CN107326086A - A kind of ADH2*2 genotype detections kit and its detection method - Google Patents
A kind of ADH2*2 genotype detections kit and its detection method Download PDFInfo
- Publication number
- CN107326086A CN107326086A CN201710684516.6A CN201710684516A CN107326086A CN 107326086 A CN107326086 A CN 107326086A CN 201710684516 A CN201710684516 A CN 201710684516A CN 107326086 A CN107326086 A CN 107326086A
- Authority
- CN
- China
- Prior art keywords
- adh2
- genes
- types
- reference product
- positive reference
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A kind of ADH2*2 genotype detections kit and its detection method, it is characterised in that：Including KOD archaeal dna polymerases, sense primer, anti-sense primer, selectively targeted fluorescence probe, GG type positive references product, AA type positive reference product and AG type positive reference product；The homozygous DNA sequence dnas of GG are the linear recombinant DNA sequences of one section designed by template of the site GG types of people ADH2*2 genes 143；The homozygous DNA sequence dnas of AA are the linear recombinant DNA sequences of one section designed by template of the site AA types of people ADH2*2 genes 143；AG type positive reference product are to be formed by GG type positive reference product with AA type positive reference product by isometric mixed preparing.The detection method of the present invention can quickly, easily detect the variation in the site of ADH2*2 genes the 143rd.
Description
Technical field
The present invention relates to technical field of molecular biology, and in particular to a kind of ADH2*2 genotype detections kit and its inspection
Survey method, the kit uses PCR amplification in vitro methods, for acetaldehyde dehydrogenase ADH2*2 in qualitative detection people's whole blood sample the
The gene pleiomorphism in 143 sites.
Background technology
Alcohol dehydrogenase（Alcohol dehydrogenase, abbreviation ADH）The entitled ethanol of system：DPN redox
Enzyme（alcohol：NAD+ oxidoreductase）, largely it is present among humans and animals liver, plant and microbial cell,
It is a kind of zinc-containing metal enzyme, with extensive substrate specificity.In people and mammal body, alcohol dehydrogenase（ADH）With second
Aldehyde dehydrogenase（ALDH）Alcohol dehydrogenase enzyme system is constituted, internal alcohol metabolism is participated in, is metabolic enzyme important in humans and animals body.
Alcohol dehydrogenase ADH2*2（G143A）It is responsible for the ethanol decomposition metabolism of catalysis human body, ADH enzymatic activity enhancing can accelerate second
Alcohol is converted to acetaldehyde, and ADH2*2 (G143A) gene pleiomorphism causes the individual alcohol metabolism energy for carrying ADH2*2 allele
Power declines.Therefore, qualitative detection ADH2 gene pleiomorphism, can be used for screening alcohol metabolism ability crowd.
The method of clinical or test in laboratory ADH2 gene pleiomorphisms includes PCR- direct sequencings, PCR- pyrophosphoric acids at present
PCR sequencing PCR, fluorescence quantitative PCR method, PCR- gene chips, PCR- electrophoretic analysis, PCR- high-resolution melting curves method, equipotential
Gene specific PCR methods, PCR- RFLPs method, in situ hybridization（ISH）Etc. a variety of methods.
PCR- direct sequencings are also referred to as PCR-Sanger sequencings.The operating process of PCR-Sanger PCR sequencing PCRs mainly includes
PCR is expanded and PCR primer purifying, sequencing reaction, four key steps of sequencing and interpretation of result.This method belongs to qualitative detection.
It is main not enough：Sensitivity is not high, especially when carrying out tumor tissues somatic mutation detection, when target gene is mutated in tissue
When ratio is less than 20%, in fact it could happen that false negative result；There is particular/special requirement to reagent and instrument, be difficult popularization；Complex operation, into
This is of a relatively high, and speed is slow, flux is low.
PCR- pyrosequencings method need to design the sequencing primer of a biotin labeling, when primer is moved back with single-stranded template DNA
, will under archaeal dna polymerase, ATP sulfurylases, the synergy of 4 kinds of enzymes of luciferase and apyrase after fire
Each dNTP polymerization and the release coupling of first order fluorescence signal are got up on primer, by detecting release and the intensity of fluorescence,
Reach the purpose of the real time measure DNA sequence dna.Major defect：There is particular/special requirement to reagent and instrument, be difficult popularization；Detection sensitivity
It is limited, to the low abundance somatic mutation in tumor tissues（<3%）Easily there is false negative；Sequencing length base only more than 10,
Long segment can not be analyzed.
Real-time fluorescence PCR method can be divided into two kinds of sonde method and non-sonde method, and the former utilizes the spy with target sequence specific hybridization
Pin（Taqman and molecular beacon）To indicate the increase of amplified production, the latter is referred to using fluorescent dye or the primer of particular design
Show the increase of amplified production.The sensitivity of real-time fluorescence PCR method is high, and parting is accurate, and simple and efficient to handle, instrument is easily general
And, it is easy to promote the use of.But this method flux is not high, probe cost is higher, and the testing cost of Single locus is relevant with sample size,
Sample size is smaller, and cost is higher.This method is primarily adapted for carrying out parting to a small amount of site, large sample.
PCR- gene chips are regularly arranged using specific oligonucleotide fragment as probe, by it is fixed on support
On thing, then sample DNA is expanded by PCR, the program such as fluorescence labeling, by base pairing principle and chip hybridization, then pass through
Fluorescence detecting system is detected and analyzed to the fluorescence signal on chip, so as to obtain the genotype information of individual rapidly.Should
Method is used to belong to qualitative detection during DNA Genotypings, and sensitivity is 50 ng/ μ L.
PCR- electrophoretic analysis refers to enter target gene fragment to be analyzed performing PCR amplification, and passes through Ago-Gel electricity
Gene polymorphism sites are carried out Genotyping by swimming or capillary electrophoresis analysis according to the size of PCR primer.Needed during PCR
Positive quality control product and negative quality-control product are set up, needs to carry out the judgement of clip size with molecular weight marker simultaneously during electrophoretic analysis.
