CN103849681A - Primer composition for guiding nitroglycerin medication and healthy drinking, multiple gene detection kit and use method of kit - Google Patents

Abstract

The invention discloses a primer composition for guiding nitroglycerin medication and healthy drinking, a multiple gene detection kit and a use method of the kit, and the kit comprises the primer composition, a PCR buffer solution and a positive reference substance, and the PCR buffer solution comprises ultrapure water, an X solution, a 10*PCR (polymerase chain reaction) buffer solution, a PCR primer, a 25mM magnesium chloride solution and DNA polymerase, the primer composition comprise two forward and reverse amplification primers of different gene types on the 2 SNP sites of genes related to the nitroglycerin medication and healthy drinking and forward and reverse amplification primers capable of reflecting internal reference, the gene sequences of the primers are represented as SEQ ID NO.1-NO.8; the use method comprises the step of acquiring a sample and extracting nucleic acid, the step of performing the PCR reaction by using extracted nucleic acid as a template, and the final step of separating the sample through capillary electrophoresis. The primer composition has the advantages of being strong in specificity, high in accuracy, high in flux, strong in reliability, low in cost and free from false negative result.

Description

A kind of medicine of glonoin and healthy primer sets compound, multiple gene detecting kit and using method thereof of drinking of instructing

Technical field

The present invention relates to a kind of multiple gene detecting kit and detection method thereof, especially relate to a kind of medicine of glonoin and healthy primer sets compound, multiple gene detecting kit and using method thereof of drinking of instructing.

Background technology

Pannonit is nitro vasodilator, is one of special efficacy common drug of control coronary heart disease and angina pectoris.Pannonit and other all can produce active NO free radical in vivo containing nitro medicine (as Sodium Nitroprusside), thereby activate the guanylate cyclase of unstriated muscle and its hetero-organization, increase the synthetic of cGMP.CGMP activates the protein kinase that cGMP relies on, and changes the phosphorylation of different albumen in unstriated muscle, makes myosin (myosin) light chain dephosphorylation.The phosphorylation of known myosin light chain is relevant with the contraction schedule that maintains unstriated muscle, and experimental evidence shows that the pharmacology of nitrovasodilators is identical with blood pressure Endothelium derived relaxing factor (EDRF) (having proved NO or the material containing NO) with biochemical action.It is closely related that research finds that ALDH2 gene and pannonit are converted into NO.If but there is Glu504Lys sudden change in patient ALDH2 gene, will affect the esterase activity of ALDH2, pannonit biotransformation is in vivo obstructed, thereby effectively metabolism pannonit, cause nitrogen protoxide to reduce and even cannot produce nitrogen protoxide, medicine is also just difficult to effectively play a role, and long-time irrelievable stenocardia may develop into Acute Myocardial Infarction, causes life danger.About 1/3rd gook has ALDH2 gene Glu504Lys sudden change, can scientifically instruct patient with angina pectoris to select medicine to the diagnosis of ALDH2 gene pleiomorphism.

Meanwhile, ALDH2 is also one of key gene in alcohol metabolism approach.After alcohol enters in body, first through ethanol dehydrogenase 1B(ADH1B) catalysis, metabolism is acetaldehyde.Acetaldehyde can further be converted into acetic acid under the effect of aldehyde dehydrogenase 2 (ALDH2), and the final metabolism of acetic acid generates CO2 and water, excretes.Acetaldehyde is unstable and easily produce free radical.Acetaldehyde is accumulated and will be caused many tissues and organ as liver, kidney, the heart, brain grievous injury possible carcinogenic, as liver cancer, cancer of the stomach etc.Cancer research mechanism of the World Health Organization was classified as one-level procarcinogen (with flavacin peer) in 2009 alcohol metabolite acetaldehyde.ALDH2 gene occurs after Glu504Lys sudden change, and what coding obtained is not have activated albumen, and acetaldehyde is converted into acetic acid and is obstructed, and can cause acetaldehyde to pile up.ADH1B gene occurs after Arg48His sudden change, and it is 40 to 100 times of wild-type that ethanol conversion becomes the speed of acetaldehyde, can cause acetaldehyde to produce rapidly.Can scientifically instruct health of people to drink to the diagnosis of ALDH2 and ADH1B gene pleiomorphism.

