CN103898229B - SYBR Green I fluorescence dye is used to carry out the Lateral Flow Strip of specific DNA detection - Google Patents
SYBR Green I fluorescence dye is used to carry out the Lateral Flow Strip of specific DNA detection Download PDFInfo
- Publication number
- CN103898229B CN103898229B CN201410151521.7A CN201410151521A CN103898229B CN 103898229 B CN103898229 B CN 103898229B CN 201410151521 A CN201410151521 A CN 201410151521A CN 103898229 B CN103898229 B CN 103898229B
- Authority
- CN
- China
- Prior art keywords
- nylon membrane
- probe
- test strip
- sequence
- influenza virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
- C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Do you the invention provides a kind of utilization SYBR? Green? I fluorescence dye carries out the technology of specific DNA rapid detection in test strip, and it comprises the following steps: select nylon membrane as the material of test strip; By probe points on nylon membrane, probe is specific nucleotide sequences to be detected, then uviolizing, baking, dark stored dry; Be template with sample to be tested, take probe as the primer of stencil design be primer, carry out pcr amplification, 94 DEG C of sex change 10min, put 4 DEG C immediately afterwards, obtain sequence to be measured; Wash buffer nylon membrane, dot blot liquid on nylon membrane, do you wherein comprise SYBR in hybridization solution? Green? I and sequence to be measured, the hybridization of room temperature dark, nylon membrane is cleaned in turn with damping fluid, deionized water, with the imagine scanner imaging of 488-nm laser, according to the whether luminous result of determination of nylon membrane.The method Jian mono-﹑ Lian Jia ﹑ fast, be applicable to clinical quick diagnosis.
Description
Technical field
The present invention relates to biological technology application, specifically a kind of SYBRGreenI of utilization fluorescence dye carries out the technology of specific DNA rapid detection in test strip.
Background technology
Pathogen detection has very important using value in a lot of research field always, especially in medical treatment and food service industry.Quick, the accurate detection and Identification of pathogenic agent are the keys of effective infection control and early treatment.But the pathogen culture of standard not only needs to hatch at least 8 hours on substratum, also will carry out extra biochemistry or Immune discrimination, not only loaded down with trivial details but also time-consuming.By contrast, quantitative polyase chain reaction (qPCR) and microarray etc. based on the detection method of nucleic acid, Geng Kuai Su ﹑ sensitive, but, still have in these methods many not only complexity but also expensive.
In recent years, tremendous contribution has been made in the development of lateral chromatography detection method to papery biological assay reported.Lateral chromatography detection method is used to carry out immunoassay at first, and it uses nanoparticle and latex microsphere can carry out instant Visual retrieval to potential nucleic acid.But this method markers step is complicated, Multiple detection can not be carried out.
Summary of the invention
Technical problem to be solved by this invention is for above the deficiencies in the prior art, provides the Lateral Flow Strip carrying out specific DNA detection that a kind of Jian mono-﹑ Lian Jia ﹑ is quick, be applicable to clinical quick diagnosis.
The technical solution adopted in the present invention is:
Use SYBRGreenI fluorescence dye to carry out a Lateral Flow Strip for specific DNA detection, comprise the following steps:
(1) selection of test strip material: select nylon membrane as the material of test strip.
(2) preparation of probe sensing layer: by probe points on nylon membrane, described probe is specific nucleotide sequences to be detected, then irradiates nylon membrane with ultraviolet, then toasts, last dark stored dry.This step effectively can improve the hybridization signal of probe and testing sample.
(3) target sequence of sample to be tested obtains: use regular-PCR technology, the homologous sequence characteristic Design pair of primers according to sample to be tested and probe carries out pcr amplification, and increased afterwards 94 DEG C of sex change 10min again, then puts 4 DEG C immediately, obtain sequence to be measured.