When molecular weight marker reaction tube is without the weaker band of band or appearance, loading wells leakage, fluorescent dye are included the reason for possible
Not enough or failure, electrophoresis time is long or voltage is excessive.The advantage of this method is that cost is low, can be carried out in common lab；
Have the disadvantage to be only suitable for carry out qualitative determination to DNA insertion/deletions or fusion, it is impossible to be used in SNP detection.
The content of the invention
The present invention is intended to provide a kind of ADH2*2 genotype detections kit and its detection method, can using the kit
Quickly, the type in the site of ADH2*2 genes the 143rd is easily detected.
To reach above-mentioned purpose, the technical solution adopted by the present invention is：A kind of ADH2*2 genotype detections kit, including
KOD DNA polymerases, sense primer, anti-sense primer, selectively targeted fluorescence probe, GG type positive references product, AA types positive ginseng
Examine product and AG type positive reference product；
The sense primer is the sense primer designed for people ADH2*2 genes, the sequence of sense primer for 5 '-
CCTTCTCCAACACTCTCCACGATGC-3’ （Such as SEQ NO:Shown in 1）；
The anti-sense primer is the anti-sense primer designed for people ADH2*2 genes, the sequence of anti-sense primer for 5 '-
GAATCTGAACAGCTTCTCTTTATTCTGTAGA-3’ （Such as SEQ NO:Shown in 2）；
The selectively targeted fluorescence probe is the probe of the specific pairs sequence with someone's ADH2*2 genes, its base sequence
For 5 '-TCTGTCGCACAGATGACCAC-3 '（Such as SEQ NO:Shown in 3）, fluorescent dye is the pyrroles of fluorine boron two；
The GG types positive reference product are a kind of solution using the homozygous DNA sequence dnas of GG as main component, the homozygous DNA of GG
Sequence is the linear recombinant DNA sequence of one section designed by template of the site GG types of people ADH2*2 genes 143, the homozygous DNA of GG
Sequence is 5 '-TCTTTTCTGAATCTGAACAGCTTCTCTTTATTCTGTAGATGGTGGCTGTAGGAATC TGTCGCACAGAT
GACCACGTGGTTAGTGGCAACCTGGTGACCCCCCTTCCTGTGATTTTAGGCCATGAGGCAGCCGGCATCGTGGAGAG
TGTTGGAGAAGGGGT-3’ （Such as SEQ NO:Shown in 4）, wherein, the base position with underscore is people's ADH2*2 genes
143 sites, the GG types that 143 site is used to characterize people's ADH2*2 genes can be mutated the position of the AA types for people's ADH2*2 genes
Put；
The AA types positive reference product are a kind of solution using the homozygous DNA sequence dnas of AA as main component, the homozygous DNA of AA
Sequence is the linear recombinant DNA sequence of one section designed by template of the site AA types of people ADH2*2 genes 143, the homozygous DNA of AA
Sequence is 5 '-TCTTTTCTGAATCTGAACAGCTTCTCTTTATTCTGTAGATGGTGGCTGTAGGAATC TGTCACACAGAT
GACCACGTGGTTAGTGGCAACCTGGTGACCCCCCTTCCTGTGATTTTAGGCCATGAGGCAGCCGGCATCGTGGAGAG
TGTTGGAGAAGGGGT-3’ （Such as SEQ NO:Shown in 5）, wherein, the base position with underscore is people's ADH2*2 genes
143 sites, the AA types that 143 site is used to characterize people's ADH2*2 genes can be mutated the position of the GG types for people's ADH2*2 genes
Put；
The AG types positive reference product are to be matched somebody with somebody by the GG types positive reference product with AA type positive reference product by isometric mix
System is formed, and the concentration for the homozygous DNA sequence dnas of GG that the GG types positive reference product contain contains equal to the AA types positive reference product
The concentration of some homozygous DNA sequence dnas of AA.
Relevant content in above-mentioned technical proposal is explained as follows：
1st, in such scheme, KOD archaeal dna polymerases are the hyperthermophilic separated from the sulfur-bearing stomata of the small treasured island of Kagoshima Prefecture
Original bacteria Thermococcus kodakaraensis KOD1 extraction purifications come out, with very strong 3' → 5' Exonucleolytics
Enzymatic activity (proofreading activity), fidelity is about 50 times of Taq DNA Polymerase.DNA synthesis with more than 1Kb/30s
Speed, the speed is twice of Taq polymerase the most common.In addition, it is also its elongation that processivity etc. is more outstanding
The one of the main reasons of speed quickly.Using KOD archaeal dna polymerases, the time of one cycle can be made to be contracted from original a few minutes
Short is tens seconds.Production company is TOYOBO companies, and its structure is referring to Japan Patent JP2008306935A.
2nd, in such scheme, the selectively targeted fluorescence probe is QProbe, by the specific arrangement of mixing, will be had
The fluorchrome of this feature of fluorescent quenching as mark probe.QProbe structure is referring to Japan Patent
JP2011097956A, using this feature, just without using the pigment of other double-strandednucleic acid structures such as insertion DNA intercalators,
Without using two kinds of probes of FRET phenomenons can be caused, and the probe that mark is made in a kind of fluorescent material is used in, not
While High-Speed Amplification being hindered, target nucleic acid sequence can be specifically detected.
3rd, in such scheme, preferably scheme is containing the dense of the homozygous DNA sequence dnas of GG in the GG types positive reference product
Spend for 500 copy/microlitre, in the AA types positive reference product concentration containing the homozygous DNA sequence dnas of AA be 500 copy/microlitre,
The concentration containing the homozygous DNA sequence dnas of GG and the homozygous DNA sequence dnas of AA is 500 copies/micro- in the AG types positive reference product
Rise.The process for preparation of GG type positive reference product and AA type positive reference product is about that first DNA sequence dna is building up on vector plasmid
Preserve, buffer reagent dilution is added, so as to be configured to GG type positive reference product and AA type positive reference product.Buffer reagent can be with
Any one of TE buffer solutions for pH7.6 Tris-HCl buffer solutions, purified water and pH 7.6 etc..
