CN101857903A - Mycobacteria strain detecting dot blot membrane and kit - Google Patents
Mycobacteria strain detecting dot blot membrane and kit Download PDFInfo
- Publication number
- CN101857903A CN101857903A CN 201010206892 CN201010206892A CN101857903A CN 101857903 A CN101857903 A CN 101857903A CN 201010206892 CN201010206892 CN 201010206892 CN 201010206892 A CN201010206892 A CN 201010206892A CN 101857903 A CN101857903 A CN 101857903A
- Authority
- CN
- China
- Prior art keywords
- seq
- mycobacterium
- oligonucleotide probe
- detect
- base sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention discloses a mycobacteria strain detecting kit, comprising a dot blot membrane. A specific oligonucleotide probe for specifically detecting 23 mycobacteria and a primer for specifically amplifying an insertion sequence between mycobacteria 16S rRNA and 23S rRNA are fixed. The mycobacteria strain gene detecting kit adopts PCR combining with reverse DNA hybrid chip detection technology to simultaneously identify 23 mycobacteria within one day. The novel technology can simultaneously identify the most mycobacteria within shortest time and has the most reliable detection result. The kit distinguishes mycobacteria through the difference of gene sequences of different mycobacteria and carries out distinction and identification in the level of gene sequence of bacteria and molecular structure, so that the classification is more accurate and reliable.
Description
Technical field
The present invention relates to the mycobacteria strain detection range, relate in particular to a kind of mycobacteria strain detecting dot blot membrane and test kit.
Background technology
Working group is determined according to the classification of international mycobacterium, and mycobacterium is divided into three major types (Runyon classification):
One, the flora of slowly growing
1. tuberculosis flora: comprise the Bacillus tuberculosis, Bacillus tuberculosis bovis, mycobacterium africanum, mycobacterium microti.
2.I group's light chromogenic bacteria.Characteristics are that colony colour is not obvious when in the dark cultivating, propagation phase contact light after 1 hour bacterium colony to be woods lemon yellow.As: Kansas, Mycobacterium marinum etc.
3.II group scotochromogen.Characteristics are that bacterium colony is safran when in the dark cultivating, the S type.Long-term exposure then is red orange.As: scrofula, mycobacterium aquae.
4.III the group is chromogenic bacteria not.Characteristics are that general non-pigment produces.As in bird type, the born of the same parents, mycobacterium buruli etc.
Two, ramp bacterium
Be IV group bacterium, characteristics are quick growths.Comprise accidental, tortoise, M. smegmatics etc.
Three, need the special nutrition bacterium
Comprise Mycobacterium leprae, mycobacterium lepraemurim, mycobacterium paratuberculosis.
I in the Runyon classification, II, III, IV group mycobacterium are called non-tuberculous mycobacteria (nontuberculosis mycobacteria NTM) again.
The disease that non-tuberculous mycobacteria (NTM) beyond mycobacterium tuberculosis and the Mycobacterium leprae causes is called the non-tuberculous mycobacteria disease, can involve lymphoglandula, skin, soft tissue and lung.Non-tuberculous mycobacteria infects lungs, causes that pulmonary lesion is called non-tuberculous mycobacteria tuberculosis.Non-tuberculous mycobacteria (NTM) is reported in the world kind more than 150, has wherein named 54 kinds, has pathogenic mycobacterium to have 37 kinds, has isolated kind more than 20 within Chinese territory.
NTM is a kind of environment mycobacterium, major part is a metatroph, mainly be present in the physical environment, general received viewpoint is now, the people can infect NTM and be ill from environment, water and soil earth is important route of transmission, and interpersonal the propagation is not confirmed as yet, but can give the people by animal infection.
Countries in the world are because the difference of geography, environment, weather, the difference of various countries' economy, educational level, medical technique level is different with investigation method, standard to disease, the sick popularity of NTM varies, but almost is that the tuberculosis tendency reduces at present, and the NTM disease has increases trend gradually.
China's tuberculosis epidemiological random sampling survey demonstration for the first time in 1979,8 provinces and cities, 520,000 people's phlegm bacterium are cultivated positive 681 parts, are NTM through strain identification 29 strains, and separation rate is 4.3%.Nineteen ninety, national for the third time tuberculosis epidemiological random sampling survey result showed that the NTM infection rate is 15.35%, and Zhejiang Province is up to 44.89%.The NTM bacterial strain accounted for 11.1% during whole nation stream was transferred in 2000.
Non-tuberculous mycobacteria is pathogenic following characteristics:
(1) the elderly suffers from multiple disease susceptible disease.Non-tuberculous mycobacteria is usually as Secondary cases or the property followed disease, and infection has the distinguishing feature that opportunistic is this bacteria pathogenic.Often accept immunosuppressor and use the adrenocortical hormone person when chronic obstructive pulmonary disease, the elderly, malignant tumor patient, kidney dialysis, organ transplantation, this sick incidence increases.
(2) pathogenic low.It is generally acknowledged NTM pathogenic lower to the mankind than mycobacterium tuberculosis.Liu Jingdong thinks that NTM person's estimation is infected more than 100,000,000 in the whole nation, but sends out the only over one hundred example of patient.I have 9 routine patients to use respirator the lesion contemporaneously, and wherein 8 routine patients detect acid-fast bacilli from phlegm, cultivate by tubercule bacillus to add strain identification, and wherein 7 routine patients do not have the compound group of tuberculosis.Among this 8 routine patient only 1 example clear and definite pulmonary shadow is arranged.
(3) clinical symptom differs greatly.It is generally acknowledged that pulmonary lesion and pulmonary tuberculosis that NTM causes are quite similar, symptom is lighter mostly, lacking in individuality property.Generally showing as cough, expectoration, low-heat and tired or idol has spitting of blood, and some patient does not have obvious clinical symptom and sign.Because of most of patients has lung's underlying diseases, the symptom of luxuriant cough, expectoration is due to the underlying diseases by mistaken diagnosis often.
(4) acquired immune deficiency syndrome (AIDS) and HIV the infected's pilosity.In America and European acquired immune deficiency syndrome (AIDS) patient, find 50% patient infection mycobacterium, wherein 10%～15% is compound group mycobacterium in bird-born of the same parents.
(5) resistant rate height.It is 95.9% that the resistant rate of report non-tuberculous mycobacteria is arranged; Anti-multiple medicines rate is 83.7%.
Because mycobacterium resistant rate height, in the disease detection process effect of strain identification particularly important, identify better direction of medication usage of institute's infection bacteria species.
Present mycobacteria strain detection kit both domestic and external mainly exists sensing range less than normal, easily the shortcoming of omission.
Summary of the invention
For addressing the above problem, but main purpose of the present invention is to provide mycobacterium type in a kind of one-time detection 23, and detection time is short, the accurate believable mycobacteria strain detecting dot blot membrane of result.
