CN102676661B - Fluorescent polarization based homogeneous phase detection method of single nucleotide polymorphism of codon118 of ERCC1 (excision repair cross-complementing 1) gene - Google Patents
Fluorescent polarization based homogeneous phase detection method of single nucleotide polymorphism of codon118 of ERCC1 (excision repair cross-complementing 1) gene Download PDFInfo
- Publication number
- CN102676661B CN102676661B CN201210127673.4A CN201210127673A CN102676661B CN 102676661 B CN102676661 B CN 102676661B CN 201210127673 A CN201210127673 A CN 201210127673A CN 102676661 B CN102676661 B CN 102676661B
- Authority
- CN
- China
- Prior art keywords
- ercc1
- value
- codon118
- single nucleotide
- nucleotide polymorphism
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Abstract
The invention relates to a fluorescent polarization based homogeneous phase detection method of a single nucleotide polymorphism of a codon118 of an ERCC1 (excision repair cross-complementing 1) gene. The homogeneous phase detection method solves the problems of high cost, complicated operating steps, proneness to causing contamination and influence on detection result accuracy in the prior art, and is simple in steps, easy to operate, not prone to causing contamination as operation can be completed once in a closed tube, and low in cost as any special reagent and fluorescence quenching or micro-groove binding agent are not needed. Application of a specific probe with single end marked to detection of the single nucleotide polymorphism of the codon118 of the ERCC1 gene results in changes of fluorescent polarization values and enables detection results to be more objective and accurate. Result analysis is simple as only numeric comparison is needed in result judgment, and the homogeneous phase detection method can easily realize standardization and automation, is wide in application range and can be used for detecting clinical blood or tissue specimens.
Description
Technical field:
The present invention relates to the detection technique field of ERCC1 gene Exon4 ll8 bit codon Codon118 single nucleotide polymorphism, particularly relate to a kind of homogeneous assay, it is by detecting the fluorescence polarization value of change to monitor the ERCC1 gene Exon4 ll8 bit codon Codon118 single nucleotide polymorphism existed in sample.
background technology:
Single nucleotide polymorphism (SNP) refers to, in the genome of the normal individual of a certain crowd, there is different base specific nucleic acid position, the difference of human DNA sequence, the polymorphism change of the DNA sequence dna namely occurred during single nucleotide alteration in chromogene group sequence, SNPs is also referred to as biallelic marker.In human genome 3,000,000,000 bases, approximately every 300 to 500 bases just have a SNP to occur, nearly 20,000,000 SNP of whole human genome.SNP can occur again at encoding gene in Noncoding gene, to the phenotype (form, metabolism and immunological status etc.) of human individual, the reaction sensibility of the individual susceptibility to environmental pathogenic factor, resistibility, medicine and treatment produces great effect, therefore, it detects biological study, drug development, medical diagnosis, biomedicine and medical jurisprudence great significance.
DNA damage reparation is a complicated process, repairs approach and completes, comprise Nucleotide Sequence Analysis and base excision repair approach etc. by a series of DNA.ERCC1 is the important gene in base excision repair approach, in DNA reparation approach, serve key effect, and its normal expression is the molecular basis maintaining this repairing effect.ERCC1 codonl18 is positioned at the 4th exon, a reticent SNP, namely C/T changes the amino acid aspartic acid (Asp) of encoding same, C/T conversion may be selected with codon to reduce by half, ERCC1 mRNA product and protein translation subsequently reduce relevant, reduce DNA repair ability, may be closely related with individual tumors susceptibility.Meanwhile, DNA repair ability is the major reason of the curative effect affecting platinum medicine.Platinum medicine (cis-platinum, carboplatin) is a class important drugs of chemotherapy.The heterodimer that ERCC1 and xeroderma pitmentosum gene are formed, DNA single chain is driven in the 5 ' end-grain cutting in the DNA damage site that can cause at platinum medicine, ensures proceeding, by cell survival is required of the repair process of DNA.Therefore, gene polymorphic is not only relevant with the chemotherapeutic efficacy of tumour, also has impact to prognosis.In the therapeutic process of tumour, DNA repair ability strengthens the performance that have impact on antitumor drug curative effect, easily produces resistance; DNA repair ability declines and contributes to the sustainable existence of the platinum-DNA adduct function of anti-tumor activity, thus on the impact that prognosis produces.There is obvious relation in SNP and the platinum-based chemotherapy susceptibility of existing a lot of bibliographical information ERCC1, there is significant correlation lifetime after ERCC1 (118) C/T single nucleotide polymorphism and Patients with Non-small-cell Lung platinum-based chemotherapy, and the lifetime after ERCC1 (118) C/T and T/T genotype Chemotherapy in Patients and chemosensitivity are apparently higher than carrying the genotypic patient of C/C.After ERCC1 (118) SNP and platinum-based chemotherapy there is certain dependency likely as the prediction index of lifetime after platinum-based chemotherapy in lifetime.The detection of prompting ERCC1 gene ll8 bit codon Codon118 single nucleotide polymorphism not only can be widely used in biological study, also early warning tumour can occur, predict chemotherapeutic efficacy, for early diagnosis of tumor, prognosis judge and instruct foresight personalized medicine to provide foundation.And ERCC1 gene ll8 bit codon Codon118 single nucleotide polymorphism does not exist only in tissue, all can detect in peripheral blood, hydrops and sputum, this advantage is studied relevant biology and to carry out early stage, responsive noninvasive diagnostic significance great.
At present, ERCC1 gene ll8 bit codon Codon118 mononucleotide polymorphism analyzing method has a lot, the technology such as RFLP, allele specific oligonucleotide oligonucleotide hybridization, oligonucleotide linking parsing, allele specific oligonucleotide PCR, DNA sequencing, gene chip, TDI-FP all can detect respectively, but these methods relate to amplification, digestion purifying, deactivation, hybridization extend and the step such as to be in charge of, need electrophoresis and multistep aftertreatment more, waste time and energy and efficiency has much room for improvement.And easily pollute because reaction tubes changed by needs in operating process, affect the accuracy of detected result.Or plant and instrument is expensive, is difficult to large-scale promotion application.
Therefore, need to obtain a kind of easy and simple to handle, special accurately, easily stdn and automatization, low cost ERCC1 gene ll8 bit codon Codon118 single nucleotide polymorphism new detecting method.
Embodiment of the present invention provide the homogeneous assay of ERCC1 gene ll8 bit codon Codon118 single nucleotide polymorphism in a kind of working sample, and the method is measured as basis with fluorescence polarization.The principle of fluorescence polarization technology is as follows: the fluorescent probe with lower molecular weight is due to its fast rotary then have less degree of polarization, and the fluorescent probe with larger molecular weight has larger degree of polarization because it rotates at a slow speed.Therefore, when with comparatively macromole in conjunction with time, the degree of polarization of fluorophore increases, and fluorescence polarization values increases.
summary of the invention:
The present invention relates to a kind of homogeneous assay for ERCC1 gene ll8 bit codon Codon118 single nucleotide polymorphism in working sample, described homogeneous assay comprises the following steps: that (1) obtains extract from sample: use a kind of reagent or test kit to extract genomic dna from testing sample, obtain the extract of purifying, (2) amplification combines: the extract of above-mentioned purifying is added reaction reagent and carry out amplification combination, described reaction reagent comprises the PCR damping fluid of 10 times, concentration is respectively the dNTP (dGTP of 2.0 ~ 2.5mmol/L, dCTP, dATP and dTTP), the MgCl2 of 2.0 ~ 3.5mmol/L, the Taq DNA polymerase of 1-5U/ μ l, concentration is the upstream primer that ERCC1 gene the 4th exon of 0.2-2.0 μm of ol/L contains ll8 bit codon Codon118 single nucleotide polymorphism district DNA, downstream primer, and concentration is the fluorescently-labeled DNA probe of band of the ERCC1 gene C odon118 C/T single nucleotide polymorphism of 0.05-0.2 μm of ol/L, described reaction conditions is: after 94-96 DEG C of sex change 4-10min, hatch 5-40 second for 95 DEG C, hatch 15-60 second for 53-63 DEG C, hatch 10-60 second for 72 DEG C, 35-45 circulation, last incubated at room, (3) detect: the fluorescence polarization FP value of detection reaction solution, SPSS computed in software FP average (means) and standard deviation (S.D.), t inspection statistics is cloudy, positive control reacts whole liquid FP Distribution value: lowest detection lower limit positive control reacts whole liquid FP value+FP standard deviation (S.D.) < negative control and reacts whole liquid FP average-FP standard deviation (S.D.), positive threshold value Cut-off=lowest detection lower limit positive control FP average (means), negative threshold value Cut-off=lowest detection lower limit positive control FP average (means)+FP standard deviation (S.D.), more namely testing sample FP value and Cut-off value know ERCC1 gene C odon118 single nucleotide polymorphism:
The negative threshold value Cut-off value of testing sample FP value >, it is non-homogeneous that target site and institute in reaction add corresponding fluorescently-labeled probe sequence,
The positive threshold value Cut-off value of testing sample FP value <, target site adds corresponding fluorescently-labeled probe sequence homology to institute in reaction,
The positive threshold value Cut-off value of testing sample FP value >, but testing sample FP value < feminine gender threshold value Cut-off simultaneously, then target site state cannot judge, need again detect.