The ADH2*2 genotype detections kit also includes positive quality control product, and positive quality control product is one kind with base sequence
For the reagent of main component, the base sequence is by isometric by the GG types positive reference product with AA type positive reference product
Mixed preparing is formed, and it is 1000 that the positive quality control product, which contains the homozygous DNA sequence dnas of GG and the concentration of the homozygous DNA sequence dnas of AA,
Copy/microlitre.
The positive quality control product is prior sample designed, as concentration known and base sequence, and other are tested
Sample is detected that it is supported the use as a part for kit with other reagents, for user's checking testing result together
Accuracy.
4th, in such scheme, the GG types positive reference product, AA type positive reference product and AG type positive reference product contain
There is prior designed, concentration known base sequence, and other tested samples are detected together, are mainly used in giving birth in manufacturer
Technical staff to kit carry out quality testing.Detect the positive reference of 3 kinds of genotype respectively using the reagent in kit
Product（That is GG types positive reference product, AA type positive reference product and AG type positive reference product）, testing result should be corresponding gene type.
To reach above-mentioned purpose, a kind of ADH2*2 genotype detection methods of the invention comprise the following steps：
The first step, prepares tested sample, to be detected sample as the object of detection, is detected sample behaviour whole blood；
Second step, using the tested sample as templet gene chain, fluorescence is carried out using the ADH2*2 genotype detections kit
Quantitative pcr amplification reaction, fluorescent quantitative PCR reaction reaction system be：
Sense primer 0.1 μm of ol/L, 1.4 to 2.8 μ L；
Anti-sense primer 0.1 μm of ol/L, 1.4 to 2.8 μ L；
Selectively targeted 0.1 μm of ol/L of fluorescence probe, 1.0 to 2.0 μ L；
MgCl2*6H2O 0.35g/L, 1.4 to 2.8 μ L；
DNTPs 0.02mM, 0.4 to 0.8 μ L；
KOD DNA polymerase 0.02U/ μ L, 0.4 to 0.8 μ L；
The μ L of KOD buffer 3.2 to 6.4；
The μ of template 4 to 8 L；
3rd step, is detected, detection condition is followed successively by with high-resolution melting curve method：
（1）94.0 DEG C, 30.0 seconds,
（2）39.0 DEG C, 30.0 seconds,
（3）40.0 ~ 75.0 DEG C, 0.09 DEG C/sec；
4th step, detection result judges that the basis for estimation of three kinds of results of positive cutoff value is by positive cutoff value：
（1）143 sites of ADH2*2 genes are GG homozygotes：It is molten where fluorescence differential value >=10, and melting curve peak value
Temperature is solved between 61.5 DEG C ~ 65.5 DEG C；
（2）143 sites of ADH2*2 genes are AA homozygotes：It is molten where fluorescence differential value >=10, and melting curve peak value
Temperature is solved between 54 DEG C ~ 58.5 DEG C；
（3）143 sites of ADH2*2 genes are AG heterozygotes：There are 2 melting curve peaks, the fluorescence at one of melting curve peak
Melting temperature where differential value >=10 and melting curve peak value between 54 DEG C ~ 58.5 DEG C, another melting curve peak it is glimmering
Melting temperature where light differential value >=10 and melting curve peak value is between 61.5 DEG C~65.5 DEG C.
1st, in such scheme, the dNTPs is deoxyadenosine triphosphate（dATP）, the phosphorus of deoxycytidine three（dCTP）, deoxidation
GTP（dGTP）, thymidine triphosphoric acid（dTTP）Mixture.
2nd, in such scheme, the course of reaction of the fluorescent quantitative PCR reaction of the second step is as follows：
（1）94.0 DEG C of pre-degenerations 30.0 seconds,
（2）97.0 DEG C are denatured 1.0 seconds,
（3）60.0 DEG C are annealed 3.0 seconds,
（4）63.0 DEG C extend 5.0 seconds, wherein, step（2）~（4）Circulation 50 times.
3rd, in such scheme, in the first step, people's whole blood of collection is diluted after 10 ~ 50 times with sample lysate,
It is used as the tested sample；Wherein, the sample lysate is made up of buffer solution and purified water, the body of buffer solution and purified water
Product is than being 1：99, buffer solution is the Tris-HCl buffer solutions that pH is 7.6.
4th, in such scheme, high-resolution fusion curve（High-resolution melt, HRM) analytical technology is near several
A kind of newest genetic analysis method for being mutated scanning and Genotyping risen abroad over year, is a kind of based on monokaryon
Thuja acid melting temperature is different and forms the genetic analysis new technology of different shape melting curve, with high sensitiveness, can be with
The difference of single base is detected, and cost is low, flux is high, speed is fast, result is accurate, the limitation in not examined site, it is real
Real stopped pipe operation is showed.
The present invention design principle be：The kit of the present invention is expanded using PCR amplification in vitro methods to target nucleic acid,
And use selectively targeted fluorescence probe（QProbe）Acetaldehyde takes off in the method for detecting target nucleic acid, qualitative detection people's whole blood sample
Hydrogen enzyme ADH2*2（G143A）Gene pleiomorphism.Using people ADH2*2 gene coding region as template, add corresponding upstream and draw
Thing and anti-sense primer, KOD archaeal dna polymerases are catalyzed each primer extension gene strand.By the annealing of primer repeatedly, extend to expand
The nucleic acid fragment of gaining.Afterwards, amplification of nucleic acid and the selectively targeted fluorescence of the specific pairs sequence with ADH2*2 genes
Probe hybridization is combined, and ADH2*2 genotype is detected by parsing the change of fluorescence.
The kit and detection method of the present invention uses the KOD archaeal dna polymerases with High-Speed Amplification ability to be expanded,
The simple selectively targeted fluorescence probe of design（Q- probes）Can quickly, easy ADH2*2 genes are detected.Meanwhile,
Totally enclosed amplification can prevent from carrying the generation for the false positive results that pollution etc. is caused.In addition, adding positive matter in reaction system
Control product, it will be appreciated that the influence that the obstructive substance of clinical sample is reacted PCR, further prevent that the vacation of ADH2*2 genetic tests is cloudy
Property.
