CN108130364A - Nucleic acid rapid detection method based on molecular beacon under a kind of room temperature - Google Patents
Nucleic acid rapid detection method based on molecular beacon under a kind of room temperature Download PDFInfo
- Publication number
- CN108130364A CN108130364A CN201711080881.2A CN201711080881A CN108130364A CN 108130364 A CN108130364 A CN 108130364A CN 201711080881 A CN201711080881 A CN 201711080881A CN 108130364 A CN108130364 A CN 108130364A
- Authority
- CN
- China
- Prior art keywords
- molecular beacon
- nucleic acid
- amplification
- detection method
- room temperature
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Nucleic acid rapid detection method based on molecular beacon under the good a kind of room temperature of concise, quick, low cost, effect, make the very fast PCR amplification of two temperatures method to the nucleic acid, molecular beacon is added in the amplification reaction system and makees fluorescence instruction probe, the amplified reaction temperature change is 95 DEG C 60 DEG C, the single loop time≤10s, total time-consuming≤10min, after amplified reaction, mixed liquor after directly penetrating amplified reaction with UV illumination, visual observations, what the mixed liquor sent out that fluorescent visual is shown in is determined as the positive, is otherwise determined as feminine gender.The present invention is suitable for nucleic acid fast qualitative detection.
Description
Technical field
The invention belongs to nucleic acid amplification and detection field, particular content is related to a kind of based on the quick of molecular beacon
PCR amplification and the method for being used for quick visualization end point determination at normal temperatures.
Background technology
During detection of nucleic acids, for the sensitivity of raising detection, need first largely to expand target set nucleic acid object,
In order to subsequent detection.PCR (PCR) as the gold standard of detection of nucleic acids, is widely used to medicine and examines
The various fields such as disconnected, the residual detection of agriculture, food security inspection.Traditional PCR amplification is built upon three reaction temperatures and certain
Repetition reaction in recurring number.In general, each cycle needs to provide three reaction temperatures and corresponding suitable to PCR amplification
Time.Three reaction temperatures correspond to three phases, respectively denaturation stage (95 DEG C), annealing (55 DEG C~65 DEG C), extension (72
℃).It is existing longer by the detection of nucleic acids total time-consuming of PCR amplification.It is alternative according to the difference of template and the difference of amplification enzyme
Adjustment three phases duration and originate and end up add in pre-degeneration and extension the stage.For PCR reactions
Speech, it is crucial that meet the temperature requirement in each stage, therefore this just needs the heat block very fine to temperature control, and for
It will also have the function of rapid temperature rise and drop concurrently, to reduce the whole time of reaction.
In addition, the detection for amplified production, traditional method is using gel electrophoresis, when which expends more
Between and manpower, and to uncap to amplified production, easily form Aerosol Pollution, and the chemicals used in electrophoresis endangers to human body
Evil is larger.And now using it is more be then real-time fluorescence detection method, this method is generally embedded in using DNA double chain fluorescence
Agent, such as SYTO 9, SYBR Green I, Gel Red, using real-time fluorescence PCR instrument to Ct values during the entire process of reaction
Size is recorded and then is characterized indirectly nucleic acid amplification situation.In order to improve the specificity of detection, some molecular probes are opened
It issues, such as hydrolysis probes (Taqman probes), hybridization probe (molecular beacon), combined probe.They are in nucleic acid amplification
Complementary pairing is carried out using the principle of base pair complementarity and template in the process, it is real so as to fulfill specificity is carried out to nucleic acid amplification
When detect.But these utilize the detection method of probe, it usually needs more complicated real-time fluorescence PCR instrument reads data, therefore
Cost is higher, time-consuming longer, is restricted in popularization.
Molecular beacon is since its structure is in hairpin form, and under same concentration in detection architecture, opposite linear probe is (such as
Taqman hydrolysis probes) molecular beacon shows lower background signal value, so as to have higher signal-to-noise ratio.Believed based on molecule
Target nucleic acid detection method is detected object frequently with real-time fluorescence method.For molecular beacon end-point detection method, not
It appears in the newspapers to have and end point determination is carried out to amplified production at normal temperatures using it.This means that carry out specificity using molecular beacon
It is a kind of detection method for having very much prospect and being worth exploitation that end point determination, which evades the lengthy and jumbled of the cumbersome and instrument of melting curve,.
Invention content
The present invention will overcome the existing detection of nucleic acids by PCR amplification, and time-consuming, needs adapted equipment requirement high, performance accuracy
Control is stringent, it is of high cost the defects of, the nucleic acid rapid detection method based on molecular beacon, this method under a kind of room temperature are provided and passed through
Nucleic acid PCR expands, and makees qualitative detection absolutely to object under room temperature, and step is easy, time-consuming short, without high-grade, high request
Device configuration, it is at low cost, detection determination requirement can be met.
The technical solution adopted by the present invention first, making the very fast PCR amplification of two temperatures method to the nucleic acid, is characterized in that
Molecular beacon is added in the amplification reaction system and makees fluorescence instruction probe, the amplified reaction temperature change is 95 DEG C -60
DEG C, the single loop time≤10s, total time-consuming≤10min after amplified reaction, directly penetrates amplified reaction with UV illumination
Mixed liquor afterwards, visual observations, what the mixed liquor sent out that fluorescent visual is shown in is determined as the positive, is otherwise determined as feminine gender.
The technical solution adopted by the present invention second is that making the very fast PCR amplification of two temperatures method to the nucleic acid, is characterized in that
Molecular beacon is added in the amplification reaction system and makees fluorescence instruction probe, the amplified reaction temperature change is 95 DEG C -60
DEG C, the single loop time≤10s, after amplified reaction, light obtained by LED light is filtered with optical filter one for total time-consuming≤10min
Mixed liquor after irradiation amplified reaction, then the mixed liquor is blocked with optical filter two, the thang-kng of visual observations optical filter two has fluorescence
That visually sees is determined as the positive, is otherwise determined as feminine gender；The logical optical wavelength of first optical filter and the 5 ' institute of molecular beacon
The excitation wavelength of the fluorescent material of label is suitable, what the logical optical wavelength of second optical filter was marked with the molecular beacon 5 '
The launch wavelength of fluorescent material is suitable.