For achieving the above object, the present invention adopts following technical scheme:
A kind of mycobacteria strain detecting dot blot membrane comprises a substrate and is fixed in described suprabasil specific oligonucleotide probe, and described specific oligonucleotide probe comprises:
1) be used to detect the specific oligonucleotide probe of M. smegmatics, its base sequence is shown in any one of SEQ ID NO:1 or SEQ ID NO:26-28;
2) be used to detect the specific oligonucleotide probe of Mycobacterium intracellulare, its base sequence is shown in any one of SEQ ID NO:2 or SEQ ID NO:29-31;
3) be used to detect the specific oligonucleotide probe of mycobacterium kansasii, its base sequence is shown in any one of SEQ ID NO:3 or SEQ ID NO:32-33;
4) be used to detect the specific oligonucleotide probe of Mycobacterium chelonei, its base sequence is shown in any one of SEQ ID NO:4 or SEQ ID NO:34-38;
5) be used to detect the specific oligonucleotide probe of Mycobacterium marinum, its base sequence is shown in any one of SEQ ID NO:5 or SEQ ID NO:39-41;
6) be used to detect the specific oligonucleotide probe of mycobacterium fortutitum, its base sequence is shown in any one of SEQ ID NO:6 or SEQ ID NO:42-45;
7) be used to detect the specific oligonucleotide probe of mycobacterium terrae, its base sequence is shown in any one of SEQ ID NO:7 or SEQ ID NO:46-48;
8) be used to detect the specific oligonucleotide probe of achromatic mycobacterium, its base sequence is shown in any one of SEQ ID NO:8 or SEQ ID NO:49-50;
9) be used to detect the specific oligonucleotide probe of mycobacterium tuberculosis, its base sequence is shown in any one of SEQ ID NO:9 or SEQ ID NO:51-53;
10) be used to detect the specific oligonucleotide probe of mycobacterium avium, its base sequence is shown in any one of SEQ ID NO:10 or SEQ ID NO:54-56;
11) be used to detect the specific oligonucleotide probe of Mycobacterium scrofulaceum, its base sequence is shown in any one of SEQ ID NO:11 or SEQ ID NO:57-58;
12) be used to detect the specific oligonucleotide probe of mycobacterium abscessus, its base sequence is shown in any one of SEQ ID NO:12 or SEQ ID NO:59-61;
13) be used to detect the specific oligonucleotide probe of mycobacterium xenopi, its base sequence is shown in any one of SEQ ID NO:13 or SEQ ID NO:62-64;
14) be used to detect the specific oligonucleotide probe of pale yellow mycobacterium, its base sequence is shown in any one of SEQ ID NO:14 or SEQ ID NO:65-67;
15) be used to detect the specific oligonucleotide probe of Mycobacterium phlei, its base sequence is shown in any one of SEQ ID NO:15 or SEQ ID NO:68-70;
16) be used to detect the specific oligonucleotide probe of mycobacterium gordonae, its base sequence is shown in any one of SEQ ID NO:16 or SEQ ID NO:71-73;
17) be used to detect the specific oligonucleotide probe of mycobacterium triviale, its base sequence is shown in any one of SEQ ID NO:17 or SEQ ID NO:74-75;
18) be used to detect the specific oligonucleotide probe of golden mycobacterium, its base sequence is shown in SEQ ID NO:18 or shown in any one of the SEQ ID NO:76-78;
19) be used to detect the specific oligonucleotide probe of stomach/mycobacterium buruli, its base sequence is shown in any one of SEQ IDNO:19 or SEQ ID NO:79-80;
20) be used to detect the specific oligonucleotide probe of cow mycobacterium, its base sequence is shown in any one of SEQ ID NO:20 or SEQ ID NO:81-82;
21) be used to detect the specific oligonucleotide probe that Suhl adds the branch bacillus, its base sequence is shown in any one of SEQ IDNO:21 or SEQ ID NO:83-84;
22) be used to detect the specific oligonucleotide probe of Di Shi mycobacterium, its base sequence is shown in any one of SEQ ID NO:22 or SEQ ID NO:85-86;
23) be used to detect the specific oligonucleotide probe of ape and monkey mycobacterium, its base sequence is shown in any one of SEQ ID NO:23 or SEQ ID NO:87-89;
Above-mentioned all sequences can be replaced by its complementary base sequences thereof.
Described substrate is a nylon membrane.
A kind of mycobacteria strain detection kit, described test kit comprises:
1) be used to detect the specific oligonucleotide probe of M. smegmatics, its base sequence is shown in any one of SEQ ID NO:1 or SEQ ID NO:26-28;
2) be used to detect the specific oligonucleotide probe of Mycobacterium intracellulare, its base sequence is shown in any one of SEQ ID NO:2 or SEQ ID NO:29-31;
3) be used to detect the specific oligonucleotide probe of mycobacterium kansasii, its base sequence is shown in any one of SEQ ID NO:3 or SEQ ID NO:32-33;
4) be used to detect the specific oligonucleotide probe of Mycobacterium chelonei, its base sequence is shown in any one of SEQ ID NO:4 or SEQ ID NO:34-38;
5) be used to detect the specific oligonucleotide probe of Mycobacterium marinum, its base sequence is shown in any one of SEQ ID NO:5 or SEQ ID NO:39-41;
6) be used to detect the specific oligonucleotide probe of mycobacterium fortutitum, its base sequence is shown in any one of SEQ ID NO:6 or SEQ ID NO:42-45;
7) be used to detect the specific oligonucleotide probe of mycobacterium terrae, its base sequence is shown in any one of SEQ ID NO:7 or SEQ ID NO:46-48;
8) be used to detect the specific oligonucleotide probe of achromatic mycobacterium, its base sequence is shown in any one of SEQ ID NO:8 or SEQ ID NO:49-50;
9) be used to detect the specific oligonucleotide probe of mycobacterium tuberculosis, its base sequence is shown in any one of SEQ ID NO:9 or SEQ ID NO:51-53;
10) be used to detect the specific oligonucleotide probe of mycobacterium avium, its base sequence is shown in any one of SEQ ID NO:10 or SEQ ID NO:54-56;
11) be used to detect the specific oligonucleotide probe of Mycobacterium scrofulaceum, its base sequence is shown in any one of SEQ ID NO:11 or SEQ ID NO:57-58;
12) be used to detect the specific oligonucleotide probe of mycobacterium abscessus, its base sequence is shown in any one of SEQ ID NO:12 or SEQ ID NO:59-61;
13) be used to detect the specific oligonucleotide probe of mycobacterium xenopi, its base sequence is shown in any one of SEQ ID NO:13 or SEQ ID NO:62-64;
14) be used to detect the specific oligonucleotide probe of pale yellow mycobacterium, its base sequence is shown in any one of SEQ ID NO:14 or SEQ ID NO:65-67;
15) be used to detect the specific oligonucleotide probe of Mycobacterium phlei, its base sequence is shown in any one of SEQ ID NO:15 or SEQ ID NO:68-70;
16) be used to detect the specific oligonucleotide probe of mycobacterium gordonae, its base sequence is shown in any one of SEQ ID NO:16 or SEQ ID NO:71-73;
17) be used to detect the specific oligonucleotide probe of mycobacterium triviale, its base sequence is shown in any one of SEQ ID NO:17 or SEQ ID NO:74-75;
18) be used to detect the specific oligonucleotide probe of golden mycobacterium, its base sequence is shown in SEQ ID NO:18 or shown in any one of the SEQ ID NO:76-78;
19) be used to detect the specific oligonucleotide probe of stomach/mycobacterium buruli, its base sequence is shown in any one of SEQ IDNO:19 or SEQ ID NO:79-80;
20) be used to detect the specific oligonucleotide probe of cow mycobacterium, its base sequence is shown in any one of SEQ ID NO:20 or SEQ ID NO:81-82;
21) be used to detect the specific oligonucleotide probe that Suhl adds the branch bacillus, its base sequence is shown in any one of SEQ IDNO:21 or SEQ ID NO:83-84;
22) be used to detect the specific oligonucleotide probe of Di Shi mycobacterium, its base sequence is shown in any one of SEQ ID NO:22 or SEQ ID NO:85-86;
23) be used to detect the specific oligonucleotide probe of ape and monkey mycobacterium, its base sequence is shown in any one of SEQ ID NO:23 or SEQ ID NO:87-89;
Above-mentioned all sequences can be replaced by its complementary base sequences thereof;
24) primer of insertion sequence between specific amplification mycobacterium 16S rRNA and the 23S rRNA, its base sequence is shown in SEQ ID NO:24-25.
Described oligonucleotide probe is fixed in the substrate.
Described oligonucleotide probe is fixed on the nylon membrane.
The present invention is according to the difference of 16S rRNA and the insertion sequence between the 23S rRNA of different mycobacteriums, through a large amount of gene order comparison and screenings, every kind of mycobacterium has been designed 3-6 bar probe, chosen the identification and detection probe of the best probe of a kind of effect respectively as this mycobacterium from these probe kinds.Designed probe is as follows:
By the combination experiment between a large amount of different probes, final definite preferred a kind of probe combinations form (is selected the probe combinations of a probe as optimum from every kind of probe kind, each combination has 23 probes), by the screening of probe, not only can eliminate the cross reaction between the probe and can accurately distinguish each mycobacterium again.
Primer design principle of the present invention and screening method:
Bacterium rRNA is divided into 3 kinds by settling ratio, is respectively 5S, 16S and 23S rRNA.16S rRNA and 23SrRNA are coding 16S rRNA and the corresponding dna sequence dnas of 23S rRNA on the bacterial chromosome, are present in all bacterial chromosome genes, and its internal structure is made up of conserved regions and variable region two portions.Its molecular memory the variable region, demonstrate the specificity on the different classification grade levels of bacterium.Therefore, can distinguish mycobacterium not of the same race, to reach the purpose of identifying different mycobacteria strains according to the specificity of the variable region of the insertion sequence (ITS sequence) between mycobacterium 16S rRNA, 23S rRNA and 16S rRNA and the 23S rRNA.But can distinguish the favored area of identifying as mycobacteria strain from these three zones of principle, but, gene order glue is conservative on the 16S rRNA zone, difference between the different mycobacteriums is less, so the situation that exists some mycobacterium to distinguish is difficult for the detection probes that design is special.And less for the research information amount of 23S rRNA, and the variation of the gene order on this zone differs greatly, also very big for the sequence difference of mycobacterium of the same race, so in the specific probe design, also have difficulty.And the region of variability of the insertion sequence between 16S rRNA and the 23S rRNA (ITS sequence) can fully be distinguished various mycobacteriums, it is the optimal zone of strain identification of carrying out mycobacterium, therefore, our product is also chosen insertion sequence (ITS sequence) between 16S rRNA and the 23S rRNA as our target gene fragment.