Beneficial effect of the present invention：
（1）The amount of existing PCR reaction systems generally requires 40 μ L, and the amount of the fluorescent quantitative PCR reaction system of the present invention
Minimum is only 13.2 μ L.
（2）The fluorescent quantitative PCR reaction time of the present invention is greatly shortened, and be denatured, anneal, extending 50 time are circulated most
It is low only to need 0.5 hour to complete.
（3）Existing ADH2*2 genotype detections kit needs to preserve under the conditions of -20 DEG C, and the kit of the present invention
It can be preserved under the conditions of 2 ~ 8 DEG C.
（4）The present invention can prevent from carrying the generation that pollution etc. causes false positive results using totally enclosed PCR amplifications.
In a word, detection method of the invention can quickly, easily detect the type in the site of ADH2*2 genes the 143rd.This
The kit of invention can be the height with high activity alcohol dehydrogenase 2 for the testing result of ADH2*2 (G143A) genotype
Danger crowd is provided assistance in diagnosis, and reference is provided for clinical individual diagnostic agent.
Brief description of the drawings
Accompanying drawing 1 is fluorescent quantitative PCR melting curve figure when 143 sites of people's ADH2*2 genes are GG types, horizontal seat
Mark is temperature, and ordinate is fluorescence differential value；
Accompanying drawing 2 is fluorescent quantitative PCR melting curve figure when 143 sites of people's ADH2*2 genes are AA types, and abscissa is
Temperature, ordinate is fluorescence differential value；
Accompanying drawing 3 is fluorescent quantitative PCR melting curve figure when 143 sites of people's ADH2*2 genes are AG types, and abscissa is
Temperature, ordinate is fluorescence differential value；
Fluorescent quantitative PCR melting curve figure when accompanying drawing 4 is blank control, abscissa is temperature, and ordinate is that fluorescence is micro-
Score value.
Embodiment
Below in conjunction with the accompanying drawings and embodiment the invention will be further described：
Embodiment：A kind of ADH2*2 genotype detections kit and its detection method
The ADH2*2 genotype detections kit includes KOD DNA polymerases, sense primer, anti-sense primer, selectively targeted
Fluorescence probe, GG type positive references product, AA type positive reference product and AG type positive reference product；
The sense primer is the sense primer designed for people ADH2*2 genes, the sequence of sense primer for 5 '-
CCTTCTCCAACACTCTCCACGATGC-3’；
The anti-sense primer is the anti-sense primer designed for people ADH2*2 genes, the sequence of anti-sense primer for 5 '-
GAATCTGAACAGCTTCTCTTTATTCTGTAGA-3’；
The selectively targeted fluorescence probe is the probe of the specific pairs sequence with someone's ADH2*2 genes, its base sequence
For 5 '-TCTGTCGCACAGATGACCAC-3 ', fluorescent dye is the pyrroles of fluorine boron two；
The GG types positive reference product are a kind of solution using the homozygous DNA sequence dnas of GG as main component, the homozygous DNA of GG
Sequence is the linear recombinant DNA sequence of one section designed by template of the site GG types of people ADH2*2 genes 143, the homozygous DNA of GG
Sequence is 5 '-TCTTTTCTGAATCTGAACAGCTTCTCTTTATTCTGTAGATGGTGGCTGTAGGAATC TGTCGCACAGAT
GACCACGTGGTTAGTGGCAACCTGGTGACCCCCCTTCCTGTGATTTTAGGCCATGAGGCAGCCGGCATCGTGGAGAG
TGTTGGAGAAGGGGT-3 ', wherein, the base position with underscore is 143 sites of people's ADH2*2 genes, described 143
The GG types that point is used to characterize people's ADH2*2 genes can be mutated the position of the AA types for people's ADH2*2 genes；The GG types positive reference
Concentration containing the homozygous DNA sequence dnas of GG in product for 500 copies/microlitre；
The AA types positive reference product are a kind of solution using the homozygous DNA sequence dnas of AA as main component, the homozygous DNA of AA
Sequence is the linear recombinant DNA sequence of one section designed by template of the site AA types of people ADH2*2 genes 143, the homozygous DNA of AA
Sequence is 5 '-TCTTTTCTGAATCTGAACAGCTTCTCTTTATTCTGTAGATGGTGGCTGTAGGAATC TGTCACACAGAT
GACCACGTGGTTAGTGGCAACCTGGTGACCCCCCTTCCTGTGATTTTAGGCCATGAGGCAGCCGGCATCGTGGAGAG
TGTTGGAGAAGGGGT-3 ', wherein, the base position with underscore is 143 sites of people's ADH2*2 genes, described 143
The AA types that point is used to characterize people's ADH2*2 genes can be mutated the position of the GG types for people's ADH2*2 genes；The AA types positive reference
Concentration containing the homozygous DNA sequence dnas of AA in product for 500 copies/microlitre；
The AG types positive reference product are to be matched somebody with somebody by the GG types positive reference product with AA type positive reference product by isometric mix
System is formed, and the concentration for the homozygous DNA sequence dnas of GG that the GG types positive reference product contain contains equal to the AA types positive reference product
It is homozygous containing the homozygous DNA sequence dnas of GG and AA in the concentration of some homozygous DNA sequence dnas of AA, the AG types positive reference product
The concentration of DNA sequence dna be 500 copies/microlitre.
The ADH2*2 genotype detections kit also includes positive quality control product, and positive quality control product is one kind with base sequence
For the reagent of main component, the base sequence is by isometric by the GG types positive reference product with AA type positive reference product
Mixed preparing is formed, and it is 1000 that the positive quality control product, which contains the homozygous DNA sequence dnas of GG and the concentration of the homozygous DNA sequence dnas of AA,
Copy/microlitre.