Relate to ERCC1 gene C odon118 C/C in method, the positive of ERCC1 gene C odon118 T/T and negative control, utilize known sequence clone to obtain by general molecular biology method.
Further, step (1) comprising: in reagent or test kit, carry out process obtain genomic dna; The reagent of wherein said acquisition genomic dna or test kit are the DNA extraction liquid of inner protein enzyme K, cell pyrolysis liquid, and include the reagent of phenol/chloroform, ethanol or DNA purifying DEAE resin or DNA adsorption column; The DNA reclaimed is increased by PCR, and in pcr amplification process, ll8 bit codon Codon118 single nucleotide polymorphism remains unchanged.
Further, wherein said primer is that ERCC1 gene contains ll8 bit codon Codon118 single nucleotide polymorphism general upstream primer, downstream primer, the fluorescently-labeled probe of described band is the probe of ERCC1 gene ll8 bit codon Codon118 single nucleotide polymorphism homology, can be combined change to produce the fluorescence polarization value that can detect with obtained amplicon; Detect the fluorescence polarization of the whole liquid of described each reaction to obtain fluorescence polarization measurement value; And by fluorescence polarization measurement value compared with characterized fluorescence polarization values, described characterized fluorescence polarization values is control reaction whole liquid FP average, Cut-off value.
In optimal technical scheme, Codon118 mononucleotide polymorphism sequence is contained according to ERCC1 gene to be measured, avoid Codon118 pleomorphism site design universal primer, wherein said covering ERCC1 gene contains the general upstream of Codon118 single nucleotide polymorphism, downstream primer sequence is: forward primer 5'-cagtccagaacactgggacatgac-3', reverse primer 5'-ggtcatccctattgatggcttctg-3', Codon118 C/C genotype probe sequence is 5'-ccaaattcccagggcacgttgcgcacg-3', or 5'-caaattcccagggcacgttgcgcacg-
3', or 5'-caaattcccagggcacgttgcgcac-3', or 5'-caaattcccagggcacgttgcgc-3', or 5'-caaattcccagggcacgttgcg-3', or 5'-caaattcccagggcacgttgc-3'.Codon118 T/T genotype probe sequence is 5'-ccaaattcccagggcacAttgcgcacg-3', or 5'-caaattcccagggcacAttgcgcacg-3', or 5'-caaattcccagggcacAttgcgcac-3', or 5'-caaattcccagggcacAttgcgc-3', or 5'-caaattcccag ggcacAttgcg-3', or 5'-caaattcccagggcacAttgc-3'.
In preferred technical scheme, wherein said end-labelled fluorescein is TAMRA(tetramethylrhodamine), or FAM(Fluoresceincarboxylic acid), R110(rhodamine), FITC(fluorescein isothiocyanate), TET(Tetrachlorofluorescein), HEX(chlordene fluorescein), ROX, BTR.Two kinds of genotype probes use respectively two kinds different fluorescein-labelled.
In preferred technical scheme, it comprises the steps: to provide multiple ERCC1 gene ll8 bit codon Codon118 single nucleotide polymorphism positive control further: ERCC1 Codon118 C/C positive control pGEM-T-ERCC1-C/C, ERCC1 Codon118 T/T positive control pGEM-T-ERCC1-118T/T, and intersect negative control each other, namely pGEM-T-ERCC1-C/C is the negative control of ERCC1 Codon118T/T, pGEM-T-ERCC1-118T/T is the negative control of ERCC1 Codon118 C/C, each the moon, positive control solution has different concentration known, each positive and negative contrast adds reaction reagent and reacts, and the fluorescence polarization value measuring each described standard control reaction solution corresponds to known ERCC1 gene ll8 bit codon Codon118 C/C to provide multiple, the fluorescence polarization values of T/T positive and negative contrast.
In optimal technical scheme, wherein said Cut-off value is for using SPSS computed in software negative control, positive control reacts whole liquid FP value average and standard deviation, t method of inspection statistics is cloudy, positive control reacts whole liquid FP Distribution value, the Cut-off value obtained, meet: lowest detection lower limit positive control reacts whole liquid FP value+FP standard deviation (S.D.) < negative control and reacts whole liquid FP average-FP standard deviation (S.D.), positive threshold value Cut-off=lowest detection lower limit positive control FP average (means), negative threshold value Cut-off=lowest detection lower limit positive control FP average (means)+FP standard deviation (S.D.), more namely testing sample FP value and Cut-off value know ERCC1 gene C odon118 single nucleotide polymorphism.
In optimal technical scheme, wherein said testing sample FP value and negative control react whole liquid FP average, more namely Cut-off value knows that ERCC1 gene ll8 bit codon Codon118 single nucleotide polymorphism specifically refers to: threshold value Cut-off value as negative in testing sample FP value >, it is non-homogeneous that target site and institute in reaction add corresponding fluorescently-labeled probe sequence, threshold value Cut-off value as positive in testing sample FP value <, target site adds corresponding fluorescently-labeled probe sequence homology to institute in reaction, threshold value Cut-off value as positive in testing sample FP value >, but the negative threshold value Cut-off of testing sample FP value < simultaneously, then target site state cannot judge, need again detect.
The present invention further provides test kit, primer and the probe etc. of implementing described detection.
Compared with prior art, advantage of the present invention is:
1), present method step is simple, simple to operate; In stopped pipe, a step completes, and not easily pollutes.
2), cost is low, do not need any special agent and fluorescent quenching or very low power bonding agent.By applying the special probe of single-ended mark, cause the change of fluorescence polarization value, detect ERCC1 gene ll8 bit codon Codon118 single nucleotide polymorphism, detected result is more objective and accurate.
3), interpretation of result is simple, only needs numeral to compare, easy stdn, automatization, applied range, can be used for research and detection sample ERCC1 gene ll8 bit codon Codon118 single nucleotide polymorphism when result judges.
Accompanying drawing explanation
Fig. 1 is the ERCC1 gene ll8 bit codon Codon118 single nucleotide polymorphism T/T sequencing result of patient's first DNA sample.
Fig. 2 is the ERCC1 gene ll8 bit codon Codon118 single nucleotide polymorphism C/C sequencing result of patient's second DNA sample.
Fig. 3 is the ERCC1 gene ll8 bit codon Codon118 single nucleotide polymorphism C/T sequencing result of patient third DNA sample.
embodiment:
In the present invention, from sample, extract DNA, with primer and probe, the association reaction that increases occurs, cause the change of fluorescence polarization degree numerical value therefrom, this change changes with the change of ERCC1 gene ll8 bit codon Codon118 single nucleotide polymorphism state.The preferred embodiments of the invention provide a kind of homogeneous assay of ERCC1 gene C odon118 single nucleotide polymorphism state, and the method is sensitive, quick, simple and cost is low.Describe the present invention below in conjunction with embodiment.
Preferred embodiment describes:
Embodiment 1
On peripheral blood from patients with lung cancer ERCC1 gene ll8 bit codon, the homogeneous phase of C/T single nucleotide polymorphism detects prediction platinum class resistance
1), materials and methods
Several healthy volunteer's peripheral blood extracts DNA, Codon118 single nucleotide polymorphism universal primer is contained: forward primer 5'-cagtccagaacactgggacatgac-3' with ERCC1 gene, reverse primer 5'-ggtcatccctattgatggcttctg-3', amplification, extension amplification outcome enters
PGEM-T-easy Vectors (Promega, USA) builds standard control clone.The single nucleotide polymorphism of sequencing Screening and Identification reference substance.Extract containing the plasmid pGEM-T-ERCC1-118T/T of T/T single nucleotide polymorphism on ERCC1 gene ll8 bit codon and the pGEM-T-ERCC1-C/C standard substance in contrast containing C/C single nucleotide polymorphism on ERCC1 gene ll8 bit codon, detect OD value in 260nm quantitative.