Existingly be mainly gene chip, quantitative fluorescent PCR and Sanger sequencing for single nucleotide polymorphism (SNP) detection method.

(1) qPCR detection method: adopt fluorescent quenching and two end-labelling, design specific probe for SNP Mutation.Its advantage be highly sensitive, accuracy is strong.Its shortcoming is that (1) flux is low: be not suitable for the detection in many SNP site; Be difficult to arrange internal control gene.(2) cost is higher: probe mark cost is high; Obtain all related SNP information if need, need carry out multiple detection tests, stack cost is more expensive.

(2) gene chips: gene chip is to pass through micro-processing technology, by the DNA fragmentation of the particular sequence of ten hundreds of and even 1,000,000 (gene probe), arrange and be fixed on the upholder such as silicon chip, slide regularly, the two-dimentional DNA probe array forming, utilize the biological sample of this class chip and mark to hybridize, can carry out fast qualitative and quantitative analysis to the gene expression profile bioinformation of sample.DNA chip: because the advantages such as high-throughput are widely applied in SNP detects, rely on the difference of wild-type and mutated genes hybridization kinetics to detect mutational site.Its advantage is: (1) high-flux parallel detects; (2) easy and simple to handle quick: whole detection only needs substantially can go out for 4-8 hour result.Shortcoming: 1) the hybridization kinetics difference difference between different SNP site, carry out multidigit point while detecting simultaneously condition be difficult to control; 2) technical costs costliness, complexity: each sample needs a chip, and cost great Yu $1000/ sample, is unfavorable for large-scale promotion; Synthetic and the fixing more complicated of probe, particularly make highdensity probe array, is main rate-limiting step; 3) poor repeatability, accuracy is low, is prone to false positive false negative result; 4) sensitivity is lower: chip method needs nucleic acid amount larger, generally must first do multiplex PCR amplification, because primer is more, easily self produces dimer, hairpin structure, or because Tm value is different, and the object fragment efficiency difference that causes increasing, and then the sensitivity of impact detection; 5), because the kind of chip is more, be difficult to formulate a unified quality control standard.

(3) Sanger(dideoxy chain termination) sequencing: Sanger method is to start at a certain fixing point according to Nucleotide, stop at some specific bases place at random, and after each base, carry out fluorescent mark, produce a series of Nucleotide of four groups of different lengthss that finish with A, T, C, G, then on urea-denatured PAGE glue, electrophoresis detects, thereby obtains visible DNA base sequence.Its advantage is snp analysis gold standard, can find known SNP, also can find unknown SNP.Shortcoming is that each site of each sample all needs through pcr amplification, runs glue, then cuts glue purification, then checks order.Step, disperse, cost is higher more, and workload is large, and the cycle is long, and it is relatively costly that accumulative total price is detected in multiple SNP site.

Multiple SNP loci detection method is based on multiplex PCR and capillary electrophoresis (CE) isolation technique.Adopt multiple PCR method, simultaneously add in the same reaction tubes >=1 pair of specific gene amplimer and reaction internal reference primer, analyze multiple SNP site and genotype according to the size of gene amplification fragment by capillary electrophoresis separation, can fast and effeciently detect multiple SNP site, overcome the defect that traditional method exists, there is following advantage:

1, high-throughput: native system is realized a single reaction detection 30-40 site.

2, accuracy is strong: adopt CE to separate PCR product, non-specific amplification product, primer dimer and specific amplification products can be separated, at utmost reduce false positive;

3, susceptibility is high, and result is reproducible: native system has overcome the deviation that the unequal amplification of normal PCR amplification method causes, and has improved a set of goal gene is carried out to speed and susceptibility qualitatively, adopts laser induced fluorescence(LIF)-PMT, has hypersensitivity;

4, method is easy, uses economical: the invention provides from a complete set of experimental programs such as reagent, multiple PCR primer design, interpretations of result; The testing cost Shao Yu $50 of each sample, is beneficial to large-scale promotion;

5, handiness is strong: the target gene that can adjust according to demand at any time detection.