In actual production, the ADH2*2 genotype detections kit can make the kit comprising following component：
（1）It polymerize enzymatic reagent [KOD Mix]：It is made up of KOD archaeal dna polymerases, dNTP etc., specification is 140 μ L × 2,140 μ L
× 4 or 140 μ L × 6；
（2）Primed probe reagent [ADH2*2 Mix]：I.e. by sense primer, anti-sense primer and selectively targeted fluorescence probe
The mix reagent of composition, specification is 140 μ L × 1,140 μ L × 2 or 140 μ L × 3；
（3）GG type positive references product, AA type positive reference product and AG type positive reference product, specification is 100 μ L × 1；
（4）Positive quality control product, specification is 150 μ L × 1.
Wherein, the DNA sequence dna in GG types positive reference product, AA type positive reference product and AG type positive reference product is structure
It is built on vector plasmid and preserves, original plasmid is purchased in raw work bioengineering（Shanghai）Limited company, vector plasmid is built
Process belongs to prior art, and detailed process is as follows：
--- --- DNA fragmentation --- positive gram of carrier construction --- conversion culture --- is reclaimed in rubber tapping to design of primers for PCR amplifications
--- 37 DEG C of shaking table culture --- plasmid extraction --- sequencings confirm base sequence for grand identification.
Plasmid after extracting is configured to the GG types positive reference product again, and compound method is as follows：
（1）Prepared and diluted liquid：Add purified water → addition Tris-HCl buffer solutions of 50% formula ratio（pH7.6）→ add residue
Purified water（Be vortexed concussion 3 times, every time 5 seconds）→ 0.002mol/L Tris-HCl（pH 7.6）Dilution；
（2）The site GG homozygosis vector plasmid pre-dilution of people ADH2*2 genes 143：Add the dilution of 50% formula ratio → plus
Enter the site GG homozygosis vector plasmid solution of people ADH2*2 genes 143 → remaining dilution of addition（Be vortexed concussion 3 times, often
Secondary 5 seconds）→ obtain the site GG homozygosis plasmid solutions of X copy/microlitre people ADH2*2 genes 143（X represents the specific number of plasmid concentration
Value）；
（3）Obtain GG type positive reference product：Add dilution → addition X copy/microlitre people's ADH2*2 genes of 50% formula ratio
The 143 site GG homozygosis plasmid solutions → remaining dilution of addition（Be vortexed concussion 3 times, every time 5 seconds）→ obtain GG types positive ginseng
Examine product.
Plasmid after extracting is configured to the AA types positive reference product again, and compound method is as follows：
（1）Prepared and diluted liquid：Add purified water → addition Tris-HCl buffer solutions of 50% formula ratio（pH7.6）→ add residue
Purified water（Be vortexed concussion 3 times, every time 5 seconds）→ 0.002mol/L Tris-HCl（pH 7.6）Dilution；
（2）The site AA homozygosis vector plasmid pre-dilution of people ADH2*2 genes 143：Add the dilution of 50% formula ratio → plus
Enter the site AA homozygosis vector plasmid solution of people ADH2*2 genes 143 → remaining dilution of addition（Be vortexed concussion 3 times, often
Secondary 5 seconds）→ obtain the site AA homozygosis plasmid solutions of X copy/microlitre people ADH2*2 genes 143（X represents the specific number of plasmid concentration
Value）；
（3）Obtain AA type positive reference product：Add dilution → addition X copy/microlitre people's ADH2*2 genes of 50% formula ratio
The 143 site AA homozygosis plasmid solutions → remaining dilution of addition（Be vortexed concussion 3 times, every time 5 seconds）→ obtain AA types positive ginseng
Examine product.
ADH2*2 genotype detection methods comprise the following steps：
The first step, prepares tested sample, to be detected sample as the object of detection, is detected sample behaviour whole blood；Dissolved with sample
Liquid dilutes people's whole blood of collection after 25 times, is used as the tested sample；Wherein, the sample lysate is by buffer solution and pure
Change water to constitute, the volume ratio of buffer solution and purified water is 1：99, buffer solution is pH7.6 Tris-HCl buffer solutions；
Second step, using the tested sample as templet gene chain, fluorescent quantitative PCR reaction is carried out using the kit,
Fluorescent quantitative PCR reaction reaction system be：
Sense primer 0.1 μm of ol/L, 1.4 to 2.8 μ L；
Anti-sense primer 0.1 μm of ol/L, 1.4 to 2.8 μ L；
Selectively targeted 0.1 μm of ol/L of fluorescence probe, 1.0 to 2.0 μ L；
MgCl2*6H2O 0.35g/L, 1.4 to 2.8 μ L；
DNTPs 0.02mM, 0.4 to 0.8 μ L；
KOD DNA polymerase 0.02U/ μ L, 0.4 to 0.8 μ L；
The μ L of KOD buffer 3.2 to 6.4；
The μ of template 4 to 8 L；
In the reaction system that above-mentioned fluorescent quantitative PCR is reacted, on the premise of the concentration of each component is constant, each group
Point volumetric usage at most can be that 2 times of above-mentioned numerical value, the i.e. volume used of sense primer are 2.8 μ L, anti-sense primer it is used
Volume is 2.8 μ L, and the volume used of selectively targeted fluorescence probe is 2.0 μ L, MgCl2*6H2O volume used is 2.8 μ L,
DNTPs volume used be 0.8 μ L, KOD DNA polymerases volume used be 0.8 μ L, KOD buffer volume used be
6.4 μ L, the volume used of template is 8 μ L；
The course of reaction of the fluorescent quantitative PCR reaction is as follows：
（1）94.0 DEG C of pre-degenerations 30.0 seconds,
（2）97.0 DEG C are denatured 1.0 seconds,
（3）60.0 DEG C are annealed 3.0 seconds,
（4）63.0 DEG C extend 5.0 seconds, wherein, step（2）~（4）Circulation 50 times；
3rd step, is detected, detection condition is followed successively by with high-resolution melting curve method：
（1）94.0 DEG C, 30.0 seconds,
（2）39.0 DEG C, 30.0 seconds,
（3）40.0 ~ 75.0 DEG C, 0.09 DEG C/sec；
Directly in mdk gene analyzer GENECUBE（Manufacturer is TOYOBO）It is upper progress fluorescent quantitative PCR reaction and
Detection.Concretely comprise the following steps：By the tested μ L of sample 4, polymerization enzymatic reagent [KOD Mix] 4 μ L, primed probe reagent [ADH2*2
Mix] 5.2 μ L mixing after, be modulated into reaction solution.Special suction pipe draws reaction solution into special plastic capillary.Progress is expanded instead
Should.Detected, determine the fluorescent value that wavelength is 510nm ~ 550nm.The fluorescent value of measure is parsed by dedicated analysis software, conversion
Into the fluorescence differential value for representing change in fluorescence amount.Fluorescence differential value is parsed, measurement result is shown on a display screen.