(4) detection of target dna: use wash buffer to secure the nylon membrane of probe, then hybridization solution on putting on nylon membrane, wherein comprise the sequence to be measured that SYBRGreenI and step (3) obtain in hybridization solution, the hybridization of room temperature dark, then nylon membrane is cleaned in turn with damping fluid, deionized water, finally use the imagine scanner of 488-nm laser to moistening nylon membrane imaging, whether send the yin and yang attribute of green fluorescence result of determination according to nylon membrane.
If there is specific nucleotide sequences to be detected in sample to be tested, so just can amplify the nucleotide fragments with probes complementary by regular-PCR amplification, so just there is the sequence that can form duplex structure with the probe sequence complementation in nylon membrane test strip in hybridization solution, so SYBRGreenI fluorescence dye is just inserted in this double-stranded DNA, like this under ultraviolet irradiation, show bright green fluorescence, this is positive findings; Otherwise, be exactly negative findings.
As preferably, in described step (1), nylon membrane is strip, is of a size of 3cm × 0.5cm.
As preferably, described step (2) middle probe is several, these several probes with fixing spaced points on nylon membrane.Several probes described are several target sequences of several target sequences that a certain disease/virus is relevant or relative disease/virus.If the probe be arranged in nylon membrane test strip is influenza virus A, B, H1, H3 tetra-kinds, just can carry out detecting above-mentioned four kinds of influenza virus types by one-time detection so simultaneously simultaneously, may be used for the type distinguishing various specific DNA, fast and easy, detected result is with strong points, tolerance range is high, and comparative is strong, and may differentiate is high.
As preferably, the concentration of described step (2) middle probe is 500nM, consumption is 0.5 μ L.Study discovery by experiment, when concentration and probe concentration is 500nM, hybridization signal reaches capacity.
As preferably, the wavelength of described step (2) middle-ultraviolet lamp is 254nm, irradiation time is 2min.Experiment finds, through the nylon membrane of uv irradiating compared with undosed, hybridization signal improves 20-30%.Uv irradiating facilitates the crosslinking reaction of probe and nylon membrane, decreases the DNA probe that hybridization incubation period is fled from from film, therefore, can obtain higher fluorescent signal.
As preferably, in described step (2), the temperature of baking is 60 DEG C, the time is 5min.Experiment finds, by UV-crosslinked mistake with without the equal 60 DEG C of bakings of UV-crosslinked film 5 minutes, fluorescent signal can be improved 20% and 40% respectively.Experiment confirms that longer baking time can not improve hybridization signal further.
As preferably, described step (4) damping fluid is TE damping fluid.
As preferably, in described step (4) hybridization solution, the concentration of SYBRGreenI is 2.5mM, the concentration of target sequence is 250nM.
As preferably, in described step (4), the time of room temperature dark hybridization is 5min.Study discovery by experiment, hybridize 5 minutes similar to hybridizing the fluorescent signal that produces for 20 minutes, longer hybridization time can make signal weakening on the contrary.This may be that the probe that some can be caused to secure owing to hybridizing hatching for a long time discharges from film.
The present invention will put nucleotide sequence not modified on nylon membrane as capture probe, testing process only needs to make target DNA and SYBRGreenI mixture hatch 5 minutes, after of short duration cleaning film bar, imaging is carried out with flat bed scanner, if there is phosphor dot at film bar specific position, the target gene existed with probes complementary is herein described.Compared with prior art, the present invention has following remarkable advantage and beneficial effect:
(1) this invention exploits one on nylon membrane with UV-crosslinked (254nm, 2min) with ephemeral fever process (60 DEG C, 5min) fix the method for probe, UV-crosslinked DNA signal is improve 20%-30%, DNA signal is improve 20% by thermal treatment;
(2) judgement of result is carried out by the SYBRGreenI colour developing of fluorescence dye, without the need to marking (as TaqMan probe
tMprobe or molecular beacon (molecularbeacon)), simple to operate, highly sensitive, high specificity, reduces testing cost to a great extent;
(3) SYBRGreenI is selected to carry out specific DNA detection as fluorescence dye, nylon membrane as the combination of test strip, through detecting, confirm this combination and the double-stranded DNA dyestuff comprising SYBRGreenI, LCGreen, EvaGreen, SYTO9, SYTO13, LightCycler480ResoLight with comprise nylon membrane, nitrocellulose membrane, PVDF membrane (PVDF) other of Paper Based Bolster Plate combine and compare, it is when carrying out detection of nucleic acids, signal to noise ratio is maximum, is most suitable for the detection carrying out test strip specific nucleic acid;
(4) the present invention is without the need to using the biochemistry of cost intensive or immune instrument, and the PCR instrument only needing a Daepori to lead to just can realize the detection of specific DNA, and this makes testing cost greatly reduce;
(5) detection method is simple to operate, and result display is fast, single-minded with strong points, be applicable to very much doctor at the four methods of diagnosis, tentatively confirm several suspicious cause of disease after, carry out further illness confirmation, be applicable to clinical expansion.