According to 16S rRNA of mycobacterium and the residing specific position of insertion sequence between the 23S rRNA, we choose the design section of the conserved regions of 16S rRNA as upstream primer, choose the design section of the conserved regions of 23S rRNA simultaneously as downstream primer, design four upstream primers and four downstream primers respectively according to known technology design of primers principle, choose a pair of primer that wherein amplification efficiency is the highest by test and use primer as this patented technology.Four pairs of primers of design are as follows:
| The primer title | Sequence number | Primer sequence (5`--3` |
| ??MF1 | ??SEQ?ID?NO：24 | ?????????GTGGAGGGAGCCGTCGAAGGTG |
| ??MR1 | ??SEQ?ID?NO：25 | ??BIOTIN-CGGCTCTCGATGCCAAGGCATC |
| ??MF2 | ??SEQ?ID?NO：90 | ?????????GTAACACCCGAAGCCGGTGGCC |
| ??MR2 | ??SEQ?ID?NO：91 | ??BIOTIN-ACGACATCACTCGTGCTGGTT |
| ??MF3 | ??SEQ?ID?NO：92 | ?????????GTACACACCGCCCGTCACGTCAT |
| ??MR3 | ??SEQ?ID?NO：93 | ??BIOTIN-TATCGCAGCCTCCCACGTCCTTC |
| ??MF4 | ??SEQ?ID?NO：94 | ?????????CTGGTGAATACGTTCCCGGGCC |
| ??MR4 | ??SEQ?ID?NO：95 | ??BIOTIN-GGTACTGAGATGTTTCACTTCC |
Wherein the best a pair of primer of expanding effect is as follows:
| The primer title | Sequence number | Primer sequence (5`--3` |
| ??MF1 | ??SEQ?ID?NO：24 | ?????????GTGGAGGGAGCCGTCGAAGGTG |
| ??MR1 | ??SEQ?ID?NO：25 | ??BIOTIN-CGGCTCTCGATGCCAAGGCATC |
The present invention designs special amplimer according to the conservative region of mycobacterium 16S rRNA and 23S rRNA, designs corresponding probe according to different mycobacterium 16S rRNA and the insertion sequence between the 23S rRNA, utilizes hybridization to carry out bacterial classification and detects.
Mycobacteria strain gene detecting kit of the present invention adopts PCR in conjunction with reverse DNA hybridization hybrid chip detection technique, can in the time, identify 23 kinds of mycobacteriums simultaneously, this technology is present identification of mycobacterium most species simultaneously, time is the shortest, the most reliable new technology of detected result.Test kit of the present invention is distinguished mycobacterium by the difference of the gene order of different mycobacteriums, distinguishes and identifies that it is more accurate, more reliable to classify from the gene order of bacterium and molecular structure level.Solved in traditional authentication method and identified that by the growthhabit of bacterium existing evaluation required time reaches 4-6 week, the result can't judge, identifying species is few and the part mycobacterium is existed the problem of omission.
Description of drawings
Fig. 1 is M. smegmatics (MSM) detected result figure;
Fig. 2 is Mycobacterium intracellulare (MIN) detected result figure;
Fig. 3 is mycobacterium kansasii (MKA) detected result figure;
Fig. 4 is Mycobacterium chelonei (MCH) detected result figure;
Fig. 5 is Mycobacterium marinum (MMA) detected result figure;
Fig. 6 is mycobacterium fortutitum (MFO) detected result figure;
Fig. 7 is mycobacterium terrae (MIE) detected result figure;
Fig. 8 is achromatic mycobacterium (MNO) detected result figure;
Fig. 9 is in conjunction with mycobacterium (MTC) detected result figure;
Figure 10 is mycobacterium avium (MAV) detected result figure;
Figure 11 is Mycobacterium scrofulaceum (MSC) detected result figure;
Figure 12 is mycobacterium abscessus (MAB) detected result figure;
Figure 13 is mycobacterium xenopi (MXE) detected result figure;
Figure 14 is pale yellow mycobacterium (MGI) detected result figure;
Figure 15 is Mycobacterium phlei (MPH) detected result figure;
Figure 16 is mycobacterium gordonae (MGO) detected result figure;
Figure 17 is mycobacterium triviale (MTR) detected result figure;
Figure 18 is golden mycobacterium (MAU) detected result figure;
Figure 19 is stomach/mycobacterium buruli (MGA) detected result figure;
Figure 20 is cow mycobacterium (MUA) detected result figure;
Figure 21 is that Suhl adds branch bacillus (MSZ) detected result figure;
Figure 22 is Di Shi mycobacterium (MDI) detected result figure;
Figure 23 is ape and monkey mycobacterium (MSI) detected result figure.
Embodiment
1 one kinds of mycobacteria strain detecting dot blot membranes of embodiment
Comprise a substrate and be fixed in described suprabasil specific oligonucleotide probe, described specific oligonucleotide probe comprises:
1) be used to detect the specific oligonucleotide probe of M. smegmatics, its base sequence is shown in SEQ ID NO:1;
2) be used to detect the specific oligonucleotide probe of Mycobacterium intracellulare, its base sequence is shown in SEQ ID NO:2;
3) be used to detect the specific oligonucleotide probe of mycobacterium kansasii, its base sequence is shown in SEQ ID NO:3;
4) be used to detect the specific oligonucleotide probe of Mycobacterium chelonei, its base sequence is shown in SEQ ID NO:4;
5) be used to detect the specific oligonucleotide probe of Mycobacterium marinum, its base sequence is shown in SEQ ID NO:5;
6) be used to detect the specific oligonucleotide probe of mycobacterium fortutitum, its base sequence is shown in SEQ ID NO:6;
7) be used to detect the specific oligonucleotide probe of mycobacterium terrae, its base sequence is shown in SEQ ID NO:7;
8) be used to detect the specific oligonucleotide probe of achromatic mycobacterium, its base sequence is shown in SEQ ID NO:8;
9) be used to detect the specific oligonucleotide probe of mycobacterium tuberculosis, its base sequence is shown in SEQ ID NO:9;
10) be used to detect the specific oligonucleotide probe of mycobacterium avium, its base sequence is shown in SEQ ID NO:10;
11) be used to detect the specific oligonucleotide probe of Mycobacterium scrofulaceum, its base sequence is shown in SEQ ID NO:11;
12) be used to detect the specific oligonucleotide probe of mycobacterium abscessus, its base sequence is shown in SEQ ID NO:12;
13) be used to detect the specific oligonucleotide probe of mycobacterium xenopi, its base sequence is shown in SEQ ID NO:13;
14) be used to detect the specific oligonucleotide probe of pale yellow mycobacterium, its base sequence is shown in SEQ ID NO:14;
15) be used to detect the specific oligonucleotide probe of Mycobacterium phlei, its base sequence is shown in SEQ ID NO:15;
16) be used to detect the specific oligonucleotide probe of mycobacterium gordonae, its base sequence is shown in SEQ ID NO:16;
17) be used to detect the specific oligonucleotide probe of mycobacterium triviale, its base sequence is shown in SEQ ID NO:17;
18) be used to detect the specific oligonucleotide probe of golden mycobacterium, its base sequence is shown in SEQ ID NO:18;
19) be used to detect the specific oligonucleotide probe of stomach/mycobacterium buruli, its base sequence is shown in SEQ IDNO:19;
20) be used to detect the specific oligonucleotide probe of cow mycobacterium, its base sequence is shown in SEQ ID NO:20;
21) be used to detect the specific oligonucleotide probe that Suhl adds the branch bacillus, its base sequence is shown in SEQ IDNO:21;
22) be used to detect the specific oligonucleotide probe of Di Shi mycobacterium, its base sequence is shown in SEQ ID NO:22;
23) be used to detect the specific oligonucleotide probe of ape and monkey mycobacterium, its base sequence is shown in SEQ ID NO:23;
Probe stationary method: with probe and 1M NHS, 1M DEC combination treatment, utilize the DNA point sample instrument under the control of chip manufacturing program, to carry out point sample, after point sample finishes probe can be fixed on the nylon membrane by the method that forms covalent linkage with the treated active group that contains in nylon membrane surface (amino, sulfydryl), the probe stationary amount is to be air-dry behind the probe solution point sample 1ul of 5uM.