4th step, detection result judges that the basis for estimation of three kinds of results of positive cutoff value is by positive cutoff value：
（1）143 sites of ADH2*2 genes are GG homozygotes：It is molten where fluorescence differential value >=10, and melting curve peak value
Temperature is solved between 61.5 DEG C ~ 65.5 DEG C, referring to shown in accompanying drawing 1；
（2）143 sites of ADH2*2 genes are AA homozygotes：It is molten where fluorescence differential value >=10, and melting curve peak value
Temperature is solved between 54 DEG C ~ 58.5 DEG C, referring to shown in accompanying drawing 2；
（3）143 sites of ADH2*2 genes are AG heterozygotes：There are 2 melting curve peaks, the fluorescence at one of melting curve peak
Melting temperature where differential value >=10 and melting curve peak value between 54 DEG C ~ 58.5 DEG C, another melting curve peak it is glimmering
Melting temperature where light differential value >=10 and melting curve peak value is between 61.5 DEG C~65.5 DEG C, referring to shown in accompanying drawing 3.
The fluorescence differential value refers to that the value that the fluorescence intensity of the object to detecting is varied with temperature does differential derivation, obtains
Fluorescence differential value.
In the above-described embodiments, the concentration containing the homozygous DNA sequence dnas of GG, AA types are positive in the GG types positive reference product
Contain the homozygous DNA sequence dnas of GG and AA in concentration and AG type positive reference product containing the homozygous DNA sequence dnas of AA in reference material
The concentration of homozygous DNA sequence dna be 500 copies/microlitre, under the concentration implementation result preferably, but in the art above-mentioned sun
Property reference material in DNA sequence dna concentration 500 ~ 5000 copy/microlitre in the range of can be carried out.Similarly, positive quality control product contains
Have the concentration of the homozygous DNA sequence dnas of GG and the homozygous DNA sequence dnas of AA 500 ~ 5000 copies/microlitre in the range of can be carried out.
In addition, when being diluted to people's whole blood, above-described embodiment is exemplified by diluting 25 times, in the practical operation of this area, to use sample
People's whole blood of collection is diluted 10 ~ 50 times and can be carried out as tested sample by this lysate.
The above embodiments merely illustrate the technical concept and features of the present invention, and its object is to allow person skilled in the art
Scholar can understand present disclosure and implement according to this, and it is not intended to limit the scope of the present invention.It is all according to the present invention
The equivalent change or modification that Spirit Essence is made, should all be included within the scope of the present invention.
SEQUENCE LISTING
<110>Step on stone biotechnology（Suzhou）Co., Ltd
<120>A kind of ADH2*2 genotype detections kit and its detection method
<130>
<160> 5
<170> PATENTIN VERSION 3.5
<210> 1
<211> 25
<212> DNA
<213>Artificial sequence
<400> 1
ccttctccaacactctccacgatgc 25
<210> 2
<211> 31
<212> DNA
<213>Artificial sequence
<400> 2
gaatctgaacagcttctctttattctgtaga 31
<210> 3
<211> 20
<212> DNA
<213>Artificial sequence
<400> 3
tctgtcgcacagatgaccac 20
<210> 4
<211> 160
<212> DNA
<213>Artificial sequence
<400> 4
tcttttctgaatctgaacagcttctctttattctgtagatggtggctgtaggaatctgtcgcacagatgacca
cgtggttagtggcaacctggtgaccccccttcctgtgattttaggccatgaggcagccggcatcgtggagagtgttg
gagaaggggt 160
<210> 5
<211> 160
<212> DNA
<213>Artificial sequence
<400> 5
tcttttctgaatctgaacagcttctctttattctgtagatggtggctgtaggaatctgtcacacagatgacca
cgtggttagtggcaacctggtgaccccccttcctgtgattttaggccatgaggcagccggcatcgtggagagtgttg
gagaaggggt 160
Claims (6)
1. a kind of ADH2*2 genotype detections kit, it is characterised in that：Including KOD DNA polymerases, sense primer, downstream
Primer, selectively targeted fluorescence probe, GG type positive references product, AA type positive reference product and AG type positive reference product；
The sense primer is the sense primer designed for people ADH2*2 genes, the sequence of sense primer for 5 '-
CCTTCTCCAACACTCTCCACGATGC-3’；
The anti-sense primer is the anti-sense primer designed for people ADH2*2 genes, the sequence of anti-sense primer for 5 '-
GAATCTGAACAGCTTCTCTTTATTCTGTAGA-3’；
The selectively targeted fluorescence probe is the probe of the specific pairs sequence with someone's ADH2*2 genes, its base sequence
For 5 '-TCTGTCGCACAGATGACCAC-3 ', fluorescent dye is the pyrroles of fluorine boron two；
The GG types positive reference product are a kind of solution using the homozygous DNA sequence dnas of GG as main component, the homozygous DNA of GG
Sequence is the linear recombinant DNA sequence of one section designed by template of the site GG types of people ADH2*2 genes 143, the homozygous DNA of GG
Sequence is 5 '-TCTTTTCTGAATCTGAACAGCTTCTCTTTATTCTGTAGATGGTGGCTGTAGGAATC TGTCGCACAGAT
GACCACGTGGTTAGTGGCAACCTGGTGACCCCCCTTCCTGTGATTTTAGGCCATGAGGCAGCCGGCATCGTGGAGAG
TGTTGGAGAAGGGGT-3 ', wherein, the base position with underscore is 143 sites of people's ADH2*2 genes, described 143
The GG types that point is used to characterize people's ADH2*2 genes can be mutated the position of the AA types for people's ADH2*2 genes；
The AA types positive reference product are a kind of solution using the homozygous DNA sequence dnas of AA as main component, the homozygous DNA of AA
Sequence is the linear recombinant DNA sequence of one section designed by template of the site AA types of people ADH2*2 genes 143, the homozygous DNA of AA
Sequence is 5 '-TCTTTTCTGAATCTGAACAGCTTCTCTTTATTCTGTAGATGGTGGCTGTAGGAATC TGTCACACAGAT
GACCACGTGGTTAGTGGCAACCTGGTGACCCCCCTTCCTGTGATTTTAGGCCATGAGGCAGCCGGCATCGTGGAGAG
TGTTGGAGAAGGGGT-3 ', wherein, the base position with underscore is 143 sites of people's ADH2*2 genes, described 143
The AA types that point is used to characterize people's ADH2*2 genes can be mutated the position of the GG types for people's ADH2*2 genes；
The AG types positive reference product are to be matched somebody with somebody by the GG types positive reference product with AA type positive reference product by isometric mix
System is formed, and the concentration for the homozygous DNA sequence dnas of GG that the GG types positive reference product contain contains equal to the AA types positive reference product
The concentration of some homozygous DNA sequence dnas of AA.