Extract first, second, the third peripheral blood in patients 1 milliliter respectively, use TIANamp Genomic DNA Kit test kit (sky root is biological, Beijing) to carry out peripheral blood sample DNA extraction, the extraction of genomic dna, to specifications procedure operation respectively.
The homogeneous phase of ERCC1 gene C odon118 C single nucleotide polymorphism detects: the plasmid pGEM-T-containing 1-1000 copies/ml cloned with this room
ERCC1-C/C as positive control standard substance, with containing 10
7plasmid pGEM-the T-ERCC1-T/T of copies/ml is as intersection negative control standard substance.Get positive and negative reference standards and first, second respectively, the third peripheral blood in patients DNA profiling 5 μ L adds reaction reagent 50 μ L and increase: described reagent comprises 10 × PCR damping fluid 5 μ L; Concentration is respectively dGTP, dCTP, dATP and dTTP of 2.5mM, the MgCl of 3.5mmol/L
2, the Taq DNA polymerase of 1.5U, concentration 500nM forward primer 5'-cagtccagaacactgggacatgac-3', reverse primer 5'-ggtcatccctattgatggcttctg
-3', concentration 50nM fluorescence labeling probe 5'TAMRA-ccaaattcccagggcacgttgcgcacg-3', after reaction conditions: 94-95 DEG C of sex change 4-10min, hatch 5-40 second for 95 DEG C, hatch 15-60 second for 55-60 DEG C, hatch 10-60 second for 72 DEG C, 35-45 circulation, last incubated at room detects.Multiple hole is all done in each reaction.
The homogeneous phase of ERCC1 gene C odon118 T single nucleotide polymorphism detects: using the plasmid pGEM-T-ERCC1-118T/T containing 1-1000 copies/ml of above-mentioned steps clone as positive control standard substance, to contain 10
7plasmid pGEM-the T-ERCC1-C/C of copies/ml is as intersection negative control standard substance.Get positive and negative reference standards and first, second respectively, the DNA profiling 5 μ L of the third peripheral blood in patients add reaction reagent 50 μ L and increase: the fluorescence labeling probe 5'FAM-ccaaattcccagggcacAttgcgcacg-3' of 50nM, other reagent and reaction conditions the same.Multiple hole is all done in each reaction.
Application Fluorescence Polarization Capable Instrument Victor (PerkinElmer Life Science, the U.S.) fluorescence polarization detector detects the fluorescence polarization value FP of reference substance and sample reaction product.Fluorescence polarization determination is at room temperature carried out, respectively at excitation wavelength 535nm, absorbing wavelength 590nm detects the polarization value FP of the TAMRA fluorescence of each reference substance and sample reaction product, respectively at excitation wavelength 485nm, absorbing wavelength 530nm detects the polarization value FP of the FAM fluorescence of each reference substance and sample reaction product, take mP as international unit.
Application SPSS statistical software analyzes experimental result, calculates FP average (means) and the standard deviation (S.D.) of each contrast and sample.T inspection statistics positive control and negative control react whole liquid FP Distribution value, obtain: lowest detection lower limit positive control reacts whole liquid FP value+FP standard deviation (S.D.) < negative control and reacts whole liquid FP average-FP standard deviation (S.D.), positive threshold value Cut-off=lowest detection lower limit positive control FP average (means), negative threshold value Cut-off=lowest detection lower limit positive control FP average (means)+FP standard deviation (S.D.), more namely testing sample FP value and Cut-off value know ERCC1 gene C odon118 single nucleotide polymorphism.
Threshold value Cut-off value as negative in testing sample FP value >, it is non-homogeneous that target site and institute in reaction add corresponding fluorescently-labeled probe sequence, threshold value Cut-off value as positive in testing sample FP value <, target site adds corresponding fluorescently-labeled probe sequence homology to institute in reaction, threshold value Cut-off value as positive in testing sample FP value >, but the negative threshold value Cut-off of < simultaneously, then target site state cannot judge, need again detect.
Peripheral blood in patients DNA detects with sequencing, to verify fluorescence polarization detected result simultaneously.DNA 5 μ L adds common sequencing reaction reagent 50 μ L and increases: described pcr amplification binding reagents comprises 10 × PCR damping fluid 5 μ L; Concentration is respectively dGTP, dCTP, dATP and dTTP of 2.5mM, the MgCl of 2.5mmol/L
2the Taq DNA polymerase of 1.5 U, the forward primer 5'-cagtccagaacactgggacatgac-3' of 500nM, reverse primer 5'-ggtcatccctattgatggcttctg-3', reaction conditions is: after 95 DEG C of sex change 4min, hatch 20 seconds for 95 DEG C, hatch 40 seconds for 55 DEG C, hatch 20 seconds for 72 DEG C, 35 circulations, 72 DEG C extend 5min, and reaction terminates rear sample and verifies through 1.2% agarose gel electrophoresis, and application UV-light gel imaging system is observed.Amplified production purifying send order-checking (ABI 377 instrument, AmpliCycle sequencing kit, Perkin Elmer, USA).
2), the results are summarized in lower list 1,2
The genotypic homogeneous phase of ERCC1 gene C odon118 single nucleotide polymorphism C detects:
Table 1. sample, the positive and negative control react whole liquid FP value average (means) and standard deviation (S.D.)
* data represent with FP value average (means) ± standard deviation (S.D).
These results show TAMRA fluorescence polarization FP value of the present invention and ERCC1 (118) single nucleotide polymorphism has good dependency, negative control pGEM-T-ERCC1-118T/T fluorescence polarization FP value and positive control lowest detection lower limit pGEM-T-ERCC1-118 C/C fluorescence polarization FP value have significant distributional difference.It is anti-that lowest detection lower limit positive control reacts whole liquid FP value+FP standard deviation (S.D.) (160.4+7.3=167.7) < negative control
Should whole liquid FP average-FP standard deviation (S.D.) (189.88-13.75=176.13), positive threshold value Cut-off=lowest detection lower limit positive control FP average (means)=160.4, negative threshold value Cut-off=lowest detection lower limit positive control FP average (means)+FP standard deviation (S.D.)=160.4+7.3=167.7, this method is highly sensitive, lowest detection lower limit reaches 100 copies/ml, high specificity, even if negative control is up to 10
7copies/ml, there is false positive results not yet, therefore judge that the ERCC1 gene C odon118 site of patient's first peripheral blood DNA sample is without C genotype accordingly, the ERCC1 gene C odon118 site of patient's second, the third peripheral blood DNA sample is containing C genotype, this judgement (accompanying drawing 1 consistent with sequencing result, 2,3).
The genotypic homogeneous phase of ERCC1 gene C odon118 single nucleotide polymorphism T detects:
Table 2. sample, the positive and negative control react whole liquid FP value average (means) and standard deviation (S.D.)
* data represent with FP value average (means) ± standard deviation S.D.
These results show FAM fluorescence polarization FP value of the present invention and ERCC1 (118) single nucleotide polymorphism has good dependency, negative control pGEM-T-ERCC1-118C/C fluorescence polarization FP value and positive control lowest detection lower limit pGEM-T-ERCC1-118T/T fluorescence polarization FP value have significant distributional difference.It is anti-that lowest detection lower limit positive control reacts whole liquid FP value+FP standard deviation (S.D.) (170.7+10.5=181.2) < negative control
Should whole liquid FP average-FP standard deviation (S.D.) (203.12-16.7=196.42), positive threshold value Cut-off=lowest detection lower limit positive control FP average (means)=170.7, negative threshold value Cut-off=lowest detection lower limit positive control FP average (means)+FP standard deviation (S.D.)=170.7+ 10.5=181.2, this method is highly sensitive, lowest detection lower limit reaches 100 copies/ml, high specificity, even if negative control is up to 10
7copies/ml, there is false positive results not yet, therefore result accordingly, judge that the ERCC1 gene C odon118 site of patient's second peripheral blood DNA sample is without T genotype, the ERCC1 gene C odon118 site of patient first, the third peripheral blood DNA sample is containing T genotype, this judgement consistent with sequencing result (accompanying drawing 1,2,3).