2 one kinds of mycobacteria strain detection kit of embodiment
Described test kit comprises: be fixed with the specific oligonucleotide probe nylon membrane and
The primer of insertion sequence between specific amplification mycobacterium 16S rRNA and the 23S rRNA, its base sequence is shown in SEQ ID NO:24-25;
The fixed specific oligonucleotide probe comprises on the nylon membrane bar:
1) be used to detect the specific oligonucleotide probe of M. smegmatics, its base sequence is shown in SEQ ID NO:1;
2) be used to detect the specific oligonucleotide probe of Mycobacterium intracellulare, its base sequence is shown in SEQ ID NO:2;
3) be used to detect the specific oligonucleotide probe of mycobacterium kansasii, its base sequence is shown in SEQ ID NO:3;
4) be used to detect the specific oligonucleotide probe of Mycobacterium chelonei, its base sequence is shown in SEQ ID NO:4;
5) be used to detect the specific oligonucleotide probe of Mycobacterium marinum, its base sequence is shown in SEQ ID NO:5;
6) be used to detect the specific oligonucleotide probe of mycobacterium fortutitum, its base sequence is shown in SEQ ID NO:6;
7) be used to detect the specific oligonucleotide probe of mycobacterium terrae, its base sequence is shown in SEQ ID NO:7;
8) be used to detect the specific oligonucleotide probe of achromatic mycobacterium, its base sequence is shown in SEQ ID NO:8;
9) be used to detect the specific oligonucleotide probe of mycobacterium tuberculosis, its base sequence is shown in SEQ ID NO:9;
10) be used to detect the specific oligonucleotide probe of mycobacterium avium, its base sequence is shown in SEQ ID NO:10;
11) be used to detect the specific oligonucleotide probe of Mycobacterium scrofulaceum, its base sequence is shown in SEQ ID NO:11;
12) be used to detect the specific oligonucleotide probe of mycobacterium abscessus, its base sequence is shown in SEQ ID NO:12;
13) be used to detect the specific oligonucleotide probe of mycobacterium xenopi, its base sequence is shown in SEQ ID NO:13;
14) be used to detect the specific oligonucleotide probe of pale yellow mycobacterium, its base sequence is shown in SEQ ID NO:14;
15) be used to detect the specific oligonucleotide probe of Mycobacterium phlei, its base sequence is shown in SEQ ID NO:15;
16) be used to detect the specific oligonucleotide probe of mycobacterium gordonae, its base sequence is shown in SEQ ID NO:16;
17) be used to detect the specific oligonucleotide probe of mycobacterium triviale, its base sequence is shown in SEQ ID NO:17;
18) be used to detect the specific oligonucleotide probe of golden mycobacterium, its base sequence is shown in SEQ ID NO:18;
19) be used to detect the specific oligonucleotide probe of stomach/mycobacterium buruli, its base sequence is shown in SEQ IDNO:19;
20) be used to detect the specific oligonucleotide probe of cow mycobacterium, its base sequence is shown in SEQ ID NO:20;
21) be used to detect the specific oligonucleotide probe that Suhl adds the branch bacillus, its base sequence is shown in SEQ IDNO:21;
22) be used to detect the specific oligonucleotide probe of Di Shi mycobacterium, its base sequence is shown in SEQ ID NO:22;
23) be used to detect the specific oligonucleotide probe of ape and monkey mycobacterium, its base sequence is shown in SEQ ID NO:23.
Embodiment 3
With embodiment 2 described detection kit clinical sample is detected,
Required reagent:
20×SSC?pH?7.0
NaCl????????????175.3g
Trisodium Citrate 88.2g
Add H
2O 750mL dissolving is transferred pH to 7.0 with pH meter, is settled to 1000mL at last, and autoclaving is preserved.
10％SDS??pH?7.0
SDS??????20g
Add H
2O 180mL dissolving is transferred pH to 7.0 with pH meter,
Be settled to 200mL at last.
A liquid (pH 7.4 for 1 * SSC, 0.1%SDS)
20×SSC????100mL
10％SDS????10mL
Add H
2O is settled to 1000mL.
B liquid (pH 7.4 for 0.5 * SSC, 0.1%SDS)
20×SSC????25mL
10％SDS????10mL
Add H
2O is settled to 1000mL.
C liquid (0.1M Trisodium Citrate, pH 5.4)
1M Trisodium Citrate 100mL
Add H
2O is settled to 1000mL.
Colour developing liquid (fresh preparation is used, and is sequentially added into following solution)
C liquid 19mL
TMB?????????1mL
30％H
2O
2????2μL
1. from clinical sample, extract the mycobacterium genomic dna
Extract the mycobacterium genomic dna and can adopt the mycobacterium DNA rapid extraction test kit of Yaneng Biotechnology (Shenzhen) Co., Ltd. to extract from clinical sample, concrete extracting method is with reference to " mycobacterium DNA rapid extraction test kit process specifications ".Simultaneously also can adopt other the method or the test kit of other company to extract the mycobacterium genomic dna, the detection that the DNA amount that only need extract can reach this product requires to get final product.
The extraction of mycobacterium DNA in the sputum sample
1) collect clinical sputum sample, add the reagent that reduces phlegm (4% NaOH) of equivalent, fully vibrating reduces phlegm handled 15～30 minutes, liquefied fully until sputum.(annotate: if the dense cheese shape that is of sputum sample then adds the reagent that reduces phlegm of doubling dose.)
2) shift 1.2mL sputum sample Digestive system in the 1.5mL centrifuge tube, 12000 rev/mins, centrifugal 5 minutes, abandon supernatant.
3) add 1mL M washing lotion, fully mixing, centrifugal 2 minutes, is abandoned supernatant by 12000 rev/mins.
4) add 50 4. L M lysates, fully mixing boils 10 minutes (noticing that centrifuge tube pipe lid may pop, the careful pollution) in boiling water.
5) 12000 rev/mins, centrifugal 2 minutes, supernatant liquor promptly can be used as pcr template.
2.PCR amplification
Take out the PCR reaction tubes, on tube wall, carry out mark, after 5000rpm is centrifugal 2 seconds, add 4 4. L sample supernatant liquor as the pcr amplification template.Each experiment must be provided with a positive control and a negative control, promptly each 4. L positive control dna and lysate are template with 4.
Increase by following condition:
3. hybridization
Get the 15mL plastic centrifuge tube, put into the film bar that indicates patient numbering, add A liquid 5-6mL and all (25 μ L) PCR products, lid is tightened, mixing PCR product is unscrewed the centrifuge tube lid more slightly, and the pipe lid pops when avoiding heating.Centrifuge tube is put into 10 minutes (guaranteeing that the hybridization solution liquid level is positioned under the boiling water liquid level fully) of boiling water heating, take out and tighten lid, put into 57 ℃ of hybridization of hybridization case 1.5 to 4 hours.Get the 50mL plastics tubing simultaneously, add 40mL B liquid and in hybridization case or water bath, be preheated to 57 ℃.
Contrast: get two film bars in addition and hybridize with negative control PCR product and positive control PCR product respectively, method is the same.
4. wash film
Take out the film bar, move in the 50mL plastics tubing that preheating B liquid is housed, in 15 minutes (every pipe 40mL solution can wash 6 film bars at most simultaneously) of 57 ℃ of jog washings.
5. colour developing
With 1: 2000 POD solution of A liquid preparation (singly do two films and only need 4 μ L POD mother liquors, be mixed with 8mL and use liquid, doing four films can be mixed with 12mL and use liquid with 6 μ L POD mother liquors), the room temperature jog soaked 30 minutes, discarded POD solution.Wash twice with A liquid chamber temperature jog, each 5 minutes.Washed film 1-2 minute cofabrication colour developing liquid (colour developing liquid needs fresh preparation, joins method and sees page up) with C liquid chamber temperature.The film bar is soaked in lucifuge colour developing got final product observations in 10～15 minutes in the colour developing liquid.
