by normal V;

3. DNA primer and probe:

The forward primer sequence of corresponding saltant type BRAF V600E used is:

5-GTGATTTTGGTCTAGCTACAGA-3；

The forward primer sequence of corresponding wild-type BRAF used is:

5-GTGATTTTGGTCTAGCTACAGT-3；

The reverse primer sequence of BRAF used is:

5-biotin-TTAATTCTAATACGACTCACTATAGGGCTGGTCCCTGTTGTTGAT; Biotin can carry out coupling with 96 orifice plates of special processing;

The calmodulin binding domain CaM that contains RNA polymerase in the reverse primer sequence of BRAF used is:

AATTCTAATACGACTCACTATAGGG; By with vitamin H coupling, can increase BRAF Gene traps probability, and improve BRAF gene is locked onto to the specificity in 96 orifice plates;

The sequence of molecular beacon used (fluorescent probe) is:

5-FLUOROPHORE-GCGAGAAGTCATCAGAATGCACTCGC-QUENCHER-3；

(4) trace routine:

1. tissue samples is placed in to 1.5ml centrifuge tube, adds 100 μ l lysates, vibration 30s, then centrifugal treating 5min at 4 ℃, obtains reaction mixture (premix); The 10mM Tris-HCl damping fluid, 50mM ethylenediamine tetraacetic acid (EDTA) (EDTA), 0.2% sodium laurylsulfonate (SDS), 200mM NaCl, the 0.1mg/mL Proteinase K that in described lysate, contain pH=8.5, and with diethylpyrocarbonate (DEPC) treated water;

2. prepare detection reaction mixture (premix):

Prepare following material:

A reaction mixture (premix) (corresponding to a hole of each 96 orifice plate, 20 μ l systems)

Wherein:

In 5 described * reaction buffer (reaction buffer), contain:

200mM Tris-HCl damping fluid, pH=8.5

60mMMgCl ₂

350mM?KCl

2.5mM dithiothreitol (DTT) (DTT)

5mM?of?each?dNTP

10mM?each?of?ATP，UTP?and?CTP

7.5mM?GTP

2.5mM?ITP

Described 5 * primer mixed solution (primer mix) contains 75% dimethyl sulfoxide (DMSO) (DMSO) and forward primer and each 1mM of reverse primer;

3. reaction mixture (Premix) is joined in micrometering prospect hole (with 96 hole PCR plates of sealing membrane) to every hole 19 μ l;

4. the 1 μ l supernatant liquor or the separated total RNA1 μ l (10-100ng/ μ l) obtaining that get tissue samples to be detected add in micrometering prospect hole; Reaction mixture is hatched 5min at 65 ℃, is then cooled to 41 ℃ to hatch 5min, adds 5 μ l enzyme mixtures, then at 41 ℃, hatches 90min;

In described enzyme mixture (Each reaction), contain:

5. by periodic monitoring fluorescent signal (5 to 10min monitoring interval), RNA amplicon is carried out quantitatively; Analyze the slope of each reaction, by the slope ratio of contrast tissue samples and standard rna, carry out to determine the content of saltant type BRAF V600E or wild-type BRAF.

Described periodic monitoring fluorescent signal instrument comprises qPCR instrument, but is not limited to qPCR instrument, can be the instrument of various detection fluorescent signals.

To those skilled in the art, obviously the invention is not restricted to the details of above-mentioned one exemplary embodiment, and in the situation that not deviating from spirit of the present invention or essential characteristic, can realize the present invention with other specific form.Therefore, no matter from which point, all should regard embodiment as exemplary, and be nonrestrictive, scope of the present invention is limited by claims rather than above-mentioned explanation, is therefore intended to include in the present invention dropping on the implication that is equal to important document of claim and all changes in scope.

In addition, be to be understood that, although this specification sheets is described according to embodiment, but not each embodiment only comprises an independently technical scheme, this narrating mode of specification sheets is only for clarity sake, those skilled in the art should make specification sheets as a whole, and the technical scheme in each embodiment also can, through appropriately combined, form other embodiments that it will be appreciated by those skilled in the art that.

Claims (8)

1. adopt allelotrope RNA isothermal duplication method to carry out a method for rapid detection BRAF transgenation, it is characterized in that, comprise the following steps:

(1) detect and prepare:

1. tissue samples: gather fresh surgical tumor tissues sample; If detected immediately, use fine needle aspiration tissue samples, by the circulating tumor cell in blood, or the tumour cell in body fluid for detection of; If do not detected immediately, tissue samples is placed in the temperature of-70 ℃ and preserves;

2. clone and cell cultures: HT29 clone is with saltant type BRAF V600E, and 293 clones, with wild-type BRAF, are cultivated these two kinds of clones; From two kinds of clones, extract respectively total RNA, and carry out quantitatively; Then saltant type BRAF V600E is mixed with after wild-type BRAF dilution; Described V600E refers to that on the 600th site, amino acid sports E by normal V;

3. DNA primer and probe:

The forward primer sequence of corresponding saltant type BRAF V600E used is:

5-GTGATTTTGGTCTAGCTACAGA-3；

The forward primer sequence of corresponding wild-type BRAF used is:

5-GTGATTTTGGTCTAGCTACAGT-3；

The reverse primer sequence of BRAF used is:

5-biotin-TTAATTCTAATACGACTCACTATAGGGCTGGTCCCTGTTGTTGAT；

The calmodulin binding domain CaM that contains RNA polymerase in the reverse primer sequence of BRAF used is:

AATTCTAATACGACTCACTATAGGG；

The sequence of molecular beacon used is:

5-FLUOROPHORE-GCGAGAAGTCATCAGAATGCACTCGC-QUENCHER-3；

(2) trace routine:

1. tissue samples is placed in to 1.5ml centrifuge tube, adds 100 μ l lysates, vibration 30s, then centrifugal treating 5min at 4 ℃, obtains tissue samples supernatant liquor;

2. prepare following detection reaction mixture, system 20 μ l comprise:

In described 5 * primer mixed solution, contain 75% dimethyl sulfoxide (DMSO), (sequence is each 1mM of reverse primer (sequence is 5-biotin-TTAATTCTAATACGACTCACTATAGGGCTGGTCCCTGTTGTTGAT) of 5-GTGATTTTGGTCTAGCTACAGA-3 and BRAF to the forward primer of saltant type BRAF V600E, and the result detecting is the content of saltant type BRAF;

If the primer adding is the reverse primer (sequence is 5-biotin-TTAATTCTAATACGACTCACTATAGGGCTGGTCCCTGTTGTTGAT) of wild-type BRAF forward primer (sequence is 5-GTGATTTTGGTCTAGCTACAGT-3) and BRAF, the result detecting is so exactly the content of wild-type BRAF;

3. reaction mixture (not adding sample) is joined in micrometering prospect hole to every hole 19 μ l;

4. getting 1 μ l supernatant liquor of tissue samples to be detected or total RNA1 μ l that the separated concentration obtaining is 10-100ng/ μ l adds in micrometering prospect hole; Reaction mixture is hatched 5min at 65 ℃, is then cooled to 41 ℃ to hatch 5min, adds 5 μ l enzyme mixtures, then at 41 ℃, hatches 90min;

In described enzyme mixture, contain: sorbyl alcohol, bovine serum albumin, ribonuclease H, t7 rna polymerase, AMV reversed transcriptive enzyme;

5. by monitoring fluorescent signal, RNA amplicon is carried out quantitatively; Analyze the slope of each reaction, by the slope ratio of contrast tissue samples and standard rna, carry out to determine the content of saltant type BRAF V600E or wild-type BRAF.

2. employing allelotrope RNA isothermal duplication method according to claim 1 is carried out the method for rapid detection BRAF transgenation, it is characterized in that, step (1) if 1. in tissue samples do not detect immediately, tissue samples is placed in the temperature of-70 ℃ and preserves.

3. employing allelotrope RNA isothermal duplication method according to claim 1 is carried out the method for rapid detection BRAF transgenation, it is characterized in that, step (1) 2. in from two kinds of clones, extract respectively total RNA, and carry out quantitatively with spectrophotometer; Then saltant type BRAF V600E is mixed to (saltant type RNA: wild type rna): 100%, 10%, 1%, 0.1% with wild-type BRAF according to following thinning ratio.

4. employing allelotrope RNA isothermal duplication method according to claim 1 is carried out the method for rapid detection BRAF transgenation, it is characterized in that, step (2) 1. in tissue samples is placed in to 1.5ml centrifuge tube, add 100 μ l lysates, vibration 30s, then centrifugal treating 5min at 4 ℃, obtains tissue samples supernatant liquor.

5. according to the employing allelotrope RNA isothermal duplication method described in claim 1 or 4, carry out the method for rapid detection BRAF transgenation, it is characterized in that, step (2) 1. described in contain pH=8.5 in lysate 10mM Tris-HCl damping fluid, 50mM ethylenediamine tetraacetic acid (EDTA), 0.2% sodium laurylsulfonate, 200mM NaCl, 0.1mg/mL Proteinase K and water.

6. employing allelotrope RNA isothermal duplication method according to claim 1 is carried out the method for rapid detection BRAF transgenation, it is characterized in that the following detection reaction mixture of 2. middle preparation of step (2):

The reaction mixture that a hole of each 96 orifice plate comprises 20 μ l systems, as follows:

Wherein, in 5 described * reaction buffer, contain:

200mM Tris-HCl damping fluid, pH=8.5

60mM?MgCl ₂

350mM?KCl

2.5mM dithiothreitol (DTT)

5mM?of?each?dNTP

10mM?each?of?ATP，UTP?and?CTP

7.5mM?GTP

2.5mM?ITP。

7. employing allelotrope RNA isothermal duplication method according to claim 1 is carried out the method for rapid detection BRAF transgenation, it is characterized in that, step (2) 4. in get 1 μ l supernatant liquor of tissue samples to be detected or total RNA1 μ l that the separated concentration obtaining is 10-100ng/ μ l adds in micrometering prospect hole; Reaction mixture is hatched 5min at 65 ℃, is then cooled to 41 ℃ to hatch 5min, adds 5 μ l enzyme mixtures, then at 41 ℃, hatches 90min;

In described enzyme mixture, contain:

8. employing allelotrope RNA isothermal duplication method according to claim 1 is carried out the method for rapid detection BRAF transgenation, it is characterized in that, micrometering prospect hole described in step (2) is with the micrometering prospect hole in 96 hole PCR plates of sealing membrane; 5. by 5 to 10min monitoring interval periodic monitoring fluorescent signals, instrument is the instrument of various detection fluorescent signals, comprises qPCR instrument.