2. a kind of ADH2*2 genotype detections kit according to claim 1, it is characterised in that：The ADH2*2 genotype
Detection kit also includes positive quality control product, and positive quality control product is a kind of reagent using base sequence as main component, the alkali
Basic sequence is to be formed by the GG types positive reference product with AA type positive reference product by isometric mixed preparing, the positive matter
The concentration that control product contain the homozygous DNA sequence dnas of GG and the homozygous DNA sequence dnas of AA be 500 ~ 5000 copies/microlitre.
3. a kind of ADH2*2 genotype detections kit according to claim 1, it is characterised in that：The GG types positive ginseng
Examine concentration containing the homozygous DNA sequence dnas of GG in product for 500 ~ 5000 copies/microlitre, contain AA in the AA types positive reference product
The concentration of homozygous DNA sequence dna be 500 ~ 5000 copy/microlitre, in the AG types positive reference product contain the homozygous DNA sequences of GG
Row and the homozygous DNA sequence dnas of AA concentration be 500 ~ 5000 copy/microlitre.
4. a kind of ADH2*2 genotype detection methods, it is characterised in that：Comprise the following steps：
The first step, prepares tested sample, to be detected sample as the object of detection, is detected sample behaviour whole blood；
Second step, using the tested sample as templet gene chain, is carried out glimmering using kit described in claim 1 ~ 3 any one
Fluorescent Quantitative PCR amplified reaction, fluorescent quantitative PCR reaction reaction system be：
Sense primer 0.1 μm of ol/L, 1.4 to 2.8 μ L；
Anti-sense primer 0.1 μm of ol/L, 1.4 to 2.8 μ L；
Selectively targeted 0.1 μm of ol/L of fluorescence probe, 1.0 to 2.0 μ L；
MgCl2*6H2O 0.35g/L, 1.4 to 2.8 μ L；
DNTPs 0.02mM, 0.4 to 0.8 μ L；
KOD DNA polymerase 0.02U/ μ L, 0.4 to 0.8 μ L；
The μ L of KOD buffer 3.2 to 6.4；
The μ of template 4 to 8 L；
3rd step, is detected, detection condition is followed successively by with high-resolution melting curve method：
（1）94.0 DEG C, 30.0 seconds,
（2）39.0 DEG C, 30.0 seconds,
（3）40.0 ~ 75.0 DEG C, 0.09 DEG C/sec；
4th step, detection result judges that the basis for estimation of three kinds of results of positive cutoff value is by positive cutoff value：
（1）143 sites of ADH2*2 genes are GG homozygotes：It is molten where fluorescence differential value >=10, and melting curve peak value
Temperature is solved between 61.5 DEG C ~ 65.5 DEG C；
（2）143 sites of ADH2*2 genes are AA homozygotes：It is molten where fluorescence differential value >=10, and melting curve peak value
Temperature is solved between 54 DEG C ~ 58.5 DEG C；
（3）143 sites of ADH2*2 genes are AG heterozygotes：There are 2 melting curve peaks, the fluorescence at one of melting curve peak
Melting temperature where differential value >=10 and melting curve peak value between 54 DEG C ~ 58.5 DEG C, another melting curve peak it is glimmering
Melting temperature where light differential value >=10 and melting curve peak value is between 61.5 DEG C ~ 65.5 DEG C.
5. a kind of ADH2*2 genotype detection methods according to claim 4, it is characterised in that：The fluorescence of the second step
The course of reaction of quantitative pcr amplification reaction is as follows：
（1）94.0 DEG C of pre-degenerations 30.0 seconds,
（2）97.0 DEG C are denatured 1.0 seconds,
（3）60.0 DEG C are annealed 3.0 seconds,
（4）63.0 DEG C extend 5.0 seconds, wherein, step（2）~（4）Circulation 50 times.