6, easily be automated.

At present, also do not detect and instruct the test kit of thiazide diuretic medication and the relevant report of using method thereof about the multiple SNP separating with CE based on multiplex PCR both at home and abroad.

Summary of the invention

Technical problem to be solved by this invention is to provide a kind of high specificity, accuracy is high, flux is high, reliability is strong, cost is low, instruct medicine of glonoin and healthy primer sets compound of drinking without false negative result based on multiple SNP detection system.

Technical problem to be solved by this invention is also to provide the test kit and the using method thereof that comprise above-mentioned primer sets compound.

The present invention solves the problems of the technologies described above adopted technique means: a kind of medicine of glonoin and healthy primer sets compound of drinking of instructing, comprise following 2 with forward and reverse amplimer of forward and reverse amplimer of the different genotype on medicine of glonoin and healthy 2 SNP sites of drinking on genes involved and react forward and reverse amplimer of internal reference, its nucleotide sequence is as shown in table 1 below:

Table 1

On above-mentioned ALDH2 gene, the reverse amplimer of the G type gene of rs671 fragment and the reverse amplimer of A type gene are nucleic acid sequence SEQ ID NO.3:CGGCAGGTCCTGAACCTCTG; On ADH1B gene, the reverse amplimer of the G type gene of rs1229984 fragment and the reverse amplimer of A type gene are nucleic acid sequence SEQ ID NO.6:ATATTTAGGAATAGTAGGGATTAGTA.

Instruct medicine of glonoin and a healthy multiple gene detecting kit of drinking, comprise primer sets compound, PCR reaction solution and positive reference substance described in as above table 1; Described PCR reaction solution comprises following component: ultrapure water, X solution, 10 × PCR damping fluid, 25mM magnesium chloride solution, archaeal dna polymerase.

Described X solution is for comprising triphosphate deoxy-nucleotide (dNTPs) and universal primer, and described universal primer forward amplimer sequence is AGGTGACACTATAGAATA, as shown in SEQ ID NO.9; Oppositely amplimer sequence is GTACGACTCACTATAGGGA, as shown in SEQ ID NO.10; Described universal primer forward amplimer band fluorescent mark.

Described positive reference substance be above-mentioned 2 with medicine of glonoin and healthy 2 SNP sites of drinking on genes involved on the primer clone gained DNA fragmentation of different genotype.

Above-mentioned a kind of using method that instructs medicine of glonoin and healthy multiple gene detecting kit of drinking, specifically comprises the following steps:

(1) collecting sample extract nucleic acid

The separation and Culture thing that gathers patient's buccal swab or blood sample extracts nucleic acid from separation and Culture thing;

(2) carry out PCR reaction take the nucleic acid that extracts as template

Get DNA sample 2 μ L, 10 × PCR damping fluid, 2 μ L, the magnesium chloride 3.4 μ L of 25mM, PCR primer solution 2 μ L, archaeal dna polymerase 0.6 μ L, X solution 2 μ L, after ultrapure water 10 μ L mix, join the reaction of the enterprising performing PCR of 96 hole sample panel, reaction conditions: 95 ℃ 2 minutes; 94 ℃ of 30 second, 55 ℃ of 30 second, 70 ℃ 1 minute, circulate 35 times; 70 ℃ 1 minute; 4 ℃ until collect PCR product; Wherein said X solution is for comprising triphosphate deoxy-nucleotide (dNTPs) and universal primer, and described universal primer forward amplimer sequence is AGGTGACACTATAGAATA, as shown in SEQ ID NO.9; Oppositely amplimer sequence is GTACGACTCACTATAGGGA, as shown in SEQ ID NO.10; Described universal primer forward amplimer band fluorescent mark; In PCR primer solution, each PCR primer concentration is 200nM, described PCR primer comprise following 2 with forward and reverse amplimer of the different genotype on medicine of glonoin and healthy 2 SNP sites of drinking on genes involved and react forward and reverse amplimer of internal reference, gene order is as shown in SEQ ID NO.1～NO.8 in sequence table;

(3) electrocapillary phoresis sample separation

Get PCR product 0.1-1 μ L, sample-loading buffer 38.75 μ L, DNA Marker0.5 μ L, after one, mineral oil mixes, join on 96 hole parting liquid plates and carry out electrocapillary phoresis sample separation, the collection of illustrative plates that genetic analyzer software is obtained and standard diagram contrast, the allelotype in the SNP site of medicine of glonoin and the healthy genes involved of drinking is instructed in acquisition.