A concentration of 0.01-1 μM of molecular beacon is added in system of the present invention.
It is preferentially a concentration of 0.05-0.5 μM of molecular beacon of addition in the system.
A concentration of 0.1-0.2 μM of molecular beacon is added in more preferably described system.
For the present invention, non-symmetric amplification, which had both may be used, in the nucleic acid amplification method of use can also use asymmetric expansion
Increase.It needs to add in certain density molecular beacon in amplification system, macroscopic detection is carried out after the completion of amplification.It is specific real
Applying method is：Hypervelocity PCR amplification is carried out first, and each PCR cycle time can complete within 8 second time.Then the amplification is produced
Object carries out exempting from the terminal Visual retrieval based on molecular beacon uncapped.Detection method includes following two：First, using ultraviolet
The irradiation of lamp is visually observed.Second, it is visually observed using the irradiation of visible electro-optical device.Both the above method is without multiple
Miscellaneous gel imager and the auxiliary of melting curve, it is very portable.It observes by the naked eye, you can comparison judges to detect sample
For negative or positive result.
In the present invention, the amplification system and amplification program for the PCR that exceeds the speed limit are provided, which includes recognizable mould
The primer of plate target and the thermostable type polymerase for extension, and include ion concentration each needed for amplification procedure.It is described
Amplification program includes the feature for completing the required temperature of each cycle, duration and rate temperature change.
(1) in this hypervelocity PCR amplification system, it is preferred that make in used primer concentration and standard PCR amplification system
Concentration is suitable.Preferably, the concentration of molecular beacon is with 0.01 μM to 1 μM offer in system, it is furthermore preferred that molecular beacon is dense
Degree is provided with 0.05 μM to 0.5 μM of concentration, and further, molecular beacon concentration is provided with 0.1 μM to 0.2 μM of concentration.
(2) in the present inspection method, two kinds of visible detection methods are contained：
First, with mixed liquor after ultra violet lamp amplified reaction, directly visually observe or take pictures and is negative and positive template glimmering
Light difference judges to be detected.
Second is that with mixed liquor after LED visible light combination optical filter irradiation amplified reaction, directly naked eyes or observation of taking pictures are negative
It distinguishes to be detected judgement with the fluorescence of positive template.The wavelength of selected LED diodes is believed according to selected molecule
The excitation wavelength for the fluorescent material that target 5 ' marks determines.Method is：Utilize the fluorescent material marked with molecular beacon 5 '
The close optical filter one of excitation wavelength filters off the broadband light sent out by LED diodes, recycles and 5 ' labels of molecular beacon
The close optical filter two of the launch wavelength of fluorescent material, the fluorescence sent out to the fluorescent material after excitation are filtered, and obtain institute
The transmitting fluorescence of wavelength is needed, observes by the naked eye and makees result judgement.
(3) in the present inspection method, according to the different excitation wavelength of the fluorescent material of the 5 ' of molecular beacon labels and transmitting
Wavelength carries out the selection of two tablet filters.Several frequently seen fluorescent material and the combination (example of optical filter selection is given below：5 ' fluorescence
Substance/one wavelength of optical filter/optical filter, two wavelength)：1.FAM、SYBR Green、SYTO9/470nm±15nm/520nm±
15nm。2.VIC、HEX/520±10nm/558±12nm。3.ABY、TAMRA、Cy3/550nm±10nm/587nm±10nm。
4.Texas Red, ROX, JUN/580nm ± 10nm/623 ± 14nm, etc..
The present invention is due to amplified reaction single loop time≤10s, total time-consuming≤10min, after amplified reaction directly
With mixed liquor after ultraviolet light or LED light combination optical filter irradiation amplified reaction, visual observations, mixed liquor sends out fluorescence after reaction
That visually sees is determined as the positive, is otherwise determined as feminine gender, therefore present invention detection is easy, quick, at low cost, without accurate, high-grade
Equipment configratioin requirement, detection judge reliable.
Description of the drawings
Fig. 1 is the detection of the embodiment of the present invention 1 depending on seeing that object photograph and testing result represent；
Fig. 2 is the detection of the embodiment of the present invention 2 depending on seeing that object photograph and testing result represent；
Fig. 3 is the detection of the embodiment of the present invention 3 depending on seeing that object photograph and testing result represent；
Fig. 4 is the detection of the embodiment of the present invention 4 depending on seeing that object photograph and testing result represent；
Fig. 5 is the detection of the embodiment of the present invention 5 depending on seeing that object photograph and testing result represent.
Specific embodiment
It engages several specific embodiments below to be described further the present invention, following Examples are not the present invention any
It limits.
Infectious subcutaneous and the hematopoiesis of hypervelocity PCR Visual retrieval prawns are combined under 1 room temperature of embodiment using molecular beacon
Tissue necrosis disease (IHHNV).
Exceed the speed limit PCR system：PCR reactions carry out in 25 μ L systems, which includes 0.01 μM of molecular beacon,
SpeedSTARTMHS polymerases 12.5U, KCI 50mM, MgCl2Each 0.2mM of 1.5mM, Tris-HCI 10mM, dNTP, primer
0.4 μM a concentration of (buying from Dalian treasured bioengineering Co., Ltd, article No. RR070A).
Exceed the speed limit PCR amplification program：95 DEG C of thermal starting 120s, 40 cycles, each cycle include 95 DEG C of 6s, 60 DEG C of reactions
6s, amplification total time-consuming 10min.