6. a kind of ADH2*2 genotype detection methods according to claim 4, it is characterised in that：In the first step,
People's whole blood of collection is diluted after 10 ~ 50 times with sample lysate, the tested sample is used as；Wherein, the sample lysate
It is made up of buffer solution and purified water, the volume ratio of buffer solution and purified water is 1：99, buffer solution delays for pH7.6 Tris-HCl
Fliud flushing.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710684516.6A CN107326086A (en) | 2017-08-11 | 2017-08-11 | A kind of ADH2*2 genotype detections kit and its detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710684516.6A CN107326086A (en) | 2017-08-11 | 2017-08-11 | A kind of ADH2*2 genotype detections kit and its detection method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107326086A true CN107326086A (en) | 2017-11-07 |
Family
ID=60200297
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710684516.6A Pending CN107326086A (en) | 2017-08-11 | 2017-08-11 | A kind of ADH2*2 genotype detections kit and its detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107326086A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108977499A (en) * | 2018-06-26 | 2018-12-11 | 苏州道尔盾基因科技有限公司 | A kind of detection method and kit of mankind's alcohol metabolism ability gene mutation site |
| CN109943629A (en) * | 2019-03-22 | 2019-06-28 | 踏石生物科技（苏州）有限公司 | A kind of ADRB1 G1165C genotype detection kit and its detection method |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1698897A1 (en) * | 2003-12-19 | 2006-09-06 | Kankyo Engineering Co., Ltd. | Novel mixtures for assaying nucleic acid, novel method of assaying nucleic acid with the use of the same and nucleic acid probe to be used therefor |
| JP2008306935A (en) * | 2007-06-12 | 2008-12-25 | Toyobo Co Ltd | Method for quickly detecting nucleic acid |
| CN102758008A (en) * | 2011-04-28 | 2012-10-31 | 爱科来株式会社 | Method for simultaneously detecting gene mutations of acetaldehyde dehydrogenase 2 and alcohol dehydrogenase 2 |
| CN103849681A (en) * | 2014-01-13 | 2014-06-11 | 宁波海尔施基因科技有限公司 | Primer composition for guiding nitroglycerin medication and healthy drinking, multiple gene detection kit and use method of kit |
| CN105063222A (en) * | 2015-08-28 | 2015-11-18 | 上海美吉生物医药科技有限公司 | Human ADH2 genotype detection kit |
-
2017
- 2017-08-11 CN CN201710684516.6A patent/CN107326086A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1698897A1 (en) * | 2003-12-19 | 2006-09-06 | Kankyo Engineering Co., Ltd. | Novel mixtures for assaying nucleic acid, novel method of assaying nucleic acid with the use of the same and nucleic acid probe to be used therefor |
| JP2008306935A (en) * | 2007-06-12 | 2008-12-25 | Toyobo Co Ltd | Method for quickly detecting nucleic acid |
| CN102758008A (en) * | 2011-04-28 | 2012-10-31 | 爱科来株式会社 | Method for simultaneously detecting gene mutations of acetaldehyde dehydrogenase 2 and alcohol dehydrogenase 2 |
| CN103849681A (en) * | 2014-01-13 | 2014-06-11 | 宁波海尔施基因科技有限公司 | Primer composition for guiding nitroglycerin medication and healthy drinking, multiple gene detection kit and use method of kit |
| CN105063222A (en) * | 2015-08-28 | 2015-11-18 | 上海美吉生物医药科技有限公司 | Human ADH2 genotype detection kit |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108977499A (en) * | 2018-06-26 | 2018-12-11 | 苏州道尔盾基因科技有限公司 | A kind of detection method and kit of mankind's alcohol metabolism ability gene mutation site |
| CN109943629A (en) * | 2019-03-22 | 2019-06-28 | 踏石生物科技（苏州）有限公司 | A kind of ADRB1 G1165C genotype detection kit and its detection method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2011001496A1 (en) | Sample analysis method and assay kit for use in the method | |
| WO2011116313A1 (en) | Methods, kits and compositions for detection of mrsa | |
| CN107164521A (en) | A kind of CYP2C19*2 genotype detections kit and its detection method | |
| CN1252280C (en) | Method of detecting inorganic phosphoric acid, pyrophosphate and nucleic acid, and method of typing snp sequence of DNA | |
| CN107326086A (en) | A kind of ADH2*2 genotype detections kit and its detection method | |
| CN110218772A (en) | A kind of Primer composition, kit, detection method and its application detecting microsatellite instability | |
| CN105907878A (en) | Drug resistance gene mutation detection of tuberculous bacillus based on high-resolution melting curve technology | |
| CN103045716B (en) | Method for detecting isoniazid drug resistance of mycobacterium tuberculosis by using pyrosequencing technology | |
| Zhang et al. | Genotyping of multiple clinical samples with a combined direct PCR and magnetic lateral flow assay | |
| CN106591485A (en) | Nucleic acid composition for detecting ALDH2 gene mutation and its application and kit | |
| CN107267650A (en) | A kind of ALDH2*2 genotype detections kit and its detection method | |
| CN107164522A (en) | A kind of CYP2C19*3 genotype detections kit and its detection method | |
| CN109943629A (en) | A kind of ADRB1 G1165C genotype detection kit and its detection method | |
| CN113106156A (en) | IDH1R132H gene mutation real-time fluorescence quantitative PCR detection reagent and method | |
| CN110241231A (en) | Detect composition, kit, method and the application of CYP2C19 gene pleiomorphism | |
| JP2011004733A (en) | Microarray for detecting target nucleic acid in a plurality of specimens | |
| CN113574180A (en) | Single nucleic acid for real-time detection of genetic variation of single target gene and detection method using same | |
| CN107326087A (en) | Using the site GG types of people ALDH2*2 genes 1510 as the positive reference product of template | |
| CN102943120A (en) | Method for detecting MTHFR (methylenetetrahydrofolate reductase) gene polymorphism | |
| CN111363792B (en) | Kit and method for detecting gene polymorphism based on shared primer probe and application | |
| US20110229893A1 (en) | METHOD OF MEASURING CYTOKERATIN 19 mRNA | |
| Zhang et al. | Visual genotyping from blood and saliva directly based on tracing phosphate ion generated during isothermal amplification | |
| CN107083447A (en) | Using the site GG types of people CYP2C19*2 genes 681 as the positive reference product of template | |
| CN107090511A (en) | Using the site AA types of people CYP2C19*2 genes 681 as the positive reference product of template | |
| CN107267652A (en) | Using the site GG types of people ADH2*2 genes 143 as the positive reference product of template |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20181224 Address after: Osaka Japan Applicant after: Toyo Boseki Address before: 215123 No. 99 Jinjihu Avenue, Suzhou Industrial Park, Jiangsu Province Applicant before: Stepping stone biological technology (Suzhou) Co., Ltd. |
|
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20171107 |