Our method successfully detects ERCC1 gene C odon118 single nucleotide polymorphism C/C, T/T and C/T genotype, and demonstrates this method accuracy by gene sequencing.Prove that this method detects peripheral blood ERCC1 Codon118 single nucleotide polymorphism accurately and reliably, be suitable for and carry out clinical detection.
Embodiment 2
On peripheral blood from patients with gastric cancer ERCC1 gene ll8 bit codon, the homogeneous phase of C/T single nucleotide polymorphism detects prediction platinum class resistance
1), materials and methods
Extract respectively fourth, penta, own peripheral blood in patients 1 milliliter, use TIANamp Genomic DNA Kit test kit (sky root is biological, Beijing) to carry out peripheral blood sample DNA extraction, the extraction of genomic dna, to specifications procedure operation respectively.
The homogeneous phase of ERCC1 gene C odon118 C single nucleotide polymorphism detects: get respectively positive and negative reference standards and fourth, penta, own peripheral blood in patients DNA profiling 5 μ L adds reaction reagent 50 μ L and increases: described reagent comprises the fluorescence labeling probe 5'FITC-caaattcccagggcacgttgcgcacg-3' of concentration 50nM, and other reagent and reaction conditions, step are with embodiment 1.
The homogeneous phase of ERCC1 gene C odon118 T single nucleotide polymorphism detects: get respectively positive and negative reference standards and fourth, penta, the DNA profiling 5 μ L of own peripheral blood in patients adds reaction reagent 50 μ L and increases: described reagent comprises the fluorescence labeling probe 5'R110-caaattcccagggcacAttgcgcacg-3' that concentration is 50nM, and other reagent and reaction conditions, step are with embodiment 1.
Peripheral blood in patients DNA detects with sequencing simultaneously, and described reagent and reaction conditions are with embodiment 1.
2), the results are summarized in lower list 3,4
The genotypic homogeneous phase of ERCC1 gene C odon118 single nucleotide polymorphism C detects:
Table 3. sample, the positive and negative control react whole liquid FP value average (means) and standard deviation (S.D.)
* data represent with FP value average (means) ± standard deviation (S.D).
These results show FITC fluorescence polarization FP value of the present invention and ERCC1 (118) single nucleotide polymorphism has good dependency, negative control pGEM-T-ERCC1-118T/T fluorescence polarization FP value and positive control lowest detection lower limit pGEM-T-ERCC1-118 C/C fluorescence polarization FP value have significant distributional difference.Lowest detection lower limit positive control reacts whole liquid FP value+FP standard deviation (S.D.) (161.3+10.1=171.4) < negative control and reacts whole liquid FP average-FP standard deviation (S.D.) (193.8-16.5=177.3), positive threshold value Cut-off=lowest detection lower limit positive control FP
Average (means)=161.3, negative threshold value Cut-off=lowest detection lower limit positive control FP average (means)+FP standard deviation (S.D.)=161.3+ 10.1=171.4, this method is highly sensitive, lowest detection lower limit reaches 100 copies/ml, high specificity, even if negative control is up to 10
7copies/ml, there is false positive results not yet, therefore result accordingly, judge that the ERCC1 gene C odon118 site of patient penta peripheral blood DNA sample is without C genotype, the ERCC1 gene C odon118 site of patient's fourth, own peripheral blood DNA sample contains C genotype, this judgement consistent with sequencing result (scheming slightly).
The genotypic homogeneous phase of ERCC1 gene C odon118 single nucleotide polymorphism T detects:
Table 4. sample, the positive and negative control react whole liquid FP value average (means) and standard deviation (S.D.)
* data represent with FP value average (means) ± standard deviation S.D.
These results show of the present invention
r110fluorescence polarization FP value and ERCC1 (118) single nucleotide polymorphism have good dependency, and negative control pGEM-T-ERCC1-118C/C fluorescence polarization FP value and positive control lowest detection lower limit pGEM-T-ERCC1-118T/T fluorescence polarization FP value have significant distributional difference.Lowest detection lower limit positive control reacts whole liquid FP value+FP standard deviation (S.D.) (161.3+10.2=171.5) < negative control and reacts whole liquid FP average-FP standard deviation (S.D.) (193.2-14.9=178.3), and positive threshold value Cut-off=lowest detection lower limit positive control FP is equal
Value (means)=161.3, negative threshold value Cut-off=lowest detection lower limit positive control FP average (means)+FP standard deviation (S.D.)=161.3+ 10.2=171.5, this method is highly sensitive, lowest detection lower limit reaches 100 copies/ml, high specificity, even if negative control is up to 10
7copies/ml, there is false positive results not yet, therefore result accordingly, judge that the ERCC1 gene C odon118 site of patient's fourth peripheral blood DNA sample is without T genotype, the ERCC1 gene C odon118 site of patient penta, own peripheral blood DNA sample contains T genotype, this judgement consistent with sequencing result (scheming slightly).
Our method successfully detects ERCC1 gene C odon118 single nucleotide polymorphism C/C, T/T and C/T genotype, and demonstrates this method accuracy by gene sequencing.Prove that this method detects peripheral blood DNA ERCC1 Codon118 single nucleotide polymorphism accurately and reliably, be suitable for clinical detection.
Embodiment 3
Biological study: on normal human peripheral blood ERCC1 gene ll8 bit codon, the homogeneous phase of C/T single nucleotide polymorphism detects
1), materials and methods
Extract 1, No. 2 blood donor's peripheral blood 1 milliliter, use TIANamp Genomic DNA Kit test kit (sky root is biological, Beijing) to carry out peripheral blood sample DNA extraction, the extraction of genomic dna, to specifications procedure operation.
The homogeneous phase of ERCC1 gene C odon118 C single nucleotide polymorphism detects: get positive and negative reference standards and 1, No. 2 blood donor's peripheral blood DNA template 5 μ L respectively and add reaction reagent 50 μ L and increase: described reagent comprises the fluorescence labeling probe 5'ROX-caaattcccagggcacgttgcgcac-3' of concentration 50nM, and other reagent and reaction conditions, step are with embodiment 1.
The homogeneous phase of ERCC1 gene C odon118 T single nucleotide polymorphism detects: the DNA profiling 5 μ L getting positive and negative reference standards and No. 1 blood donor's peripheral blood respectively adds reaction reagent 50 μ L and increases: described reagent comprises the fluorescence labeling probe 5'BTR-caaattcccagggcacAttgcgcac-3' that concentration is 50nM, and other reagent and reaction conditions, step are with embodiment 1.
Blood donor's peripheral blood DNA detects with sequencing simultaneously, and described reagent and reaction conditions are with embodiment 1.
2), the results are summarized in lower list 5,6
The genotypic homogeneous phase of ERCC1 gene C odon118 single nucleotide polymorphism C detects:
Table 5. sample, the positive and negative control react whole liquid FP value average (means) and standard deviation (S.D.)
* data represent with FP value average (means) ± standard deviation (S.D).
These results show ROX fluorescence polarization FP value of the present invention and ERCC1 (118) single nucleotide polymorphism has good dependency, negative control pGEM-T-ERCC1-118T/T fluorescence polarization FP value and positive control lowest detection lower limit pGEM-T-ERCC1-118 C/C fluorescence polarization FP value have significant distributional difference.Lowest detection lower limit positive control reacts the reaction of whole liquid FP value+FP standard deviation (S.D.) (131.3+8.3=139.6) < negative control
Whole liquid FP average-FP standard deviation (S.D.) (154.7-12.4=142.3), positive threshold value Cut-off=lowest detection lower limit positive control FP average (means)=131.3, negative threshold value Cut-off=lowest detection lower limit positive control FP average (means)+FP standard deviation (S.D.)=131.3+8.3=139.6, this method is highly sensitive, lowest detection lower limit reaches 100 copies/ml, high specificity, even if negative control is up to 10
7copies/ml, there is false positive results not yet, therefore result accordingly, judge that the ERCC1 gene C odon118 site of No. 2 peripheral blood DNA samples is without C genotype, the ERCC1 gene C odon118 site of No. 1 peripheral blood DNA sample contains C genotype, this judgement consistent with sequencing result (scheming slightly).