The primer sequence used：F：5’CGGAACACAACCCGACTTTA 3’
R：5’GGCCAAGACCAAAATACGAA 3’
The template sequence of amplification：
5’GGAACACAACCCGACTTTATTGAAGGGACTCCCAACGGACCGGACGAAATGGACGGAAGGCGACTGG
AAGAGAGTGAGATTGATAAACAAGTGGAAAGTACAACATGGTACACCTTCGTCATCAGAGAAAAACCACAACCAAGA
AGACTCTCCGGAAGAACACCAAACTTCACCATTACAGATCATGGTGACCACTGGCACATCACATACTCCGGACACCC
AACCAATAAGACCAGACATAGAGCTACAATCCTCGCCTATTTGGGAGTTACCTTTGCTGCCAGAGCCGAAGCTGAAG
CGACTACGGTACTTGTTAGAAATATCAAGAGATGGATACTCTATCTTATCAGATACGGTATTGAACGGCTTTCGTAT
TTTGGTCTTGGCC 3’(GeneBank：AF218266.2)
Selected molecular beacon：
5’FAM-CGCGCCAGACATAGAGCTACAATCCTCGCCGCGCG-Dabcyl3’
Ultra violet lamp under room temperature, infectious subcutaneous and the hematopoietic tissue necrosis disease of terminal Visual retrieval prawn
(IHHNV)：
As a result it shows：Positive findings are presented in the prawn for having infected IHHNV viruses, and healthy prawn is negative findings.
Embodiment 2：Infectious subcutaneous and the hematopoiesis of hypervelocity PCR Visual retrieval prawns are combined under room temperature using molecular beacon
Tissue necrosis disease (IHHNV).
Exceed the speed limit PCR system：PCR reactions carry out in 25 μ L systems, which includes 0.1 μM of molecular beacon,
SpeedSTARTMHS polymerases 12.5U, KCI 50mM, MgCl2 1.5mM, Tris-HCI 10mM, each 0.2Mm of dNTP, primer
0.4 μM a concentration of (buying from Dalian treasured bioengineering Co., Ltd, article No. RR070A).
Exceed the speed limit PCR amplification program：95 DEG C of thermal starting 120s, 40 cycles, each cycle include 95 DEG C of 4s, 60 DEG C of reactions
4s, amplification total time-consuming 7min20s.
The primer sequence used：F：5’CGGAACACAACCCGACTTTA 3’
R：5’GGCCAAGACCAAAATACGAA 3’
The template sequence of amplification：
5’GGAACACAACCCGACTTTATTGAAGGGACTCCCAACGGACCGGACGAAATGGACGGAAGGCGACTGG
AAGAGAGTGAGATTGATAAACAAGTGGAAAGTACAACATGGTACACCTTCGTCATCAGAGAAAAACCACAACCAAGA
AGACTCTCCGGAAGAACACCAAACTTCACCATTACAGATCATGGTGACCACTGGCACATCACATACTCCGGACACCC
AACCAATAAGACCAGACATAGAGCTACAATCCTCGCCTATTTGGGAGTTACCTTTGCTGCCAGAGCCGAAGCTGAAG
CGACTACGGTACTTGTTAGAAATATCAAGAGATGGATACTCTATCTTATCAGATACGGTATTGAACGGCTTTCGTAT
TTTGGTCTTGGCC 3’(GeneBank：AF218266.2)
Selected molecular beacon：
5’FAM-CGCGCCAGACATAGAGCTACAATCCTCGCCGCGCG-Dabcyl3’
Visible LED light irradiation under room temperature, infectious subcutaneous and the hematopoietic tissue necrosis disease of terminal Visual retrieval prawn
(IHHNV)：
As a result it shows：Positive findings are presented in the prawn for having infected IHHNV viruses, and healthy prawn is negative findings.
Embodiment 3：Infectious subcutaneous and the hematopoiesis of hypervelocity PCR Visual retrieval prawns are combined under room temperature using molecular beacon
Tissue necrosis disease (IHHNV).
Exceed the speed limit PCR system：PCR reactions carry out in 25 μ L systems, which includes 0.1 μM of molecular beacon
SpeedSTARTMHS polymerases 12.5U, KCI 50mM, MgCl2 1.5mM, Tris-HCI 10mM, each 0.2Mm of dNTP, primer
0.4 μM a concentration of (buying from Dalian treasured bioengineering Co., Ltd, article No. RR070A).Exceed the speed limit PCR amplification program：95 DEG C of heat
Start 120s, 40 cycles, each cycle includes 95 DEG C of 4s, 60 DEG C of reaction 4s, amplification total time-consuming 7min20s.
The primer sequence used：F：5’CGGAACACAACCCGACTTTA 3’
R：5’GGCCAAGACCAAAATACGAA 3’
The template sequence of amplification：
5’GGAACACAACCCGACTTTATTGAAGGGACTCCCAACGGACCGGACGAAATGGACGGAAGGCGACTGG
AAGAGAGTGAGATTGATAAACAAGTGGAAAGTACAACATGGTACACCTTCGTCATCAGAGAAAAACCACAACCAAGA
AGACTCTCCGGAAGAACACCAAACTTCACCATTACAGATCATGGTGACCACTGGCACATCACATACTCCGGACACCC
AACCAATAAGACCAGACATAGAGCTACAATCCTCGCCTATTTGGGAGTTACCTTTGCTGCCAGAGCCGAAGCTGAAG
CGACTACGGTACTTGTTAGAAATATCAAGAGATGGATACTCTATCTTATCAGATACGGTATTGAACGGCTTTCGTAT
TTTGGTCTTGGCC 3’(GeneBank：AF218266.2)
Selected molecular beacon：
5’Texas Red-CGCGCCAGACATAGAGCTACAATCCTCGCCGCGCG-Dabcyl3’
Ultra violet lamp under room temperature, infectious subcutaneous and the hematopoietic tissue necrosis disease of terminal Visual retrieval prawn
(IHHNV)：
As a result it shows：Positive findings are presented in the prawn for having infected IHHNV viruses, and healthy prawn is negative findings.