Accompanying drawing explanation
Shown in Fig. 1 is use the result figure that the present invention carries out influenza virus A, B, H1, H3 detect.
Embodiment
Below in conjunction with embodiment, the present invention is further described in detail.Iting is noted that following illustrating is all exemplary, being intended to the invention provides further instruction.Except as otherwise noted, all Science and Technology terms that the present invention uses have the identical meanings usually understood with the technical field of the invention personnel.
Main raw and reagent:
SYBRGreenI is purchased from Invitrogen (LifeTechnologyPteLtd, Singapore); Nylon membrane is purchased from Bio-Rad (Hercules, USA); Influenza virus A ﹑ B ﹑ H1 ﹑ H3 sample comes from the nose swab leach liquor of 4 influenza virus infection A ﹑ B ﹑ H1 ﹑ patients H3 respectively; Probe A, B, H1, H3, each primer are synthesized by Beijing six directions Hua Da Gene Tech. Company Limited.
Embodiment 1:
The present embodiment is intended to detect influenza virus A, B, H1, H3 and their mixture.The nucleotide sequence of concrete probe and target DNA is as shown in table 1..
Table 1. influenza virus A, B, H1, H3 probe and target DNA sequence
The present embodiment detection method comprises the following steps:
(1) selection of test strip material
Select nylon membrane (ZetaProbe
tM, 15cm × 15cmsheet, Bio-Rad) and as the material of test strip, nylon membrane is cut into the strip of 3cm × 0.5cm.
(2) preparation of probe sensing layer
By probe A, B, H1, H3 (500nM, 0.5 μ L) with fixing spaced points on the strip nylon membrane cut out, then use the ultraviolet of 254nm (UnitecLF-206LS) to irradiate 2 minutes to nylon membrane, 60 DEG C are toasted 5 minutes, last dark stored dry.
(3) target sequence of sample to be tested obtains
With probe A for template design primer is as follows:
A-F：5'AGGACAGTGGAGACTGATTCCCCTA3'(SEQIDNO：9)；
A-R：5'GAGTCTTCTAACCGAGGTCGAAACG3'(SEQIDNO：10)。
With probe B for template design primer is as follows:
B-F：5'AAAGCAAGCCTTACTACAC3'(SEQIDNO：11)；
B-R：5'TGTATCCGTGCCAACCTG3'(SEQIDNO：12)。
With probe H1 for template design primer is as follows:
H1-F：5'AGCAAAAGCAGGGGAAAATAAAAAC3'(SEQIDNO：13)；
H1-R：5'TTGCTCCCTCAGTTCCTC3'(SEQIDNO：14)。
With probe H3 for template design primer is as follows:
H3-F：5'TAATTCTATTAACCATGAAGACTAT3'(SEQIDNO：15)；
H3-R：5'TTGCTTAACATATCTGGGACA3'(SEQIDNO：16)。
Be template with influenza virus A sample, be that up/down trip primer carries out pcr amplification with A-F/A-R, increased afterwards 94 DEG C of sex change 10min again, then puts 4 DEG C immediately, obtain target sequence A.