6. the result judges
Every film bar of experiment all should have blue spot to occur in the PC site, and this moment, result's interpretation was considered as effectively; The Hybond membrane bar of negative control has the blue spot except that the PC site, all should not develop the color in other site, otherwise might be to take place to pollute or test and get nowhere.
Probe puts in order on the film bar:
| ??MSM | ??MIN | ??MKA | ??MCH | ??MMA | ??MFO | ??MTE | ??MNO |
| ??MTC | ??MAV | ??MSC | ??MAB | ??MXE | ??MGI | ??MPH | ??MGO |
| ??MTR | ??MAU | ??MGA | ??MUA | ??MSZ | ??MDI | ??MSI | ??PC |
The meaning of each site representative on the film bar:
| ?MSM | M. smegmatics | ??MTC | Mycobacterium tuberculosis | ??MTR | Mycobacterium triviale |
| ?MIN | Mycobacterium intracellulare | ??MAV | Mycobacterium avium | ??MAU | Golden mycobacterium |
| ?MKA | Mycobacterium kansasii | ??MSC | Mycobacterium scrofulaceum | ??MGA | Stomach/mycobacterium buruli |
| ?MCH | Mycobacterium chelonei | ??MAB | Mycobacterium abscessus | ??MUA | The cow mycobacterium |
| ?MMA | Mycobacterium marinum | ??MXE | Mycobacterium xenopi | ??MSZ | Suhl adds the branch bacillus |
| ?MFO | Mycobacterium fortutitum | ??MGI | Pale yellow mycobacterium | ??MDI | The Di Shi mycobacterium |
| ?MSM | M. smegmatics | ??MTC | Mycobacterium tuberculosis | ??MTR | Mycobacterium triviale |
| ?MTE | Mycobacterium terrae | ??MPH | Mycobacterium phlei | ??MSI | The ape and monkey mycobacterium |
| ?MNO | Achromatic mycobacterium | ??MGO | Mycobacterium gordonae | ??PC | The Quality Control point |
Can judge that by the position that spot manifests the patient is infected the type of branch bacillus.
Fig. 1 shows that the type that infects mycobacterium is M. smegmatics (MSM).
Fig. 2 shows that the type that infects mycobacterium is Mycobacterium intracellulare (MIN).
Fig. 3 shows that the type that infects mycobacterium is mycobacterium kansasii (MKA).
Fig. 4 shows that the type that infects mycobacterium is Mycobacterium chelonei (MCH).
Fig. 5 shows that the type that infects mycobacterium is Mycobacterium marinum (MMA).
Fig. 6 shows that the type that infects mycobacterium is mycobacterium fortutitum (MFO).
Fig. 7 shows that the type that infects mycobacterium is mycobacterium terrae (MIE).
Fig. 8 shows that the type that infects mycobacterium is achromatic mycobacterium (MNO).
Fig. 9 shows that the type that infects mycobacterium is in conjunction with mycobacterium (MTC).
Figure 10 shows that the type that infects mycobacterium is mycobacterium avium (MAV).
Figure 11 shows that the type that infects mycobacterium is Mycobacterium scrofulaceum (MSC).
Figure 12 shows that the type that infects mycobacterium is mycobacterium abscessus (MAB).
Figure 13 shows that the type that infects mycobacterium is mycobacterium xenopi (MXE).
Figure 14 shows that the type that infects mycobacterium is pale yellow mycobacterium (MGI).
Figure 15 shows that the type that infects mycobacterium is Mycobacterium phlei (MPH).
Figure 16 shows that the type that infects mycobacterium is mycobacterium gordonae (MGO).
Figure 17 shows that the type that infects mycobacterium is mycobacterium triviale (MTR).
Figure 18 shows that the type that infects mycobacterium is golden mycobacterium (MAU).
Figure 19 shows that the type that infects mycobacterium is stomach/mycobacterium buruli (MGA).
Figure 20 shows that the type that infects mycobacterium is cow mycobacterium (MUA).
Figure 21 shows that the type that infects mycobacterium is that Suhl adds branch bacillus (MSZ).
Figure 22 shows that the type that infects mycobacterium is Di Shi mycobacterium (MDI).
Figure 23 shows that the type that infects mycobacterium is ape and monkey mycobacterium (MSI).
SEQUENCE?LISTING
＜110〉Yaneng Biotechnology (Shenzhen) Co., Ltd.
＜120〉mycobacteria strain detecting dot blot membrane and test kit
<130>P11596
<160>95
<170>PatentIn?version?3.3
<210>1
<211>23
<212>DNA
＜213〉artificial sequence
<400>1
tttcgatgga?ctgccagaca?cac??????????????23
<210>2
<211>23
<212>DNA
＜213〉artificial sequence
<400>2
ccgggtgcac?aacagcaaat?gat??????????????23
<210>3
<211>23
<212>DNA
＜213〉artificial sequence
<400>3
ctgaggcaac?actcgggctc?tct??????????????23
<210>4
<211>23
<212>DNA
＜213〉artificial sequence
<400>4
tgtggtcttt?gacttatgga?tag????23
<210>5
<211>23
<212>DNA
＜213〉artificial sequence
<400>5
gacggaagcc?gggtgcacaa?caa????23
<210>6
<211>24
<212>DNA
＜213〉artificial sequence
<400>6
tttgtgggta?gtggttgcga?gcat???24
<210>7
<211>24
<212>DNA
＜213〉artificial sequence
<400>7
agtccttggg?ggtttctggt?ggcc???24
<210>8
<211>24
<212>DNA
＜213〉artificial sequence
<400>8
cacactgttg?ggccttgcgc?attc???24
<210>9
<211>25
<212>DNA
＜213〉artificial sequence
<400>9
gggtgcatga?caacaaagtt?ggcca????25
<210>10
<211>24
<212>DNA
＜213〉artificial sequence
<400>10
ggtgcgcaac?agcaaatgat?tgcc?????24
<210>11
<211>24
<212>DNA
＜213〉artificial sequence
<400>11
ctaaacggat?gcgttgccgg?caac?????24
<210>12
<211>23
<212>DNA
＜213〉artificial sequence
<400>12
tggactttga?cttctgaata?gtg??????23
<210>13
<211>23
<212>DNA
＜213〉artificial sequence
<400>13
ccgaggtgtt?gggcagcagg?cag??????23
<210>14
<211>24
<212>DNA
＜213〉artificial sequence
<400>14
catcgaaaga?tggtgcacag?gctt????24
<210>15
<211>25
<212>DNA
＜213〉artificial sequence
<400>15
cacactattg?ggctttgaga?caaca???25
<210>16
<211>26
<212>DNA
＜213〉artificial sequence
<400>16
tcaaaatgta?tgcgttgtcg?ttttcg??26
<210>17
<211>25
<212>DNA
＜213〉artificial sequence
<400>17
catagcagat?gagatctcta?ttgtg???25
<210>18
<211>25
<212>DNA
＜213〉artificial sequence
<400>18
gggttgtctg?gtgctgccaa?acaca???25
<210>19
<211>24
<212>DNA
＜213〉artificial sequence
<400>19
tgcgcaacag?caagcaagcc?agac????24
<210>20
<211>25
<212>DNA
＜213〉artificial sequence
<400>20
gcgctgcctt?ttggtggcgt?gttct???25
<210>21
<211>24
<212>DNA
＜213〉artificial sequence
<400>21
tgcgcggcaa?cgaacaagcc?agac????24
<210>22
<211>24
<212>DNA
＜213〉artificial sequence
<400>22
aacacactgt?tgggctttga?gatc????24
<210>23
<211>24
<212>DNA
＜213〉artificial sequence
<400>23
tgaacgcgtc?gccggcaacg?gtta????24
<210>24
<211>22
<212>DNA
＜213〉artificial sequence
<400>24
gtggagggag?ccgtcgaagg?tg????22
<210>25
<211>22
<212>DNA
＜213〉artificial sequence
<400>25
cggctctcga?tgccaaggca?tc????22
<210>26
<211>23
<212>DNA
＜213〉artificial sequence
<400>26
cacactattg?ggccctgaga?caa???23
<210>27
<211>23
<212>DNA
＜213〉artificial sequence
<400>27
tgagacaaca?ggcccgttgt?tcc???23
<210>28
<211>23
<212>DNA
＜213〉artificial sequence
<400>28
cgttgttccc?tggccactgt?gtg???23
<210>29
<211>23
<212>DNA
＜213〉artificial sequence
<400>29
atgattgcca?gacacactat?tgg????23
<210>30
<211>23
<212>DNA
＜213〉artificial sequence
<400>30
ggccctgaga?caacactcgg?tcg????23
<210>31
<211>23
<212>DNA
＜213〉artificial sequence
<400>31
gtcgatccgt?gtggagtccc?tcc????23
<210>32
<211>23
<212>DNA
＜213〉artificial sequence
<400>32
gacgaaagcc?gggtgcacga?caa????23
<210>33
<211>23
<212>DNA
＜213〉artificial sequence