The present invention compared with prior art, it has following beneficial effect: the present invention instructs medicine of glonoin and healthy primer sets compound of drinking, multiple gene detecting kit and using method thereof, primer sets compound of the present invention, multiple gene detecting kit and using method are based on multiplex PCR and electrocapillary phoresis technology, utilize the PCR specific amplification fragment of different lengths to identify the gene that differentiation is different, found the detection scheme of the different genotype on two SNP sites of a kind of synchronous detection ALDH2 and two genes of ADH1B, drink to instruct medicine of glonoin and health, present method is optimized multi-PRC reaction system, DNA sample to be measured is carried out to specific amplification, separate pcr amplification product to differentiate different genes and genotype by electrocapillary phoresis method again, within one sky, can complete the detection of 192 patient's samples, both production cost and testing cost had been saved, improve again detection efficiency and shortened the time, the use of reaction internal reference can be used for monitoring the efficiency of whole reactive system, PCR reaction, avoids false negative.

Mentioned reagent box can be synchronously to 2 with medicine of glonoin and healthy 2 SNP sites (2 SNP sites are respectively rs671 and rs1229984) of drinking on genes involved on different genotype detect, utilize the PCR specific amplification fragment of different lengths to identify the allelotype of distinguishing SNP site, to instruct medicine of glonoin and health to drink, specifically as shown in table 2:

The drink multiple gene test of table 2 medicine of glonoin and health detects target site

In sum, the present invention is based on the primer sets compound, multiple gene detecting kit and the using method thereof that instruct medicine of glonoin and health to drink of multiplex PCR-CE, different genotype on 2 SNP sites of synchronously 2 being drunk on genes involved with medicine of glonoin and health detects, detection sensitivity is high, specificity is good, reduce the false positive rate of conventional pcr amplification, can also effectively solve the easy pollution problem of conventional PCR; There is Noncompetitive internal comparison system, reliability is strong, without false negative result, the method of the present invention's application multiplex PCR and electrocapillary phoresis, there is the technical superioritys such as flux is large, accuracy is high, sensitivity is good, can detect rapidly and accurately the polymorphism of all genes involveds in sample with single reaction, provide a kind of superior molecular diagnosis method cheaply for clinical, contribute to instruct medicine of glonoin and health to drink.

Accompanying drawing explanation

Fig. 1, be that human DNA sample uses medicine of glonoin and healthy multiple gene detecting kit electrocapillary phoresis sample separation result of drinking.

Embodiment

In order to understand better content of the present invention, be described further below in conjunction with specific embodiments and the drawings.Should be understood that these embodiment, only for the present invention is further described, limit the scope of the invention and be not used in.In addition should be understood that and reading after content of the present invention, person skilled in art makes some nonessential change or adjustment to the present invention, still belongs to protection scope of the present invention.

Embodiment 1

A kind of medicine of glonoin and healthy multiple gene detecting kit of drinking of instructing of the present invention, when use, gather blood samples of patients or buccal swab sample extraction nucleic acid, enter PCR reaction take patient's nucleic acid as template, finally use electrocapillary phoresis method sample separation, concrete steps are as follows:

1, operation instruction medicine of glonoin and healthy multiple gene detecting kit of drinking, the component that test kit comprises:

1) PCR primer (PCR Primer Mix):

2) 25mM magnesium chloride (MgCl ₂)

3) archaeal dna polymerase (Taq DNA Polymerase)

4) X solution (Solution X)

5) PCR damping fluid (PCR Buffer)

6) positive control (Positive Control)

7) ultrapure water (ddH ₂o)

Above-mentioned PCR primer comprise following 2 with instruct forward and reverse amplimer of the different genotype on medicine of glonoin and healthy 2 SNP sites of drinking on genes involved and react forward and reverse amplimer of internal reference, its nucleotide sequence as show 1(or referring to sequence table SEQ ID NO.1～8) as shown in.