Embodiment 4：Infectious subcutaneous and the hematopoiesis of hypervelocity PCR Visual retrieval prawns are combined under room temperature using molecular beacon
Tissue necrosis disease (IHHNV).
Exceed the speed limit PCR system：PCR reactions carry out in 25 μ L systems, which includes 0.2 μM of molecular beacon
SpeedSTARTMHS polymerases 12.5U, KCI 50mM, MgCl2 1.5mM, Tris-HCI 10mM, each 0.2Mm of dNTP, primer
0.4 μM a concentration of (buying from Dalian treasured bioengineering Co., Ltd, article No. RR070A).Exceed the speed limit PCR amplification program：95 DEG C of heat
Start 120s, 40 cycles, each cycle includes 95 DEG C of 4s, 60 DEG C of reaction 4s, amplification total time-consuming 7min20s.
The primer sequence used：F：5’CGGAACACAACCCGACTTTA 3’
R：5’GGCCAAGACCAAAATACGAA 3’
The template sequence of amplification：
5’GGAACACAACCCGACTTTATTGAAGGGACTCCCAACGGACCGGACGAAATGGACGGAAGGCGACTGG
AAGAGAGTGAGATTGATAAACAAGTGGAAAGTACAACATGGTACACCTTCGTCATCAGAGAAAAACCACAACCAAGA
AGACTCTCCGGAAGAACACCAAACTTCACCATTACAGATCATGGTGACCACTGGCACATCACATACTCCGGACACCC
AACCAATAAGACCAGACATAGAGCTACAATCCTCGCCTATTTGGGAGTTACCTTTGCTGCCAGAGCCGAAGCTGAAG
CGACTACGGTACTTGTTAGAAATATCAAGAGATGGATACTCTATCTTATCAGATACGGTATTGAACGGCTTTCGTAT
TTTGGTCTTGGCC 3’(GeneBank：AF218266.2)
Selected molecular beacon：
5’FAM-CGCGCCAGACATAGAGCTACAATCCTCGCCGCGCG-Dabcyl3’
Visible LED light irradiation under room temperature, infectious subcutaneous and the hematopoietic tissue necrosis disease of terminal Visual retrieval prawn
(IHHNV)：
As a result it shows：Positive findings are presented in the prawn for having infected IHHNV viruses, and healthy prawn is negative findings.
Embodiment 5：Infectious subcutaneous and the hematopoiesis of hypervelocity PCR Visual retrieval prawns are combined under room temperature using molecular beacon
Tissue necrosis disease (IHHNV).
Exceed the speed limit PCR system：PCR reactions carry out in 25 μ L systems, which includes 1 μM of molecular beacon SpeedSTARTM
HS polymerases 12.5U, KCI 50mM, MgCl2 1.5mM, Tris-HCI 10mM, each 0.2Mm of dNTP, primer concentration are 0.4 μM
(buying from Dalian treasured bioengineering Co., Ltd, article No. RR070A).Exceed the speed limit PCR amplification program：95 DEG C of thermal starting 120s, 40
A cycle, each cycle include 95 DEG C of 4s, 60 DEG C of reaction 4s, amplification total time-consuming 7min20s.
The primer sequence used：F：5’CGGAACACAACCCGACTTTA 3’
R：5’GGCCAAGACCAAAATACGAA 3’
The template sequence of amplification：
5’GGAACACAACCCGACTTTATTGAAGGGACTCCCAACGGACCGGACGAAATGGACGGAAGGCGACTGG
AAGAGAGTGAGATTGATAAACAAGTGGAAAGTACAACATGGTACACCTTCGTCATCAGAGAAAAACCACAACCAAGA
AGACTCTCCGGAAGAACACCAAACTTCACCATTACAGATCATGGTGACCACTGGCACATCACATACTCCGGACACCC
AACCAATAAGACCAGACATAGAGCTACAATCCTCGCCTATTTGGGAGTTACCTTTGCTGCCAGAGCCGAAGCTGAAG
CGACTACGGTACTTGTTAGAAATATCAAGAGATGGATACTCTATCTTATCAGATACGGTATTGAACGGCTTTCGTAT
TTTGGTCTTGGCC 3’(GeneBank：AF218266.2)
Selected molecular beacon：
5’Texas Red-CGCGCCAGACATAGAGCTACAATCCTCGCCGCGCG-Dabcyl3’
Ultra violet lamp under room temperature, infectious subcutaneous and the hematopoietic tissue necrosis disease of terminal Visual retrieval prawn
(IHHNV)：
As a result it shows：Positive findings are presented in the prawn for having infected IHHNV viruses, and healthy prawn is negative findings.
Infectious subcutaneous and the hematopoiesis of hypervelocity PCR Visual retrieval prawns are combined under 6 room temperature of embodiment using molecular beacon
Tissue necrosis disease (IHHNV).
Exceed the speed limit PCR system：PCR reactions carry out in 25 μ L systems, which includes 0.01 μM of molecular beacon,
SpeedSTARTMHS polymerases 12.5U, KCI 50mM, MgCl2 1.5mM, Tris-HCI 10mM, each 0.2Mm of dNTP, primer
0.4 μM a concentration of (buying from Dalian treasured bioengineering Co., Ltd, article No. RR070A).
Exceed the speed limit PCR amplification program：95 DEG C of thermal starting 120s, 40 cycles, each cycle include 95 DEG C of 4s, 60 DEG C of reactions
4s, amplification total time-consuming 7min20s.