<400>33
acactcgggc?tctgttcgag?agt????23
<210>34
<211>23
<212>DNA
＜213〉artificial sequence
<400>34
ggatagtggt?tgcgagcatc?taa????23
<210>35
<211>23
<212>DNA
＜213〉artificial sequence
<400>35
gagcatctaa?caagcctcgc?tcg????23
<210>36
<211>23
<212>DNA
＜213〉artificial sequence
<400>36
tcgtttacga?gtgaggttag?ttt????23
<210>37
<211>23
<212>DNA
＜213〉artificial sequence
<400>37
catctaacaa?gcctcgctcg?ttt????23
<210>38
<211>23
<212>DNA
＜213〉artificial sequence
<400>38
tgaggttagt?ttttgcaatt?tat????23
<210>39
<211>23
<212>DNA
＜213〉artificial sequence
<400>39
gcacaacaac?aagcaagcca?gac????23
<210>40
<211>23
<212>DNA
＜213〉artificial sequence
<400>40
aattggatgc?gctgcctttt?ggt????23
<210>41
<211>23
<212>DNA
＜213〉artificial sequence
<400>41
ttggtggcgt?gttctgttgt?gcg????23
<210>42
<211>23
<212>DNA
＜213〉artificial sequence
<400>42
cgagcatcta?gcacgcagaa?tcg????23
<210>43
<211>23
<212>DNA
＜213〉artificial sequence
<400>43
agaatcgtgt?ggtctcactc?ctt????23
<210>44
<211>23
<212>DNA
＜213〉artificial sequence
<400>44
tgtgggtggg?gctggttttg?tgt????23
<210>45
<211>24
<212>DNA
＜213〉artificial sequence
<400>45
ggttttgtgt?gttgatgtgc?aatt???24
<210>46
<211>24
<212>DNA
＜213〉artificial sequence
<400>46
ttttgtgctg?ggcacactgt?tggg???24
<210>47
<211>24
<212>DNA
＜213〉artificial sequence
<400>47
ctgaggcaac?aggcccgttt?gtgc???24
<210>48
<211>24
<212>DNA
＜213〉artificial sequence
<400>48
cccccgggtg?ggggtgggtg?ttgt????24
<210>49
<211>24
<212>DNA
＜213〉artificial sequence
<400>49
gccgggtgca?catggactgc?gtta????24
<210>50
<211>22
<212>DNA
＜213〉artificial sequence
<400>50
gttgttgccc?cattgcggtg?gg??????22
<210>51
<211>24
<212>DNA
＜213〉artificial sequence
<400>51
agttggccac?caacacactg?ttgg????24
<210>52
<211>24
<212>DNA
＜213〉artificial sequence
<400>52
cactgttggg?tcctgaggca?acac????24
<210>53
<211>24
<212>DNA
＜213〉artificial sequence
<400>53
gacttgttcc?aggtgttgtc?ccac????24
<210>54
<211>24
<212>DNA
＜213〉artificial sequence
<400>54
ctcggtccgt?ccgtgtggag?tccc????24
<210>55
<211>24
<212>DNA
＜213〉artificial sequence
<400>55
catctagatg?agcgcatggt?cttc????24
<210>56
<211>24
<212>DNA
＜213〉artificial sequence
<400>56
tcttcgtggc?cggcgttcat?cgaa????24
<210>57
<211>24
<212>DNA
＜213〉artificial sequence
<400>57
ggcaacggtg?gcgtgttcgt?tgaa????24
<210>58
<211>22
<212>DNA
＜213〉artificial sequence
<400>58
ggctcgttct?gagtggtgtc?cc?????22
<210>59
<211>23
<212>DNA
＜213〉artificial sequence
<400>59
ctgaatagtg?gttgcgagca?tct????23
<210>60
<211>23
<212>DNA
＜213〉artificial sequence
<400>60
agcatctaaa?catagcctcg?ctc????23
<210>61
<211>23
<212>DNA
＜213〉artificial sequence
<400>61
gctggttttt?tgcaatttta?tta????23
<210>62
<211>24
<212>DNA
＜213〉artificial sequence
<400>62
ggcagtaacc?gccggcacac?tgtt???24
<210>63
<211>24
<212>DNA
＜213〉artificial sequence
<400>63
caacacccgt?ggtggtgttg?tgct?????24
<210>64
<211>25
<212>DNA
＜213〉artificial sequence
<400>64
atctggcaaa?gactgtggta?agcgg????25
<210>65
<211>25
<212>DNA
＜213〉artificial sequence
<400>65
ggtctgtttg?ttttgcaatt?tttgt????25
<210>66
<211>25
<212>DNA
＜213〉artificial sequence
<400>66
tttccggggt?tgtggtgcga?agtca????25
<210>67
<211>24
<212>DNA
＜213〉artificial sequence
<400>67
ctttgagaca?acaggcctgt?gccc?????24
<210>68
<211>25
<212>DNA
＜213〉artificial sequence
<400>68
gagacaacag?gcccgttcgg?cccct????25
<210>69
<211>23
<212>DNA
＜213〉artificial sequence
<400>69
ggtggtgtcc?cggttgcggg?gtg??????23
<210>70
<211>24
<212>DNA
＜213〉artificial sequence
<400>70
gcatctgata?cttgagggct?cctt?????24
<210>71
<211>25
<212>DNA
＜213〉artificial sequence
<400>71
gacgaagacc?gggtgcacga?caaca????25
<210>72
<211>25
<212>DNA
＜213〉artificial sequence
<400>72
acaagctaag?ccagacacac?tattg????25
<210>73
<211>22
<212>DNA
＜213〉artificial sequence
<400>73
ggtgctgtcc?ccccattggt?gg???????22
<210>74
<211>25
<212>DNA
＜213〉artificial sequence
<400>74
gggttttgtt?tgttggtgtg?atttt????25
<210>75
<211>24
<212>DNA
＜213〉artificial sequence
<400>75
gatgtcgttg?agcttgctgt?ggtg?????24
<210>76
<211>25
<212>DNA
＜213〉artificial sequence
<400>76
tgggctttga?gacaacaggc?ccgtg????25
<210>77
<211>25
<212>DNA
＜213〉artificial sequence
<400>77
gcccgggttt?ccgggtggct?ccgcg????25
<210>78
<211>23
<212>DNA
＜213〉artificial sequence
<400>78
tggctccgcg?gtggtggggt?cgg?????23
<210>79
<211>24
<212>DNA
＜213〉artificial sequence
<400>79
ctcgggcttg?tcttggactc?gtcc?????24
<210>80
<211>25
<212>DNA
＜213〉artificial sequence
<400>80
tgcgttgccc?gcgaggtagc?gtgtt????25
<210>81
<211>25
<212>DNA
＜213〉artificial sequence
<400>81
tgcacaacaa?caagcaagcc?agacg????25
<210>82
<211>23
<212>DNA
＜213〉artificial sequence
<400>82
tgttggtttc?gggatgttgt?ccc??????23
<210>83
<211>23
<212>DNA
＜213〉artificial sequence
<400>83
aacactcagg?cttggccaga?gct?????23
<210>84
<211>24
<212>DNA
＜213〉artificial sequence
<400>84
atgcgctgcc?ctcgtggtgg?cgtg????24
<210>85
<211>25
<212>DNA
＜213〉artificial sequence
<400>85
aacaagcaga?tttggtctgc?ctagg???25
<210>86
<211>25
<212>DNA
＜213〉artificial sequence
<400>86
atctaaatgg?acgcgtcgcc?ggtcg???25
<210>87
<211>25
<212>DNA
＜213〉artificial sequence
<400>87
ggcaacggtt?acgtgttcgt?tttgt????25
<210>88
<211>25
<212>DNA
＜213〉artificial sequence
<400>88
tgcacaacaa?caggcaatcg?ccaga????25
<210>89
<211>24
<212>DNA
＜213〉artificial sequence
<400>89
ttcggttgaa?gtggtgtccc?tcca?????24
<210>90
<211>22
<212>DNA
＜213〉artificial sequence
<400>90
gtaacacccg?aagccggtgg?cc???????22
<210>91
<211>21
<212>DNA
＜213〉artificial sequence
<400>91
acgacatcac?tcgtgctggt?t????????21
<210>92
<211>23
<212>DNA
＜213〉artificial sequence
<400>92
gtacacaccg?cccgtcacgt?cat????23
<210>93
<211>23
<212>DNA
＜213〉artificial sequence
<400>93
tatcgcagcc?tcccacgtcc?ttc????23
<210>94
<211>22
<212>DNA
＜213〉artificial sequence
<400>94
ctggtgaata?cgttcccggg?cc????22
<210>95
<211>22
<212>DNA
＜213〉artificial sequence
<400>95
ggtactgaga?tgtttcactt?cc????22
Claims (6)
1. a mycobacteria strain detecting dot blot membrane comprises a substrate and is fixed in described suprabasil specific oligonucleotide probe, it is characterized in that described specific oligonucleotide probe comprises:
1) be used to detect the specific oligonucleotide probe of M. smegmatics, its base sequence is shown in any one of SEQ ID NO:1 or SEQ ID NO:26-28;
2) be used to detect the specific oligonucleotide probe of Mycobacterium intracellulare, its base sequence is shown in any one of SEQ ID NO:2 or SEQ ID NO:29-31;
3) be used to detect the specific oligonucleotide probe of mycobacterium kansasii, its base sequence is shown in any one of SEQ ID NO:3 or SEQ ID NO:32-33;
4) be used to detect the specific oligonucleotide probe of Mycobacterium chelonei, its base sequence is shown in any one of SEQ ID NO:4 or SEQ ID NO:34-38;
5) be used to detect the specific oligonucleotide probe of Mycobacterium marinum, its base sequence is shown in any one of SEQ ID NO:5 or SEQ ID NO:39-41;
6) be used to detect the specific oligonucleotide probe of mycobacterium fortutitum, its base sequence is shown in any one of SEQ ID NO:6 or SEQ ID NO:42-45;