Wherein, described X solution is for comprising triphosphate deoxy-nucleotide (dNTPs) and universal primer, and described universal primer forward amplimer sequence is AGGTGACACTATAGAATA, as shown in SEQ ID NO.9; Oppositely amplimer sequence is GTACGACTCACTATAGGGA, as shown in SEQ ID NO.10; Described universal primer forward amplimer band fluorescent mark.

2, collecting sample extract nucleic acid

Gather human oral swab or blood sample and extract nucleic acid.

3, carry out PCR reaction take patient's nucleic acid of extracting as template

1) on 96 hole sample panel/eight connecting legs, add reagent and sample (PCR plate is in table 3) in following ratio, and a positive control reaction be set:

Table 3PCR reaction reagent and sample mix ratio

PCR reaction reagent	Amount/hole
		ddH 2O	8
25mM?MgCl 2	3.4
		10 × PCR damping fluid	2
PCR primer solution	2
		X solution	2
DNA sample	2
		Archaeal dna polymerase	0.6
Total	20μL

?note: positive reference substance be in above-described embodiment 12 with medicine of glonoin and healthy 2 SNP sites of drinking on genes involved on the primer clone gained DNA fragmentation of different genotype.

2) carry out thermal cycle reaction (in table 4) by following temperature after mixing:

Table 4PCR reaction conditions

Step	Temperature	Time
			1	95℃	2 minutes
2	94℃	30 seconds
			3	55℃	30 seconds
4	70℃	1 minute
			5	N/A	Repeat 2-4 step 34 time (totally 35 times)
6	70℃	1 minute
			7	4℃	Continue: until collect PCR product

4, electrocapillary phoresis sample separation

1) prepare CE sample (in table 5):

Table 5CE sample mix ratio

Title	Amount/hole
		Sample-loading buffer	38.75μL
DNA size criteria 400	0.5μL
		PCR product	0.1-1μL
Mineral oil	1

2) electrocapillary phoresis sample separation

PCR product is added in the hole of proper number on 96 hole capillary electrophoresis separation plates; Capillary electrophoresis separation is the Novel liquid-phase isolation technique of a class take kapillary as split tunnel, take high-voltage dc as motivating force, and specific procedure is 90 ℃ of sex change 120 seconds, sample introduction voltage 2kv, 30 seconds, separation voltage 6kv, 35 minutes.

5, interpretation of result

The CE that analyzes this test kit detects data, and the position and the quantity that occur according to each characteristic peak, determine genotype.Take ALDH2 gene as example: only occur ALDH2_G(CE fragment length 199nt) time, result is ALDH2G homozygote; Only there is ALDH2_A(CE fragment length 204nt) time, result is ALDH2A homozygote; ALDH2_G peak and ALDH2_A peak occur simultaneously, and result is ALDH2 heterozygote.The result decision method of ADH1B gene is identical with ALDH2 gene.

The gene locus that this test kit of table 6. detects, the CE fragment length of reaction internal reference

Note: the ALDH2 in table 6, Fig. 1 and ADH1B are the gene locus detecting, pcDNA is reaction internal reference.

Fig. 1 is that a human DNA sample uses medicine of glonoin and healthy multiple gene detecting kit electrocapillary phoresis sample separation result of drinking.There are altogether 5 characteristic peak: ALDH2G(199nt), ALDH2A(204nt), ADH1B G(220nt), ADH1B A(225nt), pcDNA(166nt).Analytical results: ALDH2G(199nt), ALDH2A(204nt) simultaneously occur, illustrate that ALDH2 is heterozygote; ADH1B G(220nt), ADH1B A(225nt) simultaneously occur, illustrate that ADH1B is heterozygote; PcDNA, for reaction internal reference, illustrates that PCR reacts successfully.This Fig. 1 also can be used as standard diagram, while measuring other sample gene type, and the collection of illustrative plates that genetic analyzer software is obtained and the contrast of this standard diagram, the allelotype in the SNP site of medicine of glonoin and the healthy genes involved of drinking is instructed in acquisition.