The genotypic homogeneous phase of ERCC1 gene C odon118 single nucleotide polymorphism T detects:
Table 6. sample, the positive and negative control react whole liquid FP value average (means) and standard deviation (S.D.)
* data represent with FP value average (means) ± standard deviation S.D.
These results show BTR fluorescence polarization FP value of the present invention and ERCC1 (118) single nucleotide polymorphism has good dependency, negative control pGEM-T-ERCC1-118C/C fluorescence polarization FP value and positive control lowest detection lower limit pGEM-T-ERCC1-118T/T fluorescence polarization FP value have significant distributional difference.Lowest detection lower limit positive control reacts whole liquid FP value+FP standard deviation (S.D.) (170.6+12.3=182.9) < negative control and reacts whole liquid FP average-FP standard deviation (S.D.) (199.3 ± 17.6=181.7), and positive threshold value Cut-off=lowest detection lower limit positive control FP is equal
Value (means)=170.6, negative threshold value Cut-off=lowest detection lower limit positive control FP average (means)+FP standard deviation (S.D.)=170.6+12.3=182.9, this method is highly sensitive, lowest detection lower limit reaches 100 copies/ml, high specificity, even if negative control is up to 10
7copies/ml, there is false positive results not yet, therefore result accordingly, judge that the ERCC1 gene C odon118 site of No. 1 peripheral blood DNA sample is without T genotype, the ERCC1 gene C odon118 site of No. 2 peripheral blood DNA samples contains T genotype, this judgement consistent with sequencing result (scheming slightly).
Our method successfully detects ERCC1 gene C odon118 single nucleotide polymorphism C/C, T/T genotype, and demonstrates its accuracy by gene sequencing method.Prove that this method detects peripheral blood DNA ERCC1 Codon118 single nucleotide polymorphism accurately and reliably, be suitable for biological experiment.
Embodiment 4
Biological study: on normal human peripheral blood ERCC1 gene ll8 bit codon, the homogeneous phase of C/T single nucleotide polymorphism detects
1), materials and methods
Extract 3, No. 4 blood donor's peripheral bloods 1 milliliter, use TIANamp Genomic DNA Kit test kit (sky root is biological, Beijing) to carry out peripheral blood sample DNA extraction, the extraction of genomic dna, to specifications procedure operation.
The homogeneous phase of ERCC1 gene C odon118 C single nucleotide polymorphism detects: get positive and negative reference standards and 3, No. 4 blood donor's peripheral blood DNA template 5 μ L respectively and add reaction reagent 50 μ L and increase: described reagent comprises the fluorescence labeling probe 5'TET-caaattcccagggcacgttgcgc-3' of concentration 50nM, and other reagent and reaction conditions, step are with embodiment 1.
The homogeneous phase of ERCC1 gene C odon118 T single nucleotide polymorphism detects: get positive and negative reference standards and 3 respectively, the DNA profiling 5 μ L of No. 4 blood donor's peripheral bloods adds reaction reagent 50 μ L and increases: described reagent comprises the fluorescence labeling probe 5'HEX-caaattcccagggcacAttgcgc-3' that concentration is 50nM, and other reagent and reaction conditions, step are with embodiment 1.
Blood donor's peripheral blood DNA detects with sequencing simultaneously, and described reagent and reaction conditions are with embodiment 1.
2), the results are summarized in lower list 7,8
The genotypic homogeneous phase of ERCC1 gene C odon118 single nucleotide polymorphism C detects:
Table 7. sample, the positive and negative control react whole liquid FP value average (means) and standard deviation (S.D.)
* data represent with FP value average (means) ± standard deviation (S.D).
These results show TET fluorescence polarization FP value of the present invention and ERCC1 (118) single nucleotide polymorphism has good dependency, negative control pGEM-T-ERCC1-118T/T fluorescence polarization FP value and positive control lowest detection lower limit pGEM-T-ERCC1-118 C/C fluorescence polarization FP value have significant distributional difference.Lowest detection lower limit positive control reacts whole liquid FP value+FP standard deviation (S.D.) (134.3+10.6=144.9)
< negative control reacts whole liquid FP average-FP standard deviation (S.D.) (169.1-11.9=157.2), positive threshold value Cut-off=lowest detection lower limit positive control FP average (means)=134.3, negative threshold value Cut-off=lowest detection lower limit positive control FP average (means)+FP standard deviation (S.D.)=134.3+10.6=144.9, this method is highly sensitive, lowest detection lower limit reaches 100 copies/ml, high specificity, even if negative control is up to 10
7copies/ml, there is false positive results not yet, therefore result accordingly, judge that the ERCC1 gene C odon118 site of No. 4 peripheral blood DNA samples is without C genotype, the ERCC1 gene C odon118 site of No. 3 peripheral blood DNA samples contains C genotype, this judgement consistent with sequencing result (scheming slightly).
The genotypic homogeneous phase of ERCC1 gene C odon118 single nucleotide polymorphism T detects:
Table 8. sample, the positive and negative control react whole liquid FP value average (means) and standard deviation (S.D.)
* data represent with FP value average (means) ± standard deviation S.D.
These results show HEX fluorescence polarization FP value of the present invention and ERCC1 (118) single nucleotide polymorphism has good dependency, negative control pGEM-T-ERCC1-118C/C fluorescence polarization FP value and positive control lowest detection lower limit pGEM-T-ERCC1-118T/T fluorescence polarization FP value have significant distributional difference.Lowest detection lower limit positive control reacts whole liquid FP value+FP standard deviation (S.D.) (182.9+16.7=199.6)
< negative control reacts whole liquid FP average-FP standard deviation (S.D.) (221.2-19.3=201.9), positive threshold value Cut-off=lowest detection lower limit positive control FP average (means)=170.6, negative threshold value Cut-off=lowest detection lower limit positive control FP average (means)+FP standard deviation (S.D.)=182.9-16.7=166.2, this method is highly sensitive, lowest detection lower limit reaches 100 copies/ml, high specificity, even if negative control is up to 10
7copies/ml, there is false positive results not yet, judge that the ERCC1 gene C odon118 site of No. 3 peripheral blood DNA samples is without T genotype, the ERCC1 gene C odon118 site of No. 4 peripheral blood DNA samples contains T genotype, this judgement consistent with sequencing result (scheming slightly).
Our method successfully detects ERCC1 gene C odon118 single nucleotide polymorphism C/C, T/T genotype, and demonstrates the accuracy of the method by gene sequencing method.Prove that this method detects peripheral blood DNA ERCC1 Codon118 polymorphism accurately and reliably, be suitable for experiment and clinical detection.
Embodiment 5
Biological study: on normal human peripheral blood ERCC1 gene ll8 bit codon, the homogeneous phase of C/T single nucleotide polymorphism detects
1), materials and methods
Extract 5, No. 6 blood donor's peripheral bloods 1 milliliter, use TIANamp Genomic DNA Kit test kit (sky root is biological, Beijing) to carry out peripheral blood sample DNA extraction, the extraction of genomic dna, to specifications procedure operation.
The homogeneous phase of ERCC1 gene C odon118 C single nucleotide polymorphism detects: get positive and negative reference standards and 5, No. 6 blood donor's peripheral blood DNA template 5 μ L respectively and add reaction reagent 50 μ L and increase: described reagent comprises the fluorescence labeling probe 5'TET-caaattcccag of concentration 50nM
Ggcacgttgcg-3', other reagent and reaction conditions, step are with embodiment 1.
The homogeneous phase of ERCC1 gene C odon118 T single nucleotide polymorphism detects: get positive and negative reference standards and 5 respectively, the DNA profiling 5 μ L of No. 6 blood donor's peripheral bloods adds reaction reagent 50 μ L and increases: described reagent comprises the fluorescence labeling probe 5'HEX-caaattcccagggcacAttgcg-3' that concentration is 50nM, and other reagent and reaction conditions, step are with embodiment 1.
Blood donor's peripheral blood DNA detects with sequencing simultaneously, and described reagent and reaction conditions are with embodiment 1.
2), the results are summarized in lower list 9,10
The genotypic homogeneous phase of ERCC1 gene C odon118 single nucleotide polymorphism C detects:
Table 9. sample, the positive and negative control react whole liquid FP value average (means) and standard deviation (S.D.)
* data represent with FP value average (means) ± standard deviation (S.D).