7) be used to detect the specific oligonucleotide probe of mycobacterium terrae, its base sequence is shown in any one of SEQ ID NO:7 or SEQ ID NO:46-48;
8) be used to detect the specific oligonucleotide probe of achromatic mycobacterium, its base sequence is shown in any one of SEQ ID NO:8 or SEQ ID NO:49-50;
9) be used to detect the specific oligonucleotide probe of mycobacterium tuberculosis, its base sequence is shown in any one of SEQ ID NO:9 or SEQ ID NO:51-53;
10) be used to detect the specific oligonucleotide probe of mycobacterium avium, its base sequence is shown in any one of SEQ ID NO:10 or SEQ ID NO:54-56;
11) be used to detect the specific oligonucleotide probe of Mycobacterium scrofulaceum, its base sequence is shown in any one of SEQ ID NO:11 or SEQ ID NO:57-58;
12) be used to detect the specific oligonucleotide probe of mycobacterium abscessus, its base sequence is shown in any one of SEQ ID NO:12 or SEQ ID NO:59-61;
13) be used to detect the specific oligonucleotide probe of mycobacterium xenopi, its base sequence is shown in any one of SEQ ID NO:13 or SEQ ID NO:62-64;
14) be used to detect the specific oligonucleotide probe of pale yellow mycobacterium, its base sequence is shown in any one of SEQ ID NO:14 or SEQ ID NO:65-67;
15) be used to detect the specific oligonucleotide probe of Mycobacterium phlei, its base sequence is shown in any one of SEQ ID NO:15 or SEQ ID NO:68-70;
16) be used to detect the specific oligonucleotide probe of mycobacterium gordonae, its base sequence is shown in any one of SEQ ID NO:16 or SEQ ID NO:71-73;
17) be used to detect the specific oligonucleotide probe of mycobacterium triviale, its base sequence is shown in any one of SEQ ID NO:17 or SEQ ID NO:74-75;
18) be used to detect the specific oligonucleotide probe of golden mycobacterium, its base sequence is shown in SEQ ID NO:18 or shown in any one of the SEQ ID NO:76-78;
19) be used to detect the specific oligonucleotide probe of stomach/mycobacterium buruli, its base sequence is shown in any one of SEQ IDNO:19 or SEQ ID NO:79-80;
20) be used to detect the specific oligonucleotide probe of cow mycobacterium, its base sequence is shown in any one of SEQ ID NO:20 or SEQ ID NO:81-82;
21) be used to detect the specific oligonucleotide probe that Suhl adds the branch bacillus, its base sequence is shown in any one of SEQ IDNO:21 or SEQ ID NO:83-84;
22) be used to detect the specific oligonucleotide probe of Di Shi mycobacterium, its base sequence is shown in any one of SEQ ID NO:22 or SEQ ID NO:85-86;
23) be used to detect the specific oligonucleotide probe of ape and monkey mycobacterium, its base sequence is shown in any one of SEQ ID NO:23 or SEQ ID NO:87-89;
Above-mentioned all sequences can be replaced by its complementary base sequences thereof.
2. a kind of mycobacteria strain detecting dot blot membrane according to claim 1 is characterized in that described substrate is a nylon membrane.
3. mycobacteria strain detection kit is characterized in that described test kit comprises:
1) be used to detect the specific oligonucleotide probe of M. smegmatics, its base sequence is shown in any one of SEQ ID NO:1 or SEQ ID NO:26-28;
2) be used to detect the specific oligonucleotide probe of Mycobacterium intracellulare, its base sequence is shown in any one of SEQ ID NO:2 or SEQ ID NO:29-31;
3) be used to detect the specific oligonucleotide probe of mycobacterium kansasii, its base sequence is shown in any one of SEQ ID NO:3 or SEQ ID NO:32-33;
4) be used to detect the specific oligonucleotide probe of Mycobacterium chelonei, its base sequence is shown in any one of SEQ ID NO:4 or SEQ ID NO:34-38;
5) be used to detect the specific oligonucleotide probe of Mycobacterium marinum, its base sequence is shown in any one of SEQ ID NO:5 or SEQ ID NO:39-41;
6) be used to detect the specific oligonucleotide probe of mycobacterium fortutitum, its base sequence is shown in any one of SEQ ID NO:6 or SEQ ID NO:42-45;
7) be used to detect the specific oligonucleotide probe of mycobacterium terrae, its base sequence is shown in any one of SEQ ID NO:7 or SEQ ID NO:46-48;
8) be used to detect the specific oligonucleotide probe of achromatic mycobacterium, its base sequence is shown in any one of SEQ ID NO:8 or SEQ ID NO:49-50;
9) be used to detect the specific oligonucleotide probe of mycobacterium tuberculosis, its base sequence is shown in any one of SEQ ID NO:9 or SEQ ID NO:51-53;
10) be used to detect the specific oligonucleotide probe of mycobacterium avium, its base sequence is shown in any one of SEQ ID NO:10 or SEQ ID NO:54-56;
11) be used to detect the specific oligonucleotide probe of Mycobacterium scrofulaceum, its base sequence is shown in any one of SEQ ID NO:11 or SEQ ID NO:57-58;
12) be used to detect the specific oligonucleotide probe of mycobacterium abscessus, its base sequence is shown in any one of SEQ ID NO:12 or SEQ ID NO:59-61;
13) be used to detect the specific oligonucleotide probe of mycobacterium xenopi, its base sequence is shown in any one of SEQ ID NO:13 or SEQ ID NO:62-64;
14) be used to detect the specific oligonucleotide probe of pale yellow mycobacterium, its base sequence is shown in any one of SEQ ID NO:14 or SEQ ID NO:65-67;
15) be used to detect the specific oligonucleotide probe of Mycobacterium phlei, its base sequence is shown in any one of SEQ ID NO:15 or SEQ ID NO:68-70;
16) be used to detect the specific oligonucleotide probe of mycobacterium gordonae, its base sequence is shown in any one of SEQ ID NO:16 or SEQ ID NO:71-73;
17) be used to detect the specific oligonucleotide probe of mycobacterium triviale, its base sequence is shown in any one of SEQ ID NO:17 or SEQ ID NO:74-75;
18) be used to detect the specific oligonucleotide probe of golden mycobacterium, its base sequence is shown in SEQ ID NO:18 or shown in any one of the SEQ ID NO:76-78;
19) be used to detect the specific oligonucleotide probe of stomach/mycobacterium buruli, its base sequence is shown in any one of SEQ IDNO:19 or SEQ ID NO:79-80;
20) be used to detect the specific oligonucleotide probe of cow mycobacterium, its base sequence is shown in any one of SEQ ID NO:20 or SEQ ID NO:81-82;
21) be used to detect the specific oligonucleotide probe that Suhl adds the branch bacillus, its base sequence is shown in any one of SEQ IDNO:21 or SEQ ID NO:83-84;
22) be used to detect the specific oligonucleotide probe of Di Shi mycobacterium, its base sequence is shown in any one of SEQ ID NO:22 or SEQ ID NO:85-86;
23) be used to detect the specific oligonucleotide probe of ape and monkey mycobacterium, its base sequence is shown in any one of SEQ ID NO:23 or SEQ ID NO:87-89;
Above-mentioned all sequences can be replaced by its complementary base sequences thereof;
24) primer of insertion sequence between specific amplification mycobacterium 16S rRNA and the 23S rRNA, its base sequence is shown in SEQ ID NO:24-25.