The primer sequence used：F：5’CGGAACACAACCCGACTTTA 3’
R：5’GGCCAAGACCAAAATACGAA 3’
The template sequence of amplification：
5’GGAACACAACCCGACTTTATTGAAGGGACTCCCAACGGACCGGACGAAATGGACGGAAGGCGACTGG
AAGAGAGTGAGATTGATAAACAAGTGGAAAGTACAACATGGTACACCTTCGTCATCAGAGAAAAACCACAACCAAGA
AGACTCTCCGGAAGAACACCAAACTTCACCATTACAGATCATGGTGACCACTGGCACATCACATACTCCGGACACCC
AACCAATAAGACCAGACATAGAGCTACAATCCTCGCCTATTTGGGAGTTACCTTTGCTGCCAGAGCCGAAGCTGAAG
CGACTACGGTACTTGTTAGAAATATCAAGAGATGGATACTCTATCTTATCAGATACGGTATTGAACGGCTTTCGTAT
TTTGGTCTTGGCC 3’(GeneBank：AF218266.2)
Selected molecular beacon：
5’FAM-CGCGCCAGACATAGAGCTACAATCCTCGCCGCGCG-Dabcyl3’
Visible LED light irradiation under room temperature, infectious subcutaneous and the hematopoietic tissue necrosis disease of terminal Visual retrieval prawn
(IHHNV)：
As a result it shows：Positive findings are presented in the prawn for having infected IHHNV viruses, and healthy prawn is negative findings.
Embodiment 7：Infectious subcutaneous and the hematopoiesis of hypervelocity PCR Visual retrieval prawns are combined under room temperature using molecular beacon
Tissue necrosis disease (IHHNV).
Exceed the speed limit PCR system：PCR reactions carry out in 25 μ L systems, which includes 0.1 μM of molecular beacon
SpeedSTARTMHS polymerases 12.5U, KCI 50mM, MgCl2 1.5mM, Tris-HCI 10mM, each 0.2Mm of dNTP, primer
0.4 μM a concentration of (buying from Dalian treasured bioengineering Co., Ltd, article No. RR070A).Exceed the speed limit PCR amplification program：95 DEG C of heat
Start 120s, 40 cycles, each cycle includes 95 DEG C of 4s, 60 DEG C of reaction 4s, amplification total time-consuming 7min20s.
The primer sequence used：F：5’CGGAACACAACCCGACTTTA 3’
R：5’GGCCAAGACCAAAATACGAA 3’
The template sequence of amplification：
5’GGAACACAACCCGACTTTATTGAAGGGACTCCCAACGGACCGGACGAAATGGACGGAAGGCGACTGG
AAGAGAGTGAGATTGATAAACAAGTGGAAAGTACAACATGGTACACCTTCGTCATCAGAGAAAAACCACAACCAAGA
AGACTCTCCGGAAGAACACCAAACTTCACCATTACAGATCATGGTGACCACTGGCACATCACATACTCCGGACACCC
AACCAATAAGACCAGACATAGAGCTACAATCCTCGCCTATTTGGGAGTTACCTTTGCTGCCAGAGCCGAAGCTGAAG
CGACTACGGTACTTGTTAGAAATATCAAGAGATGGATACTCTATCTTATCAGATACGGTATTGAACGGCTTTCGTAT
TTTGGTCTTGGCC 3’(GeneBank：AF218266.2)
Selected molecular beacon：
5’FAM-CGCGCCAGACATAGAGCTACAATCCTCGCCGCGCG-Dabcyl3’
Ultra violet lamp under room temperature, infectious subcutaneous and the hematopoietic tissue necrosis disease of terminal Visual retrieval prawn
(IHHNV)：
As a result it shows：Positive findings are presented in the prawn for having infected IHHNV viruses, and healthy prawn is negative findings.
Embodiment 8：Infectious subcutaneous and the hematopoiesis of hypervelocity PCR Visual retrieval prawns are combined under room temperature using molecular beacon
Tissue necrosis disease (IHHNV).
Exceed the speed limit PCR system：PCR reactions carry out in 25 μ L systems, which includes 0.1 μM of molecular beacon
SpeedSTARTMHS polymerases 12.5U, KCI 50mM, MgCl2 1.5mM, Tris-HCI 10mM, each 0.2Mm of dNTP, primer
0.4 μM a concentration of (buying from Dalian treasured bioengineering Co., Ltd, article No. RR070A).Exceed the speed limit PCR amplification program：95 DEG C of heat
Start 120s, 40 cycles, each cycle includes 95 DEG C of 4s, 60 DEG C of reaction 4s, amplification total time-consuming 7min20s.
The primer sequence used：F：5’CGGAACACAACCCGACTTTA 3’
R：5’GGCCAAGACCAAAATACGAA 3’
The template sequence of amplification：
5’GGAACACAACCCGACTTTATTGAAGGGACTCCCAACGGACCGGACGAAATGGACGGAAGGCGACTGG
AAGAGAGTGAGATTGATAAACAAGTGGAAAGTACAACATGGTACACCTTCGTCATCAGAGAAAAACCACAACCAAGA
AGACTCTCCGGAAGAACACCAAACTTCACCATTACAGATCATGGTGACCACTGGCACATCACATACTCCGGACACCC
AACCAATAAGACCAGACATAGAGCTACAATCCTCGCCTATTTGGGAGTTACCTTTGCTGCCAGAGCCGAAGCTGAAG
CGACTACGGTACTTGTTAGAAATATCAAGAGATGGATACTCTATCTTATCAGATACGGTATTGAACGGCTTTCGTAT
TTTGGTCTTGGCC 3’(GeneBank：AF218266.2)
Selected molecular beacon：
5’Texas Red-CGCGCCAGACATAGAGCTACAATCCTCGCCGCGCG-Dabcyl3’
Visible LED light irradiation under room temperature, infectious subcutaneous and the hematopoietic tissue necrosis disease of terminal Visual retrieval prawn
(IHHNV)：
As a result it shows：Positive findings are presented in the prawn for having infected IHHNV viruses, and healthy prawn is negative findings.