These results show TET fluorescence polarization FP value of the present invention and ERCC1 (118) single nucleotide polymorphism has good dependency, negative control pGEM-T-ERCC1-118T/T fluorescence polarization FP value and positive control lowest detection lower limit pGEM-T-ERCC1-118 C/C fluorescence polarization FP value have remarkable distributional difference.Lowest detection lower limit positive control reacts the reaction of whole liquid FP value+FP standard deviation (S.D.) (138.8+13.3=152.1) < negative control
Whole liquid FP average-FP standard deviation (S.D.) (172.5-13.3=159.2), positive threshold value Cut-off=lowest detection lower limit positive control FP average (means)=138.8, negative threshold value Cut-off=lowest detection lower limit positive control FP average (means)+FP standard deviation (S.D.)=138.8+13.3
=152.1, this method is highly sensitive, lowest detection lower limit reaches 100 copies/ml, high specificity, even if negative control is up to 10
7copies/ml, there is false positive results not yet, judge that the ERCC1 gene C odon118 site of No. 6 peripheral blood DNA samples is without C genotype, the ERCC1 gene C odon118 site of No. 5 peripheral blood DNA samples contains C genotype, this judgement consistent with sequencing result (scheming slightly).
The genotypic homogeneous phase of ERCC1 gene C odon118 single nucleotide polymorphism T detects:
Table 10. sample, the positive and negative control react whole liquid FP value average (means) and standard deviation (S.D.)
* data represent with FP value average (means) ± standard deviation S.D.
These results show HEX fluorescence polarization FP value of the present invention and ERCC1 (118) single nucleotide polymorphism has good dependency, negative control pGEM-T-ERCC1-118C/C fluorescence polarization FP value and positive control lowest detection lower limit pGEM-T-ERCC1-118T/T fluorescence polarization FP value have significant distributional difference.Lowest detection lower limit positive control reacts whole liquid FP value+FP standard deviation (S.D.) (191.7+17.4=209.1)
< negative control reacts whole liquid FP average-FP standard deviation (S.D.) (239.2-21.4=217.8), positive threshold value Cut-off=lowest detection lower limit positive control FP average (means)=191.7, negative threshold value Cut-off=lowest detection lower limit positive control FP average (means)+FP standard deviation (S.D.)=191.7+17.4=209.1, this method is highly sensitive, lowest detection lower limit reaches 100 copies/ml, high specificity, even if negative control is up to 10
7copies/ml, there is false positive results not yet, judge that the ERCC1 gene C odon118 site of No. 5 peripheral blood DNA samples is without T genotype, the ERCC1 gene C odon118 site of No. 6 peripheral blood DNA samples contains T genotype, this judgement consistent with sequencing result (scheming slightly).
Our method successfully detects ERCC1 gene C odon118 single nucleotide polymorphism C/C, T/T genotype, and demonstrates the accuracy of this method by gene sequencing method.Prove that this method detects peripheral blood DNA ERCC1 Codon118 single nucleotide polymorphism accurately and reliably, be suitable for biological experiment.
Embodiment 6
Biological study: cervical cancer patient organizes C/T single nucleotide polymorphism homogeneous phase on ERCC1 gene ll8 bit codon to detect
1), materials and methods
Extract 1 milliliter, No. 1,2, cervical cancer patient tissue, use TIANamp Genomic DNA Kit test kit (sky root is biological, Beijing) to carry out tissue sample DNA extraction, the extraction of genomic dna, to specifications procedure operation.
The homogeneous phase of ERCC1 gene C odon118 C single nucleotide polymorphism detects: get positive and negative reference standards and cervical cancer patient 1, No. 2 tissue DNA template 5 μ L respectively and add reaction reagent 50 μ L and increase: described reagent comprises the fluorescence labeling probe 5'TET-caaattcccagggcacgttgc-3' of concentration 50nM, and other reagent and reaction conditions, step are with embodiment 1.
The homogeneous phase of ERCC1 gene C odon118 T single nucleotide polymorphism detects: the DNA profiling 5 μ L getting positive and negative reference standards and No. 1,2, cervical cancer patient tissue respectively adds reaction reagent 50 μ L and increases: described reagent comprises the fluorescence labeling probe 5'HEX-caaattcccagggcacAttgc-3' that concentration is 50nM, and other reagent and reaction conditions, step are with embodiment 1.
Tissue DNA detects with sequencing simultaneously, and described reagent and reaction conditions are with embodiment 1.
2), the results are summarized in lower list 11,12
The genotypic homogeneous phase of ERCC1 gene C odon118 single nucleotide polymorphism C detects:
Table 11. sample, the positive and negative control react whole liquid FP value average (means) and standard deviation (S.D.)
* data represent with FP value average (means) ± standard deviation (S.D).
These results show TET fluorescence polarization FP value of the present invention and ERCC1 (118) single nucleotide polymorphism has good dependency, negative control pGEM-T-ERCC1-118T/T fluorescence polarization FP value and positive control lowest detection lower limit pGEM-T-ERCC1-118 C/C fluorescence polarization FP value have significant distributional difference.Lowest detection lower limit positive control reacts whole liquid FP value+FP standard deviation (S.D.) (141.8+13.6=155.4)
< negative control reacts whole liquid FP average-FP standard deviation (S.D.) (179.3-14.5=164.8), positive threshold value Cut-off=lowest detection lower limit positive control FP average (means)=141.8, negative threshold value Cut-off=lowest detection lower limit positive control FP average (means)+FP standard deviation (S.D.)=141.8+13.6=155.4, this method is highly sensitive, lowest detection lower limit reaches 100 copies/ml, high specificity, even if negative control is up to 10
7copies/ml, there is false positive results not yet, judge that the ERCC1 gene C odon118 site of No. 2 tissue DNA samples is without C genotype, the ERCC1 gene C odon118 site of No. 1 tissue DNA sample contains C genotype, this judgement consistent with sequencing result (scheming slightly).
The genotypic homogeneous phase of ERCC1 gene C odon118 single nucleotide polymorphism T detects:
Table 12. sample, the positive and negative control react whole liquid FP value average (means) and standard deviation (S.D.)
* data represent with FP value average (means) ± standard deviation S.D.
These results show HEX fluorescence polarization FP value of the present invention and ERCC1 (118) single nucleotide polymorphism has good dependency, negative control pGEM-T-ERCC1-118C/C fluorescence polarization FP value and positive control lowest detection lower limit pGEM-T-ERCC1-118T/T fluorescence polarization FP value have significant distributional difference.Lowest detection lower limit positive control reacts whole liquid FP value+FP standard deviation (S.D.) (190.3+14.6=204.9)
< negative control reacts whole liquid FP average-FP standard deviation (S.D.) (227.3-22.1=205.2), positive threshold value Cut-off=lowest detection lower limit positive control FP average (means)=190.3, negative threshold value Cut-off=lowest detection lower limit positive control FP average (means)+FP standard deviation (S.D.)=190.3+14.6=204.9, this method is highly sensitive, lowest detection lower limit reaches 100 copies/ml, high specificity, even if negative control is up to 10
7copies/ml, there is false positive results not yet, therefore according to the ERCC1 gene C odon118 site of judgement No. 1 tissue DNA sample without T genotype, the ERCC1 gene C odon118 site of No. 2 tissue DNA samples containing T genotype, this judgement consistent with sequencing result (scheming summary).
Our method successfully detects ERCC1 gene C odon118 single nucleotide polymorphism C/C, T/T genotype, and demonstrates the accuracy of this method by gene sequencing method.Prove that this method detects ERCC1 Codon118 single nucleotide polymorphism accurately and reliably, be suitable for and carry out biological experiment.
nucleotides sequence list
Primer sequence is:
Forward primer 5'-cagtccagaacactgggacatgac-3',
Reverse primer 5'-ggtcatccctattgatggcttctg-3',
Codon118 C/C genotype probe sequence is
5'-ccaaattcccagggcacgttgcgcacg-3'，
5'-caaattcccagggcacgttgcgcacg-3'，
5'-caaattcccagggcacgttgcgcac-3'，
5'-caaattcccagggcacgttgcgc-3'，
5'-caaattcccagggcacgttgcg-3'，
5'-caaattcccagggcacgttgc-3'。
Codon118 T/T genotype probe sequence is
5'-ccaaattcccagggcacAttgcgcacg-3'，
5'-caaattcccagggcacAttgcgcacg-3'，
5'-caaattcccagggcacAttgcgcac-3'，
5'-caaattcccagggcacAttgcgc-3'，
5'-caaattcccag?ggcacAttgcg-3'，
5'-caaattcccagggcacAttgc-3'。
sequence table
<110> the Fourth Military Medical University of P.L.A.