Be template with influenza virus B sample, be that up/down trip primer carries out pcr amplification with B-F/B-R, increased afterwards 94 DEG C of sex change 10min again, then puts 4 DEG C immediately, obtain target sequence B.
Be template with influenza virus H1 sample, be that up/down trip primer carries out pcr amplification with H1-F/H1-R, increased afterwards 94 DEG C of sex change 10min again, then puts 4 DEG C immediately, obtain target sequence H1.
Be template with influenza virus H3 sample, be that up/down trip primer carries out pcr amplification with H3F/H3-R, increased afterwards 94 DEG C of sex change 10min again, then puts 4 DEG C immediately, obtain target sequence H3.
Influenza virus A PCR amplification system: 20ul
Influenza virus B PCR amplification system: 20ul
Influenza virus H1PCR amplification system: 20ul
Influenza virus H3PCR amplification system: 20ul
Pcr amplification program is:
(4) detection of target dna
Get the nylon membrane bar that five steps (2) obtain and (be labeled as Strip1 respectively, Strip2, Strip3, Strip4, Strip5), 40 μ L hybridization buffers (10mMTE/0.15MNaCl) are first used to rinse the film bar securing probe, then upper different hybridization solution, 2.5mMSYBRGreenI and 250nM target sequence A is comprised in the hybridization solution of wherein Strip1, 2.5mMSYBRGreenI and 250nM target sequence B is comprised in the hybridization solution of Strip2, 2.5mMSYBRGreenI and 250nM target sequence H1 is comprised in the hybridization solution of Strip3, 2.5mMSYBRGreenI and 250nm target sequence H3 is comprised in the hybridization solution of Strip4, 2.5mMSYBRGreenI and 250nM target sequence A is comprised in the hybridization solution of Strip5, B, H1, the mixture of H3.Room temperature dark hybridization 5 minutes, then use hybridization buffer and washed with de-ionized water, finally use the Typhoon9400 imagine scanner (GEHealthcare, USA) of 488-nm laser to moistening film bar imaging, result as shown in Figure 1.Result clearly presents the position of the phosphor dot appearance that in determinand, specificity target DNA is corresponding.Same test strip can detect multiple target DNA, greatly reduce the number of times that single detects, both reduced reagent cost and in turn saved the time.
In single test strip, multiple sequence-specific probes on point, and without the need to marking probe, making to react amplified production to multiple PCR without sequence-specific DNA binding dye (SYBRGreenI) and detecting simultaneously.This feature makes the inventive method be different from existingly to carry out the current Real-time quantitative multiplex PCR of the Multiple detection system of real-time quantitative PCR amplification owing to being subject to the some optical confinement of instrument with SYBRGreenI in the solution, can only accomplish 5 heavy pcr analysis; And be difficult to find the suitable DNA dyestuff not having overlapping excitation wavelength.And the present invention is in the analysis of DNA Multiple detection, as long as can carry out PCR, its multiplicity is just substantially unrestricted.Because disposable test paper slip multiplexed nucleic acid analysis is simple to operate, specificity is high, and cost is low, and it can carry out routine screening in the place of resource-constrained.
The raw material that embodiment is used, unless otherwise indicated, is commercially available prod and the reagent of applicable biotechnology applications.
The above embodiment of the present invention can not be used for limiting the present invention to explanation of the present invention, and any change in the implication suitable with claims of the present invention and scope, all should think to be included in the scope of claims.