Embodiment 9：Infectious subcutaneous and the hematopoiesis of hypervelocity PCR Visual retrieval prawns are combined under room temperature using molecular beacon
Tissue necrosis disease (IHHNV).
Exceed the speed limit PCR system：PCR reactions carry out in 25 μ L systems, which includes 0.2 μM of molecular beacon
SpeedSTARTMHS polymerases 12.5U, KCI 50mM, MgCl2 1.5mM, Tris-HCI 10mM, each 0.2Mm of dNTP, primer
0.4 μM a concentration of (buying from Dalian treasured bioengineering Co., Ltd, article No. RR070A).Exceed the speed limit PCR amplification program：95 DEG C of heat
Start 120s, 40 cycles, each cycle includes 95 DEG C of 4s, 60 DEG C of reaction 4s, amplification total time-consuming 7min20s.
The primer sequence used：F：5’CGGAACACAACCCGACTTTA 3’
R：5’GGCCAAGACCAAAATACGAA 3’
The template sequence of amplification：
5’GGAACACAACCCGACTTTATTGAAGGGACTCCCAACGGACCGGACGAAATGGACGGAAGGCGACTGG
AAGAGAGTGAGATTGATAAACAAGTGGAAAGTACAACATGGTACACCTTCGTCATCAGAGAAAAACCACAACCAAGA
AGACTCTCCGGAAGAACACCAAACTTCACCATTACAGATCATGGTGACCACTGGCACATCACATACTCCGGACACCC
AACCAATAAGACCAGACATAGAGCTACAATCCTCGCCTATTTGGGAGTTACCTTTGCTGCCAGAGCCGAAGCTGAAG
CGACTACGGTACTTGTTAGAAATATCAAGAGATGGATACTCTATCTTATCAGATACGGTATTGAACGGCTTTCGTAT
TTTGGTCTTGGCC 3’(GeneBank：AF218266.2)
Selected molecular beacon：
5’FAM-CGCGCCAGACATAGAGCTACAATCCTCGCCGCGCG-Dabcyl3’
Ultra violet lamp under room temperature, infectious subcutaneous and the hematopoietic tissue necrosis disease of terminal Visual retrieval prawn
(IHHNV)：
As a result it shows：Positive findings are presented in the prawn for having infected IHHNV viruses, and healthy prawn is negative findings.
Embodiment 10：The infectious subcutaneous of hypervelocity PCR Visual retrieval prawns is combined using molecular beacon and make under room temperature
Haemal tissue necrosis is sick (IHHNV).
Exceed the speed limit PCR system：PCR reactions carry out in 25 μ L systems, which includes 1 μM of molecular beacon SpeedSTARTM
HS polymerases 12.5U, KCI 50mM, MgCl2 1.5mM, Tris-HCI 10mM, each 0.2Mm of dNTP, primer concentration are 0.4 μM
(buying from Dalian treasured bioengineering Co., Ltd, article No. RR070A).Exceed the speed limit PCR amplification program：95 DEG C of thermal starting 120s, 40
A cycle, each cycle include 95 DEG C of 4s, 60 DEG C of reaction 4s, amplification total time-consuming 7min20s.
The primer sequence used：F：5’CGGAACACAACCCGACTTTA 3’
R：5’GGCCAAGACCAAAATACGAA 3’
The template sequence of amplification：
5’GGAACACAACCCGACTTTATTGAAGGGACTCCCAACGGACCGGACGAAATGGACGGAAGGCGACTGG
AAGAGAGTGAGATTGATAAACAAGTGGAAAGTACAACATGGTACACCTTCGTCATCAGAGAAAAACCACAACCAAGA
AGACTCTCCGGAAGAACACCAAACTTCACCATTACAGATCATGGTGACCACTGGCACATCACATACTCCGGACACCC
AACCAATAAGACCAGACATAGAGCTACAATCCTCGCCTATTTGGGAGTTACCTTTGCTGCCAGAGCCGAAGCTGAAG
CGACTACGGTACTTGTTAGAAATATCAAGAGATGGATACTCTATCTTATCAGATACGGTATTGAACGGCTTTCGTAT
TTTGGTCTTGGCC 3’(GeneBank：AF218266.2)
Selected molecular beacon：
5’Texas Red-CGCGCCAGACATAGAGCTACAATCCTCGCCGCGCG-Dabcyl3’
Visible LED light irradiation under room temperature, infectious subcutaneous and the hematopoietic tissue necrosis disease of terminal Visual retrieval prawn
(IHHNV)：
As a result it shows：Positive findings are presented in the prawn for having infected IHHNV viruses, and healthy prawn is negative findings.
Embodiment 11：The infectious subcutaneous of hypervelocity PCR Visual retrieval prawns is combined using molecular beacon and make under room temperature
Haemal tissue necrosis is sick (IHHNV).
Exceed the speed limit PCR system：PCR reactions carry out in 25 μ L systems, which includes 1 μM of molecular beacon SpeedSTARTM
HS polymerases 12.5U, KCI 50mM, MgCl2 1.5mM, Tris-HCI 10mM, each 0.2Mm of dNTP, primer concentration are 0.4 μM
(buying from Dalian treasured bioengineering Co., Ltd, article No. RR070A).Exceed the speed limit PCR amplification program：95 DEG C of thermal starting 120s, 40
A cycle, each cycle include 95 DEG C of 4s, 60 DEG C of reaction 4s, amplification total time-consuming 7min20s.