Embodiment 2

Detection reagent specificity analyses: it is the unimodal of target fragment size that substance pcr amplification detects through capillary electrophoresis.

Above-mentioned explanation is not limitation of the present invention, and the present invention is also not limited to above-mentioned giving an example.Those skilled in the art are in essential scope of the present invention, and variation, remodeling, interpolation or the replacement made, also should belong to protection scope of the present invention.

Claims (5)

1. one kind is instructed medicine of glonoin and healthy primer sets compound of drinking, it is characterized in that, comprise following 2 with forward and reverse amplimer of forward and reverse amplimer of the different genotype on medicine of glonoin and healthy 2 SNP sites of drinking on genes involved and react forward and reverse amplimer of internal reference, its nucleotide sequence is as follows:

2. instruct medicine of glonoin and a healthy multiple gene detecting kit of drinking, it is characterized in that, comprise primer sets compound as claimed in claim 1, PCR reaction solution and positive reference substance; Described PCR reaction solution comprises following component: ultrapure water, X solution, 10 × PCR damping fluid, 25mM magnesium chloride solution, archaeal dna polymerase.

3. a kind of medicine of glonoin and healthy multiple gene detecting kit of drinking of instructing according to claim 2, it is characterized in that: described X solution is for comprising triphosphate deoxy-nucleotide (dNTPs) and universal primer, described universal primer forward amplimer sequence is AGGTGACACTATAGAATA, as shown in SEQ ID NO.9; Oppositely amplimer sequence is GTACGACTCACTATAGGGA, as shown in SEQ ID NO.10; Described universal primer forward amplimer band fluorescent mark.

4. a kind of medicine of glonoin and healthy multiple gene detecting kit of drinking of instructing according to claim 3, is characterized in that: described positive reference substance be above-mentioned 2 with medicine of glonoin and healthy 2 SNP sites of drinking on genes involved on the primer of different genotype clone gained DNA fragmentation.

5. above-mentioned a kind of using method that instructs medicine of glonoin and healthy multiple gene detecting kit of drinking, is characterized in that, specifically comprises the following steps:

(1) collecting sample extract nucleic acid

The separation and Culture thing that gathers patient's buccal swab or blood sample extracts nucleic acid from separation and Culture thing;

(2) carry out PCR reaction take the nucleic acid that extracts as template

Get DNA sample 2 μ L, 10 × PCR damping fluid, 2 μ L, the magnesium chloride 3.4 μ L of 25mM, PCR primer solution 2 μ L, archaeal dna polymerase 0.6 μ L, X solution 2 μ L, after ultrapure water 10 μ L mix, join the reaction of the enterprising performing PCR of 96 hole sample panel, reaction conditions: 95 ℃ 2 minutes; 94 ℃ of 30 second, 55 ℃ of 30 second, 70 ℃ 1 minute, circulate 35 times; 70 ℃ 1 minute; 4 ℃ until collect PCR product; Wherein said X solution is for comprising triphosphate deoxy-nucleotide (dNTPs) and universal primer, and described universal primer forward amplimer sequence is AGGTGACACTATAGAATA, as shown in SEQ ID NO.9; Oppositely amplimer sequence is GTACGACTCACTATAGGGA, as shown in SEQ ID NO.10; Described universal primer forward amplimer band fluorescent mark; In PCR primer solution, each PCR primer concentration is 200nM, described PCR primer comprise following 2 with forward and reverse amplimer of the different genotype on medicine of glonoin and healthy 2 SNP sites of drinking on genes involved and react forward and reverse amplimer of internal reference, gene order is as shown in SEQ ID NO.1～NO.8 in sequence table;

(3) electrocapillary phoresis sample separation

Get PCR product 0.1-1 μ L, sample-loading buffer 38.75 μ L, DNA Marker0.5 μ L, after one, mineral oil mixes, join on 96 hole parting liquid plates and carry out electrocapillary phoresis sample separation, the collection of illustrative plates that genetic analyzer software is obtained and standard diagram contrast, the allelotype in the SNP site of medicine of glonoin and the healthy genes involved of drinking is instructed in acquisition.

Images