Claims (3)
1. the utilization SYBRGreenI fluorescence dye of non-diagnostic object carries out an ELISA test strip method for specific DNA detection, it is characterized in that comprising the following steps:
(1) select nylon membrane as the material of test strip;
(2) by probe points on nylon membrane, described probe is specific nucleotide sequences to be detected, then irradiates nylon membrane with ultraviolet, then toasts, last dark stored dry; Described probe is several, these several probes with fixing spaced points on nylon membrane; Several probes described are influenza virus A, B, H1, H3 tetra-kinds; The concentration of described probe is 500nM, and consumption is 0.5 μ L; Described ultraviolet wavelength is 254nm, irradiation time is 2min; The temperature of baking is 60 DEG C, the time is 5min;
(3) pair of primers of stencil design of using regular-PCR technology, be template with sample to be tested, with probe be carries out pcr amplification for primer, and 94 DEG C of sex change 10min again after having increased, then put 4 DEG C immediately, obtain sequence to be measured;
(4) wash buffer is used to secure the nylon membrane of probe, then hybridization solution on putting on nylon membrane, wherein comprise the sequence to be measured that SYBRGreenI and step (3) obtain in hybridization solution, the hybridization of room temperature dark, then nylon membrane is cleaned in turn with damping fluid, deionized water, finally use the imagine scanner of 488-nm laser to moistening nylon membrane imaging, whether send the yin and yang attribute of green fluorescence result of determination according to nylon membrane; In described hybridization solution, the concentration of SYBRGreenI is 2.5mM, the concentration of sequence to be measured is 250nM; The time of described room temperature dark hybridization is 5min;
The sequence number of described influenza virus A is SEQIDNO:1; The sequence number of influenza virus B is SEQIDNO:2; The sequence number of influenza virus H1 is SEQIDNO:3; The sequence number of influenza virus H3 is SEQIDNO:4.
2. the utilization SYBRGreenI fluorescence dye of a kind of non-diagnostic object according to claim 1 carries out the ELISA test strip method of specific DNA detection, it is characterized in that in described step (1), nylon membrane is strip, is of a size of 3cm × 0.5cm.
3. the utilization SYBRGreenI fluorescence dye of a kind of non-diagnostic object according to claim 1 carries out the ELISA test strip method of specific DNA detection, it is characterized in that described step (4) damping fluid is TE damping fluid.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410151521.7A CN103898229B (en) | 2014-04-16 | 2014-04-16 | SYBR Green I fluorescence dye is used to carry out the Lateral Flow Strip of specific DNA detection |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410151521.7A CN103898229B (en) | 2014-04-16 | 2014-04-16 | SYBR Green I fluorescence dye is used to carry out the Lateral Flow Strip of specific DNA detection |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103898229A CN103898229A (en) | 2014-07-02 |
| CN103898229B true CN103898229B (en) | 2016-03-23 |
Family
ID=50989794
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410151521.7A Active CN103898229B (en) | 2014-04-16 | 2014-04-16 | SYBR Green I fluorescence dye is used to carry out the Lateral Flow Strip of specific DNA detection |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103898229B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110940646B (en) * | 2019-11-01 | 2022-08-12 | 江苏美克医学技术有限公司 | Double-fluorescence staining solution for vaginal microbial detection and application thereof |
| CN111334594B (en) * | 2020-04-03 | 2021-06-22 | 青岛科技大学 | Non-diagnosis-purpose nucleic acid amplification paper-based visual detection method |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1661104A (en) * | 2004-12-17 | 2005-08-31 | 浙江大学 | Signal detection method for gene chip of oligonucleotide with length more than 50 basic groups |
| CN1661103A (en) * | 2004-12-17 | 2005-08-31 | 浙江大学 | Gene chip in use for detecting transgene farm product |