<120> is based on the ERCC1 gene ll8 bit codon Codon118 single nucleotide polymorphism homogeneous assay of fluorescence polarization
<160>?15
<170>?PatentIn?Version3.5
<210>?1
<211>25
<212>?DNA
<213> artificial sequence
<400> forward primer
cagtccagaacactgggacatgac
<210>?2
<211>?25
<213> artificial sequence
<400> reverse primer
ggtcatccctattgatggcttctg
<210>?3
<211>?28
<212>?DNA
<213> artificial sequence
<400> probe
ccaaattcccagggcacgttgcgcacg
<210>?4
<211>?27
<212>?DNA
<213> artificial sequence
<400> probe
caaattcccagggcacgttgcgcacg
<210>?5
<211>?25
<212>?DNA
<213> artificial sequence
<400> probe
caaattcccagggcacgttgcgcac
<210>?6
<211>?24
<212>?DNA
<213> artificial sequence
<400> probe
caaattcccagggcacgttgcgc
<210>?7
<211>23
<212>?DNA
<213> artificial sequence
<400> probe
caaattcccagggcacgttgcg
<210>?8
<211>?22
<212>?DNA
<213> artificial sequence
<400> probe
caaattcccagggcacgttgc
<210>?9
<211>?28
<212>?DNA
<213> artificial sequence
<400> probe
ccaaattcccagggcacAttgcgcacg
<210>?10
<211>?27
<212>?DNA
<213> artificial sequence
<400> probe
caaattcccagggcacAttgcgcacg
<210>?11
<211>?26
<212>?DNA
<213> artificial sequence
<400> probe
caaattcccagggcacAttgcgcac
<210>?12
<211>?25
<212>?DNA
<213> artificial sequence
<400> probe
caaattcccagggcacAttgcgc
<210>?13
<211>?24
<212>?DNA
<213> artificial sequence
<400> probe
caaattcccagggcacAttgcg
<210>?14
<211>?23
<212>?DNA
<213> artificial sequence
<400> probe
caaattcccagggcacAttgc
Claims (6)
1. the homogeneous assay for ERCC1 gene ll8 bit codon Codon118 single nucleotide polymorphism in working sample, described homogeneous assay comprises the following steps: that (1) obtains extract from sample: use a kind of reagent or test kit to extract genomic dna from testing sample, and purifying, obtain the extract of purifying, (2) amplified reaction: the extract of above-mentioned purifying is added reaction reagent and carry out amplification combination, described reaction reagent comprises the PCR damping fluid of 10 times, and concentration is respectively the dNTP of 2.0 ~ 2.5mmol/L, the MgCl of 2.0 ~ 3.5mmol/L
2the Taq DNA polymerase of 1-5U/ μ l, concentration is the universal primer that ERCC1 gene the 4th exon of 0.2-2.0 μm of ol/L contains ll8 bit codon Codon118 single nucleotide polymorphism district DNA, and concentration is the fluorescently-labeled DNA probe of band of the ERCC1 gene C odon118 C/T single nucleotide polymorphism of 0.05-0.2 μm of ol/L, described reaction conditions is: after 94-96 DEG C of sex change 4-10min, hatch 5-40 second for 95 DEG C, hatch 15-60 second for 53-63 DEG C, hatch 10-60 second for 72 DEG C, 35-45 circulation, last incubated at room, (3) detect: the fluorescence polarization FP value of detection reaction solution, SPSS computed in software FP average and standard deviation, t inspection statistics is cloudy, positive control reacts whole liquid FP Distribution value: lowest detection lower limit positive control reacts whole liquid FP average+FP standard deviation < negative control and reacts whole liquid FP average-FP standard deviation, positive threshold value Cut-off=lowest detection lower limit positive control reacts whole liquid FP average, negative threshold value Cut-off=lowest detection lower limit positive control reacts whole liquid FP average+FP standard deviation, more namely testing sample FP value and Cut-off value know ERCC1 gene C odon118 single nucleotide polymorphism:
The negative threshold value Cut-off value of testing sample FP value >, it is non-homogeneous that target site and institute in reaction add corresponding fluorescently-labeled probe sequence,
The positive threshold value Cut-off value of testing sample FP value <, target site adds corresponding fluorescently-labeled probe sequence homology to institute in reaction,
The positive threshold value Cut-off value of testing sample FP value >, but testing sample FP value < feminine gender threshold value Cut-off simultaneously, then target site state cannot judge, need again detect;
Wherein, the universal primer that ERCC1 gene the 4th exon contains ll8 bit codon Codon118 single nucleotide polymorphism district DNA is: forward primer 5'-cagtccagaacactgggacatgac-3', reverse primer 5'-ggtcatccctattgatggcttctg-3', Codon118 C/C genotype probe sequence is 5'-ccaaattcccagggcacgttgcgcacg-3', or 5'-caaattcccagggcacgttgcgcacg-3', or 5'-caaattcccagggcacgttgcgcac-3', or 5'-caaattcccagggcacgttgcgc-3', or 5'-caaattcccagggcacgttgcg-3', or 5'-caaattcccagggcacgttgc-3', Codon118 T/T genotype probe sequence is 5'-ccaaattcccagggcacAttgcgcacg-3', or 5'-caaattcccagggcacAttgcgcacg-3', or 5'-caaattcccagggcacAttgcgcac-3', or 5'-caaattcccagggcacAttgcgc-3', or 5'-caaattcccag ggcacAttgcg-3', or 5'-caaattcccagggcacAttgc-3',
Present method is not used in medical diagnosis on disease object.
2. the detection method of claim 1, wherein step (1) comprising: in reagent or test kit, carry out process obtain genomic dna; The reagent of wherein said acquisition genomic dna or test kit are the DNA extraction liquid of inner protein enzyme K, cell pyrolysis liquid, and include the reagent of phenol/chloroform, ethanol or DNA purifying DEAE resin or DNA adsorption column, the DNA reclaimed is increased by PCR, in pcr amplification process, ERCC1 gene the 4th exon is contained ll8 bit codon Codon118 single nucleotide polymorphism and is remained unchanged.
3. the detection method of claim 1, wherein said primer is general forward primer, the reverse primer that ERCC1 gene the 4th exon contains ll8 bit codon Codon118 single nucleotide polymorphism district DNA, the fluorescently-labeled probe of described band is the probe that ERCC1 gene the 4th exon contains ll8 bit codon Codon118 single nucleotide polymorphism homology, and it can be combined with obtained amplicon and change to produce the fluorescence polarization value that can detect; Fluorescence polarization instrument detects the whole liquid of described each reaction to obtain fluorescence polarization measurement value; And by fluorescence polarization measurement value compared with characterized fluorescence polarization values, described characterized fluorescence polarization values is control reaction whole liquid FP average, Cut-off value.
4. the detection method of claim 1, wherein said fluorescent mark is tetramethylrhodamine, or Fluoresceincarboxylic acid, rhodamine, fluorescein isothiocyanate, Tetrachlorofluorescein, chlordene fluorescein, ROX, BTR.
5. the detection method of claim 1, it comprises the steps: to provide multiple ERCC1 gene ll8 bit codon Codon118 single nucleotide polymorphism to contrast further: ERCC1 Codon118 C/C positive control pGEM-T-ERCC1-C/C, ERCC1 Codon118 T/T positive control pGEM-T-ERCC1-118T/T, and intersect negative control each other, namely pGEM-T-ERCC1-C/C is the negative control of ERCC1 Codon118T/T, pGEM-T-ERCC1-118T/T is the negative control of ERCC1 Codon118 C/C, each sun, negative control solution has different concentration known, each positive and negative contrast adds amplification association reaction reagent and reacts, and the fluorescence polarization value measuring the whole liquid of each described control reaction is to provide multiple fluorescence polarization values corresponding to known ERCC1 Codon118 single nucleotide polymorphism, meets: lowest detection lower limit positive control reacts whole liquid FP average+FP standard deviation < negative control and reacts whole liquid FP average-FP standard deviation.