The primer sequence used：F：5’CGGAACACAACCCGACTTTA 3’
R：5’GGCCAAGACCAAAATACGAA 3’
The template sequence of amplification：
5’GGAACACAACCCGACTTTATTGAAGGGACTCCCAACGGACCGGACGAAATGGACGGAAGGCGACTGG
AAGAGAGTGAGATTGATAAACAAGTGGAAAGTACAACATGGTACACCTTCGTCATCAGAGAAAAACCACAACCAAGA
AGACTCTCCGGAAGAACACCAAACTTCACCATTACAGATCATGGTGACCACTGGCACATCACATACTCCGGACACCC
AACCAATAAGACCAGACATAGAGCTACAATCCTCGCCTATTTGGGAGTTACCTTTGCTGCCAGAGCCGAAGCTGAAG
CGACTACGGTACTTGTTAGAAATATCAAGAGATGGATACTCTATCTTATCAGATACGGTATTGAACGGCTTTCGTAT
TTTGGTCTTGGCC 3’(GeneBank：AF218266.2)
Selected molecular beacon：
5’FAM-CGCGCCAGACATAGAGCTACAATCCTCGCCGCGCG-Dabcyl3’
Visible LED light irradiation under room temperature, infectious subcutaneous and the hematopoietic tissue necrosis disease of terminal Visual retrieval prawn
(IHHNV)：
As a result it shows：Positive findings are presented in the prawn for having infected IHHNV viruses, and healthy prawn is negative findings.
Embodiment 12：The infectious subcutaneous of hypervelocity PCR Visual retrieval prawns is combined using molecular beacon and make under room temperature
Haemal tissue necrosis is sick (IHHNV).
Exceed the speed limit PCR system：PCR reactions carry out in 25 μ L systems, which includes 1 μM of molecular beacon SpeedSTARTM
HS polymerases 12.5U, KCI 50mM, MgCl2 1.5mM, Tris-HCI 10mM, each 0.2Mm of dNTP, primer concentration are 0.4 μM
(buying from Dalian treasured bioengineering Co., Ltd, article No. RR070A).Exceed the speed limit PCR amplification program：95 DEG C of thermal starting 120s, 40
A cycle, each cycle include 95 DEG C of 4s, 60 DEG C of reaction 4s, amplification total time-consuming 7min20s.
The primer sequence used：F：5’CGGAACACAACCCGACTTTA 3’
R：5’GGCCAAGACCAAAATACGAA 3’
The template sequence of amplification：
5’GGAACACAACCCGACTTTATTGAAGGGACTCCCAACGGACCGGACGAAATGGACGGAAGGCGACTGG
AAGAGAGTGAGATTGATAAACAAGTGGAAAGTACAACATGGTACACCTTCGTCATCAGAGAAAAACCACAACCAAGA
AGACTCTCCGGAAGAACACCAAACTTCACCATTACAGATCATGGTGACCACTGGCACATCACATACTCCGGACACCC
AACCAATAAGACCAGACATAGAGCTACAATCCTCGCCTATTTGGGAGTTACCTTTGCTGCCAGAGCCGAAGCTGAAG
CGACTACGGTACTTGTTAGAAATATCAAGAGATGGATACTCTATCTTATCAGATACGGTATTGAACGGCTTTCGTAT
TTTGGTCTTGGCC 3’(GeneBank：AF218266.2)
Selected molecular beacon：
5’FAM-CGCGCCAGACATAGAGCTACAATCCTCGCCGCGCG-Dabcyl3’
Ultraviolet irradiation under room temperature, the infectious subcutaneous and hematopoietic tissue necrosis of terminal Visual retrieval prawn are sick (IHHNV)：
As a result it shows：Positive findings are presented in the prawn for having infected IHHNV viruses, and healthy prawn is negative findings.
Sequence table
<110>Zhejiang University
<120>Nucleic acid rapid detection method based on molecular beacon under a kind of room temperature
<130> 1
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
cggaacacaa cccgacttta 20
<210> 2
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
ggccaagacc aaaatacgaa 20
<210> 3
<211> 388
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
ggaacacaac ccgactttat tgaagggact cccaacggac cggacgaaat ggacggaagg 60
cgactggaag agagtgagat tgataaacaa gtggaaagta caacatggta caccttcgtc 120
atcagagaaa aaccacaacc aagaagactc tccggaagaa caccaaactt caccattaca 180
gatcatggtg accactggca catcacatac tccggacacc caaccaataa gaccagacat 240
agagctacaa tcctcgccta tttgggagtt acctttgctg ccagagccga agctgaagcg 300
actacggtac ttgttagaaa tatcaagaga tggatactct atcttatcag atacggtatt 360
gaacggcttt cgtattttgg tcttggcc 388
Claims (5)
1. the nucleic acid rapid detection method based on molecular beacon under a kind of room temperature is made the nucleic acid the very fast PCR of two temperatures method and is expanded
Increase, it is characterized in that molecular beacon is added in the amplification reaction system makees fluorescence instruction probe, the amplified reaction temperature becomes
Turn to 95 DEG C -60 DEG C, the single loop time≤10s, total time-consuming≤10min after amplified reaction, directly uses UV illumination
Penetrate mixed liquor after amplified reaction, visual observations, what the mixed liquor sent out that fluorescent visual is shown in is determined as the positive, is otherwise determined as the moon
Property.
2. the nucleic acid rapid detection method based on molecular beacon under a kind of room temperature is made the nucleic acid the very fast PCR of two temperatures method and is expanded
Increase, it is characterized in that molecular beacon is added in the amplification reaction system makees fluorescence instruction probe, the amplified reaction temperature becomes
Turn to 95 DEG C -60 DEG C, the single loop time≤10s, total time-consuming≤10min after amplified reaction, is filtered with optical filter one
Mixed liquor after light irradiation amplified reaction obtained by LED light, then block the mixed liquor, visual observations optical filter two with optical filter two
Thang-kng, there is what fluorescent visual was shown in be determined as the positive, be otherwise determined as feminine gender；The logical optical wavelength of first optical filter with it is described
The excitation wavelength for the fluorescent material that molecular beacon 5 ' is marked is suitable, and logical optical wavelength and the molecule of second optical filter are believed
The launch wavelength of fluorescent material that mark 5 ' is marked is suitable.