| CN101619365A (en) * | 2009-03-06 | 2010-01-06 | 中国人民解放军第二军医大学 | Kit for detecting hepatitis B virus variation |
| CN101857903A (en) * | 2010-06-11 | 2010-10-13 | 亚能生物技术（深圳）有限公司 | Mycobacteria strain detecting dot blot membrane and kit |
| CN103403188A (en) * | 2011-01-31 | 2013-11-20 | 伊鲁米那股份有限公司 | Methods for reducing nucleic acid damage |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110086359A1 (en) * | 2008-06-10 | 2011-04-14 | Rapid Pathogen Screening, Inc. | Lateral flow assays |
-
2014
- 2014-04-16 CN CN201410151521.7A patent/CN103898229B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1661104A (en) * | 2004-12-17 | 2005-08-31 | 浙江大学 | Signal detection method for gene chip of oligonucleotide with length more than 50 basic groups |
| CN1661103A (en) * | 2004-12-17 | 2005-08-31 | 浙江大学 | Gene chip in use for detecting transgene farm product |
| CN101619365A (en) * | 2009-03-06 | 2010-01-06 | 中国人民解放军第二军医大学 | Kit for detecting hepatitis B virus variation |
| CN101857903A (en) * | 2010-06-11 | 2010-10-13 | 亚能生物技术（深圳）有限公司 | Mycobacteria strain detecting dot blot membrane and kit |
| CN103403188A (en) * | 2011-01-31 | 2013-11-20 | 伊鲁米那股份有限公司 | Methods for reducing nucleic acid damage |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103898229A (en) | 2014-07-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106119413B (en) | AIDS virus multiple fluorescence PCR detection kit and detection method | |
| US20070141575A1 (en) | Method and kit for primer based multiplex amplification of nucleic acids | |
| AU2014308980A1 (en) | Assays for single molecule detection and use thereof | |
| EP3090058A2 (en) | Systems, compositions and methods for detecting and analyzing micro-rna profiles from a biological sample | |
| US20050202414A1 (en) | Apparatus and methods for detecting a microbe in a sample | |
| JP2006201062A (en) | Nucleic acid detection or determination method | |
| JP2015536676A (en) | Method for detecting Helicobacter pylori DNA in stool samples | |
| US20210363598A1 (en) | Compositions and methods for metagenome biomarker detection | |
| WO2014193198A1 (en) | Real time quantitative and qualitative analysis method for biosubstance | |
| CN103898229B (en) | SYBR Green I fluorescence dye is used to carry out the Lateral Flow Strip of specific DNA detection | |
| JP5916740B2 (en) | Quantitative multiple identification of nucleic acid targets | |
| WO2017039144A1 (en) | Kit and method for detecting bacteria causing sexually transmitted diseases | |
| KR20160097193A (en) | Multiplex Probes | |
| WO2014039010A1 (en) | Isolated oligonucleotides, methods and kits for detection, identification and/or quantitation of chikungunya and dengue viruses | |
| JP5613160B2 (en) | Method for detecting or analyzing a target sequence in genomic DNA | |
| ITMI20101132A1 (en) | HIGH SENSITIVITY METHOD TO DETECT NUCLEIC TARGET ACID IN A SAMPLE | |
| EP4355918A1 (en) | Transcription mediated amplification methods for rna detection | |
| WO2008140494A9 (en) | High throughput screening using microarrays | |
| WO2018031545A1 (en) | Compositions and methods for detecting oral squamous cell carcinomas | |
| Can-Can et al. | Multiplex Nested Solid Phase PCR-Array Chip for Simultaneous Detection of Highly Pathogenic Microorganisms | |
| CN101386892B (en) | Common virus joint detection genotyping chip in exit-entry quarantine and detection method thereof | |
| US20180023127A1 (en) | Visually determinable genetic testing | |
| JP6468555B2 (en) | Detection kit and detection method | |
| Saijo et al. | Real-time quantitative polymerase chain reaction for virus infection diagnostics | |
| Wang et al. | Establishment of a gene detection system for hotspot mutations of hearing loss |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20201012 Address after: 314100 Building No. 2, 371 Hongye Road, Dayun Town, Jiashan County, Jiaxing City, Zhejiang Province 101 Patentee after: Aiji Taikang (Jiaxing) Biotechnology Co.,Ltd. Address before: Green Ting Road Yuhang District Cang Qian street of Hangzhou city Zhejiang province 310013 No. 1 Building 3 room 415 Patentee before: HANGZHOU XINUO BIOTECHNOLOGY Co.,Ltd. |