6. implement the claims the test kit of detection method any one of 1-5, it comprises DNA extraction reagent, DNA purified reagent, amplification binding reagents, and positive and negative contrast, primer and specific probe, wherein said primer and specific probe are: forward primer 5'-cagtccagaacactgggacatgac-3', reverse primer 5'-ggtcatccctattgatggcttctg-3', Codon118 C/C genotype probe sequence is 5'-ccaaattcccagggcacgttgcgcacg-3', or 5'-caaattcccagggcacgttgcgcacg-3', or 5'-caaattcccagggcacgttgcgcac-3', or 5'-caaattcccagggcacgttgcgc-3', or 5'-caaattcccagggcacgttgcg-3', or 5'-caaattcccagggcacgttgc-3', Codon118 T/T genotype probe sequence is 5'-ccaaattcccagggcacAttgcgcacg-3', or 5'-caaattcccagggcacAttgcgcacg-3', or 5'-caaattcccagggcacAttgcgcac-3', or 5'-caaattcccagggcacAttgcgc-3', or 5'-caaattcccag ggcacAttgcg-3', or 5'-caaattcccagggcacAttgc-3'.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210127673.4A CN102676661B (en) | 2012-04-27 | 2012-04-27 | Fluorescent polarization based homogeneous phase detection method of single nucleotide polymorphism of codon118 of ERCC1 (excision repair cross-complementing 1) gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210127673.4A CN102676661B (en) | 2012-04-27 | 2012-04-27 | Fluorescent polarization based homogeneous phase detection method of single nucleotide polymorphism of codon118 of ERCC1 (excision repair cross-complementing 1) gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102676661A CN102676661A (en) | 2012-09-19 |
| CN102676661B true CN102676661B (en) | 2014-12-31 |
Family
ID=46809210
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210127673.4A Expired - Fee Related CN102676661B (en) | 2012-04-27 | 2012-04-27 | Fluorescent polarization based homogeneous phase detection method of single nucleotide polymorphism of codon118 of ERCC1 (excision repair cross-complementing 1) gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102676661B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106834458A (en) * | 2017-01-19 | 2017-06-13 | 中国人民解放军第四军医大学 | The method of the homogeneous exons mutation index of detection EGFR allele 19 |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104988146A (en) * | 2015-06-30 | 2015-10-21 | 广州金域医学检验中心有限公司 | Primer and method for detecting ERCC1 gene polymorphism |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1596314A (en) * | 2000-12-01 | 2005-03-16 | 应答遗传公司 | Method of determining a chemotherapeutic regimen based on ercc1 and ts expression |
| CN1636069A (en) * | 2000-12-01 | 2005-07-06 | 应答遗传公司 | Method of determining a chemotherapeutic regimen based on ERCCI expression |
| CN101424639A (en) * | 2006-09-27 | 2009-05-06 | 广东省人民医院 | Platinum medicament curative effect predicting kit and use thereof |
| CN101698886A (en) * | 2009-11-10 | 2010-04-28 | 广州益善生物技术有限公司 | Liquid phase chip for detecting mRNA expression of gene associated with treatment effect of carboplatin and detection method |
| CN102154475A (en) * | 2011-01-28 | 2011-08-17 | 中国人民解放军第二军医大学 | Kit for detecting ERCC1 mRNA (Excision Repair Cross Complement Group 1 Messenger Ribonucleic Acid) expression by using fluorescence quantitative PCR (Polymerase Chain Reaction) technology |
-
2012
- 2012-04-27 CN CN201210127673.4A patent/CN102676661B/en not_active Expired - Fee Related
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1596314A (en) * | 2000-12-01 | 2005-03-16 | 应答遗传公司 | Method of determining a chemotherapeutic regimen based on ercc1 and ts expression |
| CN1636069A (en) * | 2000-12-01 | 2005-07-06 | 应答遗传公司 | Method of determining a chemotherapeutic regimen based on ERCCI expression |
| CN101424639A (en) * | 2006-09-27 | 2009-05-06 | 广东省人民医院 | Platinum medicament curative effect predicting kit and use thereof |
| CN101698886A (en) * | 2009-11-10 | 2010-04-28 | 广州益善生物技术有限公司 | Liquid phase chip for detecting mRNA expression of gene associated with treatment effect of carboplatin and detection method |
| CN102154475A (en) * | 2011-01-28 | 2011-08-17 | 中国人民解放军第二军医大学 | Kit for detecting ERCC1 mRNA (Excision Repair Cross Complement Group 1 Messenger Ribonucleic Acid) expression by using fluorescence quantitative PCR (Polymerase Chain Reaction) technology |
Non-Patent Citations (1)
| Title |
|---|
| 非小细胞肺癌患者外周血ERCC1 单核苷酸多态性与顺铂化疗疗效的相关性;李晓惠等;《中华肿瘤防治杂志》;20100214;第17卷(第3期);第170页左栏第1段倒数第1-3行、右栏第3-4段 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106834458A (en) * | 2017-01-19 | 2017-06-13 | 中国人民解放军第四军医大学 | The method of the homogeneous exons mutation index of detection EGFR allele 19 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102676661A (en) | 2012-09-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103074434B (en) | CYP2C19 gene polymorphyism detection kit and detection method thereof | |
| CN104232781B (en) | TaqMan probe real-time fluorescence PCR (Polymerase Chain Reaction) method for detecting HLA (Human Leukocyte Antigen)-B*5801 alleles | |
| CN103667514B (en) | A kind of human interleukin 2 8B gene pleiomorphism fluorescence PCR detection reagent kits | |
| CN102925562B (en) | Kit and method for detecting aminoglycoside drug-induced deafness-sensitive gene | |
| BR112012023698B1 (en) | MULTIPLEX TESTS, METHOD AND KIT FOR IDENTIFYING AND DIFFERENTIATING MRSA, MSSA, MRSE, MSSE, MSSE, MRCNS OR MSCNS | |
| CN108441553A (en) | It is a kind of it is accurate detection ALDH2 gene pleiomorphisms kit and its application | |
| CN104830852A (en) | Multiplex real-time fluorescent PCR (polymerase chain reaction) method for detecting HLA-B*15:02 alleles | |
| CN103074435B (en) | Kit for synchronously detecting related gene expression levels of 14 antineoplastic drugs and detection method of kit | |
| CN105586422A (en) | Kit for detecting TERT gene promoter mutation, and detection method and application of kit | |
| CN104293932A (en) | Method for detecting HLA-B * 5801 allele based on real-time fluorescence PCR | |
| CN102676661B (en) | Fluorescent polarization based homogeneous phase detection method of single nucleotide polymorphism of codon118 of ERCC1 (excision repair cross-complementing 1) gene | |
| CN106148516A (en) | A kind of test kit for detecting the sudden change of TERT gene promoter and detection method and application | |
| CN103103259A (en) | Method, kit and primers for determining whether two predetermined loci of nucleic acid sample mutate or not | |
| CN104313124A (en) | Specific primer for detecting bovine IGF-1 genes, fluorescent quantitative PCR detection kit of bovine GHR genes, and detection method and application of kit | |
| CN103993089A (en) | Vancomycin-resistant enterococcus multiplex fluorescence quantitative PCR (polymerase chain reaction) detection kit and detection method thereof | |
| WO2020134950A1 (en) | Gene mutation/fusion combination and kit for identification of benign and malignant pulmonary nodules | |
| CN103074438A (en) | Multi-gene detection kit for guiding administration of warfarin and detection method of multi-gene detection kit | |
| CN105506068A (en) | AMRMS-qPCR detection kit and detection method for MMP2 genotyping | |
| CN103305600B (en) | Kit for synchronously detecting related gene expression level of 14 antitumor drugs by using paraffin embedding biopsy sample, and detection method thereof | |
| CN103725787B (en) | Fluorescent PCR (Polymerase Chain Reaction) detection kit for fusion genes of leukemia | |
| CN102399858A (en) | Detection method for DNA point mutation based on fluorescent quenching release | |
| CN105316426A (en) | TPMT (thiopurine S-methyltransferase) genetic polymorphism detection kit | |
| CN104630377A (en) | Breast cancer miRNA detection kit and application of miRNA thereof | |
| CN104531866A (en) | Biomarker used for colorectal cancer | |
| CN103966310A (en) | Rapid detection kit and detection method for breast cancer susceptibility genes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20141231 Termination date: 20180427 |