3. rapid detection method as claimed in claim 1 or 2, it is characterized in that it is a concentration of that molecular beacon is added in the system
0.01-1μM。
4. rapid detection method as claimed in claim 1 or 2, it is characterized in that it is a concentration of that molecular beacon is added in the system
0.05-0.5μM。
5. rapid detection method as claimed in claim 1 or 2, it is characterized in that it is a concentration of that molecular beacon is added in the system
0.1-0.2μM。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711080881.2A CN108130364A (en) | 2017-11-06 | 2017-11-06 | Nucleic acid rapid detection method based on molecular beacon under a kind of room temperature |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711080881.2A CN108130364A (en) | 2017-11-06 | 2017-11-06 | Nucleic acid rapid detection method based on molecular beacon under a kind of room temperature |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108130364A true CN108130364A (en) | 2018-06-08 |
Family
ID=62389141
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711080881.2A Pending CN108130364A (en) | 2017-11-06 | 2017-11-06 | Nucleic acid rapid detection method based on molecular beacon under a kind of room temperature |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108130364A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109797091A (en) * | 2019-01-17 | 2019-05-24 | 浙江大学 | A kind of rotary quickly dual temperature PCR amplification automatic control device and control method |
| CN109810891A (en) * | 2019-01-17 | 2019-05-28 | 浙江大学 | A kind of quick dual temperature PCR amplification automatic control device of rocker-type and control method |
| CN111117984A (en) * | 2018-11-01 | 2020-05-08 | 浙江大学 | CRISPR system, method and device for visually and specifically detecting nucleic acid target |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104673915A (en) * | 2015-02-13 | 2015-06-03 | 重庆京因生物科技有限责任公司 | Rapid detection kit for gene single-nucleotide polymorphism site and method for rapid detection kit |
| CN107099583A (en) * | 2017-04-05 | 2017-08-29 | 浙江大学 | A kind of quick, method for detecting specificity available for nucleic acid amplification based on molecular beacon solubility curve |
-
2017
- 2017-11-06 CN CN201711080881.2A patent/CN108130364A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104673915A (en) * | 2015-02-13 | 2015-06-03 | 重庆京因生物科技有限责任公司 | Rapid detection kit for gene single-nucleotide polymorphism site and method for rapid detection kit |
| CN107099583A (en) * | 2017-04-05 | 2017-08-29 | 浙江大学 | A kind of quick, method for detecting specificity available for nucleic acid amplification based on molecular beacon solubility curve |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111117984A (en) * | 2018-11-01 | 2020-05-08 | 浙江大学 | CRISPR system, method and device for visually and specifically detecting nucleic acid target |
| CN109797091A (en) * | 2019-01-17 | 2019-05-24 | 浙江大学 | A kind of rotary quickly dual temperature PCR amplification automatic control device and control method |
| CN109810891A (en) * | 2019-01-17 | 2019-05-28 | 浙江大学 | A kind of quick dual temperature PCR amplification automatic control device of rocker-type and control method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11603558B2 (en) | Nucleic acid amplification | |
| CN108130364A (en) | Nucleic acid rapid detection method based on molecular beacon under a kind of room temperature | |
| JP2022130735A (en) | Method and apparatus for sequential amplification reaction | |
| CN103060444B (en) | Multi-stage nucleic acid amplification reactions | |
| CN109706227A (en) | A kind of quick visualization and the nucleic acid on-site inspection method that Aerosol Pollution can be prevented | |
| CN103173434A (en) | Method and device for carrying out polymerase chain reaction under constant-temperature heat source | |
| CN109182481B (en) | A kind of high-throughput method for detecting a variety of target genes | |
| JP6381659B2 (en) | Methylation detection method | |
| CN104805218B (en) | Reaction system and method based on LAMP and molecular beacons detection HPV16 and 18 | |
| CN105555971B (en) | Probe for improving molten chain resolution and multiplicity in nucleic acid determination | |
| CA2903874C (en) | Nucleic acid amplification | |
| CN108913811A (en) | The rapid amplifying method of hepatitis B virus nucleic acid | |
| CN101712973B (en) | Reactive reagent of nucleic acid amplification by chain replacement at room temperature and nucleic acid amplification method at room temperature thereof | |
| CN104404142A (en) | Fluorescent probe for fluorescent quantitative PCR reactions | |
| CN105018593B (en) | Cold water fish detection of pathogens method | |
| JP2007125011A (en) | Method of detecting specific fragment of dna or rna with aid of polymerase chain reaction | |
| CN103820541B (en) | A kind of method quickly detecting nucleic acid based on the assembling of index hair fastener and colorimetric | |
| CN103103259A (en) | Method, kit and primers for determining whether two predetermined loci of nucleic acid sample mutate or not | |
| CN110016500A (en) | Surface-probe quantifying PCR method | |
| CN103898229B (en) | SYBR Green I fluorescence dye is used to carry out the Lateral Flow Strip of specific DNA detection | |
| CN102888452B (en) | Method for screening ALK fusion gene | |
| CN112980666A (en) | Small-sized digital PCR system and application thereof | |
| CN104195135B (en) | Primer, non-diagnosis-objective target nucleotide amplifying method and non-diagnosis-objective target nucleotide amplification detecting method | |
| KR102458651B1 (en) | Isothermal amplifier capable of real-time observation of loop-mediated isothermal amplification | |
| CN108646014A (en) | The method of fluoroscopic examination platelet derived growth factor based on aptamer conformation variation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20180608 |