4. a kind of mycobacteria strain detection kit according to claim 3 is characterized in that described oligonucleotide probe is fixed in the substrate.
5. a kind of mycobacteria strain detection kit according to claim 3 is characterized in that described oligonucleotide probe is fixed on the nylon membrane.
6. mycobacteria strain detection method may further comprise the steps:
1) from sample, extracts the mycobacterium genomic dna;
2) be template with step 1) gained DNA, utilize the primer of insertion sequence between the described specific amplification mycobacterium of claim 3 16S rRNA and the 23S rRNA to carry out pcr amplification;
3) above-mentioned PCR product and the described probe sequence hybridization of claim 3 that is fixed on the matrix;
4) wash film and colour developing.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010206892 CN101857903B (en) | 2010-06-11 | 2010-06-11 | Mycobacteria strain detecting dot blot membrane and kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010206892 CN101857903B (en) | 2010-06-11 | 2010-06-11 | Mycobacteria strain detecting dot blot membrane and kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101857903A true CN101857903A (en) | 2010-10-13 |
| CN101857903B CN101857903B (en) | 2013-02-06 |
Family
ID=42944059
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201010206892 Active CN101857903B (en) | 2010-06-11 | 2010-06-11 | Mycobacteria strain detecting dot blot membrane and kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101857903B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102229999A (en) * | 2011-06-01 | 2011-11-02 | 亚能生物技术（深圳）有限公司 | Kit for identifying Mycobacterium tuberculosis and nontuberculous mycobacteria and application method thereof |
| CN103898229A (en) * | 2014-04-16 | 2014-07-02 | 杭州希诺生物科技有限公司 | Test paper strip technology for detecting specific DNA (Deoxyribonucleic Acid) by applying SYBR Green I fluorescent dye |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1464906A (en) * | 2001-07-25 | 2003-12-31 | 东曹株式会社 | Oligonucleotides for detecting tubercle bacillus and method therefor |
| CN1542142A (en) * | 1999-05-29 | 2004-11-03 | Sj高技术株式会社 | Oligonucleotide for detection and identification of mycobacteria |
| CN1995380A (en) * | 2006-01-05 | 2007-07-11 | 中国人民解放军总医院第二附属医院 | Method for detecting and identifying mycobacterium tuberculosis strain and its dedicated reagent kit |
| CN1995387A (en) * | 2006-11-07 | 2007-07-11 | 亚能生物技术（深圳）有限公司 | Gene chip detecting system for mycobacteria strain identification |
-
2010
- 2010-06-11 CN CN 201010206892 patent/CN101857903B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1542142A (en) * | 1999-05-29 | 2004-11-03 | Sj高技术株式会社 | Oligonucleotide for detection and identification of mycobacteria |
| CN1464906A (en) * | 2001-07-25 | 2003-12-31 | 东曹株式会社 | Oligonucleotides for detecting tubercle bacillus and method therefor |
| CN1995380A (en) * | 2006-01-05 | 2007-07-11 | 中国人民解放军总医院第二附属医院 | Method for detecting and identifying mycobacterium tuberculosis strain and its dedicated reagent kit |
| CN1995387A (en) * | 2006-11-07 | 2007-07-11 | 亚能生物技术（深圳）有限公司 | Gene chip detecting system for mycobacteria strain identification |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102229999A (en) * | 2011-06-01 | 2011-11-02 | 亚能生物技术（深圳）有限公司 | Kit for identifying Mycobacterium tuberculosis and nontuberculous mycobacteria and application method thereof |
| CN103898229A (en) * | 2014-04-16 | 2014-07-02 | 杭州希诺生物科技有限公司 | Test paper strip technology for detecting specific DNA (Deoxyribonucleic Acid) by applying SYBR Green I fluorescent dye |
| CN103898229B (en) * | 2014-04-16 | 2016-03-23 | 杭州希诺生物科技有限公司 | SYBR Green I fluorescence dye is used to carry out the Lateral Flow Strip of specific DNA detection |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101857903B (en) | 2013-02-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Evans et al. | Characterization of novel bovine gastrointestinal tract Treponema isolates and comparison with bovine digital dermatitis treponemes | |
| Dicksved et al. | Molecular fingerprinting of the fecal microbiota of children raised according to different lifestyles | |
| Matsuda et al. | Establishment of an analytical system for the human fecal microbiota, based on reverse transcription-quantitative PCR targeting of multicopy rRNA molecules | |
| Anne et al. | Molecular identification of Mycobacterium tuberculosis in cattle | |
| Nakanaga et al. | Nineteen cases of Buruli ulcer diagnosed in Japan from 1980 to 2010 | |
| Jang et al. | Distribution of nontuberculous mycobacteria by multigene sequence-based typing and clinical significance of isolated strains | |
| Lowe et al. | PCR-based Methodologies Used to Detect and Differentiate the Burkholderia pseudomallei complex: B. pseudomallei, B. mallei, and B. thailandensis | |
| Fujimoto et al. | Quantitative detection of viable Bifidobacterium bifidum BF-1 cells in human feces by using propidium monoazide and strain-specific primers | |
| Yadav et al. | Pathogenic ‘Bison-type’Mycobacterium avium subspecies paratuberculosis genotype characterized from riverine buffalo (Bubalus bubalis) in North India | |
| CN113564272B (en) | Rapid identification and detection method for cheese lactobacillus in fermented milk | |
| CN102471806A (en) | Composition for separately detecting mycobacterium tuberculosis complex and mycobacterium genus, and method for simultaneously detecting mycobacterium tuberculosis and mycobacteria genus by real-time multiplex polymerase chain reaction usin | |
| Ballesté et al. | Bifidobacterial diversity and the development of new microbial source tracking indicators | |
| CN102808031A (en) | Multiplex polymerase chain reaction (mPCR)-denaturing high-performance liquid chromatography (DHPLC) primers and method for detecting and identifying mycobacterium | |
| Chang et al. | Rapid identification of bacteria and Candida pathogens in peritoneal dialysis effluent from patients with peritoneal dialysis-related peritonitis by use of multilocus PCR coupled with electrospray ionization mass spectrometry | |
| Ko et al. | Oligonucleotide array-based identification of species in the Acinetobacter calcoaceticus-A. baumannii complex in isolates from blood cultures and antimicrobial susceptibility testing of the isolates | |
| CN102952850B (en) | Real-time fluorescent quantitative PCR method used for detecting Mycobacterium tuberculosis, and primer, probe and kit thereof | |
| Zakham et al. | Comparison of a DNA based PCR approach with conventional methods for the detection of Mycobacterium tuberculosis in Morocco | |
| CN101857903B (en) | Mycobacteria strain detecting dot blot membrane and kit | |
| CN110168109B (en) | Diagnostic method for detecting and identifying tubercle bacillus and non-tubercle bacillus infection, confirmation of drug resistance of tubercle bacillus to rivastigmine and reagent group thereof | |
| Jang et al. | Case of pyomyositis due to Mycobacterium haemophilum in a renal transplant recipient | |
| CN103509790B (en) | Utilize the improvement tubercule bacillus diagnostic method of single tube nido real-time polymerase chain reaction (PCR) | |
| CN102229999A (en) | Kit for identifying Mycobacterium tuberculosis and nontuberculous mycobacteria and application method thereof | |
| Xu et al. | Virulence and drug resistance of aeromonas veronii isolated from shellfish. | |
| TWI306508B (en) | ||
| CN1914334B (en) | Primer for detecting mycobacterium tuberculosis and kits |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |