CN109182481B - A kind of high-throughput method for detecting a variety of target genes - Google Patents

A kind of high-throughput method for detecting a variety of target genes Download PDF

Info

Publication number
CN109182481B
CN109182481B CN201811087448.6A CN201811087448A CN109182481B CN 109182481 B CN109182481 B CN 109182481B CN 201811087448 A CN201811087448 A CN 201811087448A CN 109182481 B CN109182481 B CN 109182481B
Authority
CN
China
Prior art keywords
sequence
label
probe
target gene
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201811087448.6A
Other languages
Chinese (zh)
Other versions
CN109182481A (en
Inventor
罗光华
湛玉霞
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
First Peoples Hospital of Changzhou
Original Assignee
First Peoples Hospital of Changzhou
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by First Peoples Hospital of Changzhou filed Critical First Peoples Hospital of Changzhou
Priority to CN201811087448.6A priority Critical patent/CN109182481B/en
Publication of CN109182481A publication Critical patent/CN109182481A/en
Application granted granted Critical
Publication of CN109182481B publication Critical patent/CN109182481B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention provides a kind of high-throughput methods and kit for detecting a variety of target genes, belong to pcr gene detection technique field, comprising the following steps: design fluorescence labeling probe；The homeotic mutation sequence of the different fluorescence labeling probe of melting temperature between any two is screened as sequence label group；Sequence label in the sequence label group is wherein connect for one with target gene specific primer, obtains the specific primer of target gene tape label；By DNA sample to be checked, fluorescence labeling probe, different target gene tape label and not after the specific primer of tape label is mixed in PCR reaction system and carries out mixing gene system pcr amplification reaction, collect the fluorescence signal of melting curve, it is compared with the melting temperature Tm value of determining target gene, if they are the same, then illustrate that there are corresponding target genes in DNA sample to be checked.The method high-throughput can detect a variety of target genes, and the time is short, at low cost.

Description

A kind of high-throughput method for detecting a variety of target genes
Technical field
The invention belongs to pcr gene detection technique field more particularly to a kind of high-throughput methods for detecting a variety of target genes.
Background technique
Polymerase chain reaction (polymerase chain reaction, PCR) is a kind of by enzymatic reaction completion The method of DNA amplification in vitro, operating method is easy, detect efficiently and accurately and testing cost is low.As genetic test is examined in disease Status ever more important in controlling, in face of mass detection demand, gene sequencing technology is because its detection cycle is long, testing cost is high It is difficult to popularize, it is inexpensive, high-throughput, easy to operate as round pcr gradually becomes the conventional method of clinical gene detection The research and development of PCR new technology just seem especially urgent and important.
In recent years, with the development of multiple PCR technique, there is high-throughput PCR of many foundation on multiple PCR technique Detection method.Mode is identified according to product, is divided into using electrophoresis, mass spectrography as the open pipe high throughput PCR detection technique of representative, and Using chip method, fluorescence melting curve, high-resolution melting curve as the stopped pipe high throughput PCR detection technique of representative.Open pipe at present High-throughput detection technique using more, but due to needing open pipe to operate so there are very big product pollution risk, in addition to Other product evaluation apparatus, such as mass spectrograph, electrophoresis equipment are also needed outside PCR instrument, increases experimental cost；Stopped pipe detection Using high-throughput high-resolution melting curve technology as representative in method, this method develops more mature, but reactant at present System's requirement is especially tight, and causes the form difference on high-resolution melting curve too small when number of base difference, even if experience The technical staff of professional training abundant can not ensure the accuracy of result judgement, in addition the technology is only limitted to single channel inspection It surveys, flux optimization is limited by very large.
Summary of the invention
In view of this, the present invention provides a kind of high-throughput method for detecting a variety of target genes, the method has pollution The advantage that risk is small, easy to operate, at low cost, detection time is short, flux is high.
In order to achieve the above-mentioned object of the invention, the present invention provides a kind of high-throughput methods for detecting a variety of target genes, including Following steps:
1) random probe sequence is designed, and fluorescent marker is carried out to random probe sequence and obtains fluorescence labeling probe；
2) reverse complementary sequence of the probe sequence is subjected to random mutation, obtains the reverse complementary sequence of probe sequence Mutant nucleotide sequence group, combine complementary with probe sequence of the sequence in the mutant nucleotide sequence group is obtained into double-stranded DNA group, described in screening In double-stranded DNA group two-by-two between double-stranded DNA with the double-stranded DNA of melting temperature difference, the corresponding sequence in mutant nucleotide sequence group is anti- To sequence label group, the complementary series for synthesizing the reversed sequence label group is sequence label group；
3) specific primer pair of target gene is designed, the specific primer is to including specific forward primer and specificity Downstream primer；One of a strip label sequence and the specific primer centering in the sequence label group is connect, is obtained The specific primer of tape label sequence；
4) will the DNA fragmentation comprising target gene described in step 3), fluorescence labeling probe, the tape label sequence and without The specific primer of label, dNTPs, archaeal dna polymerase, the mixing of PCR reaction buffer carry out Single gene system pcr amplification reaction Afterwards, melting curve analysis is carried out, obtains the melting temperature Tm value of target gene, the standard Tm value as the target gene；
5) according to step 3)~4) method operate to obtain the standard Tm value of multiple and different target genes, respectively Tm1、Tm2、 Tm3……Tmn；One Connection Step 2 of the specific primer centering of different target genes) described in difference in sequence label group Sequence label；
6) by DNA sample to be checked, fluorescence labeling probe, each target gene tape label specific primer and not tape label Specific primer, dNTPs, archaeal dna polymerase, MgCl2, PCR reaction buffer mixing carry out mixed base because of system pcr amplification reaction Afterwards, melting curve analysis is carried out, by trough or the corresponding temperature value of wave crest in the melting curve and each target base in step 5) The standard Tm value of cause is compared, if the mark of the corresponding temperature value of trough or wave crest in melting curve and target gene in step 5) Quasi- TmnIt is worth identical, then illustrates to exist in DNA sample to be checked and generate the standard TmnThe target gene of value.
Preferably, the number of the target gene is 2~50.
Preferably, the fluorophor of fluorescence labeling probe described in step 1) include FAM, HEX, TET, JOE, VIC, NED, One of TAMRA, Texas Red, ROX, CY3 and CY5.
Preferably, the sequence of the fluorescence labeling probe is one or more；When the sequence of the fluorescence labeling probe is When a variety of, different fluorophors is marked on various fluorescence labeling probes.
Preferably, when the sequence of the fluorescence labeling probe is a variety of, mixing gene system PCR described in step 6) is expanded After increasing reaction, is collected by different fluorescence channels and the fluorescence of the fluorescence labeling probe melting curve of different fluorophors is marked to believe Number.
Preferably, the sequence of melting temperature difference >=0.8 DEG C is anti-between any two in the screening double-stranded DNA in step 2) To sequence label group.
Preferably, Single gene system PCR amplification and the fluorescence signal program or step of collection melting curve in step 4) 6) mixing gene system PCR amplification and the fluorescence signal program of collection melting curve are as follows in:
95 DEG C of initial denaturation, 10min；
95 DEG C of denaturation, 10s；
60 DEG C of annealing and extension, 30s；
The denaturation, annealing and extension step carry out 40 circulations.
Preferably, collected after Single gene system PCR amplification in step 4) in melting curve signal or step 6) mixed base because The program that melting curve signal is collected after system PCR amplification is as follows:
95 DEG C, 30s；30 DEG C, 4min；
After being warming up to 80 DEG C with the temperature inversion rate of 0.1 DEG C/s, 40 DEG C are cooled the temperature to.
Preferably, the system of the fluorescence signal of mixing gene system PCR amplification and collection melting curve is in step 6) 25 μ l, comprising:
PCR buffer, 2.5 μ L；
50mM MgCl2, 1 μ L；
2.5mM 4 × dNTPs, 0.7 μ L；
5U/ μ L thermal starting archaeal dna polymerase, 0.5 μ L；
Each 0.1 μ L of specific primer of 10 μM of different target gene tape labels；
10 μM of different target genes without each 0.6 μ L of tag-specific primers；
Each 0.4~1.6 μ L of 10 μM of fluorescence labeling probes；
DNA sample to be checked, 2 μ L；
The water of surplus.
The present invention also provides a kind of high-throughput kits for detecting a variety of target genes, and including following components: described is glimmering Signal probe, the specific primer of target gene tape label, not tape label target gene specific primer, dNTP, archaeal dna polymerase, MgCl2With PCR reaction buffer.
Beneficial effects of the present invention: the high-throughput method for detecting a variety of target genes provided by the invention by design and is visited The sequence label of needle sequence homology, and by the label and a connection in different target gene specific primer pairs, in PCR In amplification procedure, being identified according to the difference of Tm value whether there is corresponding target gene in sample.Method energy provided by the invention Enough to realize while detecting a variety of target genes, flux is high, and the time is short, at low cost；A kind of fluorescence marker groups can be used to mark glimmering Signal probe distinguishes different target genes, can reduce fluorescence interference, avoid false positive, while can also be effectively reduced Cost.
Detailed description of the invention
Fig. 1 is probe of the present invention and target gene tape label specific primer structural schematic diagram；
Fig. 2 is the schematic illustration of detection method；
Fig. 3 surveys in channel the detection of target gene single sample by FAM in mixed system；
Fig. 4 is the melting of all target gene samples of FAM Air conduct measurement when detecting triple channel mixing sample in mixed system Tracing analysis figure；
Fig. 5 is the detection melting curve analysis figure of single sample in HEX Air conduct measurement target gene in mixed system；
Fig. 6 is the melting curve of all target genes of HEX Air conduct measurement when detecting triple channel mixing sample in mixed system Analysis chart；
Fig. 7 is HBB mono- pattern detection melting curve analysis figure in the channel ROX in mixed system；
Fig. 8 is the melting curve of all target genes of ROX Air conduct measurement when detecting triple channel mixing sample in mixed system Analysis chart；
Fig. 9 is HBB mono- pattern detection melting curve analysis figure in the channel CY5 in mixed system；
Figure 10 is the melting curve of all target genes of CY5 Air conduct measurement when detecting triple channel mixing sample in mixed system Analysis chart.
Specific embodiment
The present invention provides a kind of high-throughput methods for detecting a variety of target genes, comprising the following steps:
1) random probe sequence is designed, and fluorescent marker is carried out to random probe sequence and obtains fluorescence labeling probe；
2) reverse complementary sequence of the probe sequence is subjected to random mutation, obtains the reverse complementary sequence of probe sequence Mutant nucleotide sequence group, combine complementary with probe sequence of the sequence in the mutant nucleotide sequence group is obtained into double-stranded DNA group, described in screening In double-stranded DNA group two-by-two between double-stranded DNA with the double-stranded DNA of melting temperature difference, the corresponding sequence in mutant nucleotide sequence group is anti- To sequence label group, the complementary series for synthesizing the reversed sequence label group is sequence label group；
3) specific primer pair of target gene is designed, the specific primer is to including specific forward primer and specificity Downstream primer；One of a strip label sequence and the specific primer centering in the sequence label group is connect, is obtained The specific primer of tape label sequence；
4) will the DNA fragmentation comprising target gene described in step 3), fluorescence labeling probe, the tape label sequence and without The specific primer of label, dNTPs, archaeal dna polymerase, the mixing of PCR reaction buffer carry out Single gene system pcr amplification reaction Afterwards, melting curve analysis is carried out, obtains the melting temperature Tm value of target gene, the standard Tm value as the target gene；
5) according to step 3)~4) method operate to obtain the standard Tm value of multiple and different target genes, respectively Tm1、Tm2、 Tm3……Tmn；One Connection Step 2 of the specific primer centering of different target genes) described in difference in sequence label group Sequence label；
6) by DNA sample to be checked, fluorescence labeling probe, the specific primer of the tape label of each target gene, each target gene Without tag-specific primers, dNTPs, archaeal dna polymerase, MgCl2, PCR reaction buffer mixing carry out mixed base because of system PCR After amplified reaction, melting curve analysis is carried out, by the trough or the corresponding temperature value of wave crest and step 5) in the melting curve In the standard Tm value of each target gene be compared, if target in the corresponding temperature value of trough or wave crest in melting curve and step 5) The standard Tm of genenIt is worth identical, then illustrates to exist in DNA sample to be checked and generate the standard TmnThe target gene of value.
In the present invention, random probe sequence is designed, and fluorescent marker is carried out to random probe sequence and obtains fluorescent marker spy Needle.The present invention preferably further includes screening step after obtaining the random probe sequence, and the screening is from the random spy In needle sequence select amplification target gene system, only in conjunction with sequence label, not with other DNA fragmentation bonding probes in system Sequence (i.e. without the probe sequence of non-specific amplification)；The present invention is not particularly limited the design method of the probe sequence and adopts With conventional method in that art.Shown in the structure of fluorescence labeling probe of the present invention such as Fig. 1 (a)；The probe sequence 5 ' ends or 3 ' end mark fluorescent groups；When 5 ' the end mark fluorescent group, 3 ' ends of the probe sequence are closed, The closing is preferably phosphate group with group.The fluorophor of heretofore described fluorescence labeling probe include FAM, HEX, One of TET, JOE, VIC, NED, TAMRA, Texas Red, ROX, CY3 and CY5.
The present invention carries out random mutation after obtaining probe sequence, by the reverse complementary sequence of the probe sequence, obtains With the mutant nucleotide sequence group of the reverse complementary sequence of probe sequence, the sequence in the mutant nucleotide sequence group is obtained in conjunction with probes complementary Double-stranded DNA, it is different to screen in the double-stranded DNA melting temperature between any two, and the sequence that melting curve can be distinguished is anti- To sequence label group, the reverse complementary sequence for synthesizing the reversed sequence label group is sequence label group.In the present invention, described Random mutation is the base mutation of different number and different loci.The reverse complementary sequence with probe sequence in the present invention It include the sequence with the stringent reverse complemental of probe in homologous sequence group.The present invention is after obtaining the sequence group, by the sequence Each of column group sequence is put into PCR reaction system with corresponding probe and carries out PCR melting curve analysis respectively, screens institute State in double-stranded DNA group the double-stranded DNA between double-stranded DNA two-by-two with melting temperature difference, the corresponding sequence group in mutant nucleotide sequence group At reversed sequence label group.In the present invention melting temperature difference it is preferred >=0.8 DEG C；More preferably >=1 DEG C.Son of the invention After obtaining the reversed sequence label group, the reverse complementary sequence for synthesizing reversed sequence label group each sequence is obtained Set of tags.
The present invention designs the specific primer pair of target gene, the specific primer is to packet after obtaining the set of tags Include specific forward primer and specific downstream primer.The present invention does not have particular/special requirement to the type of the target gene, when described When target gene is related to the diagnosing and treating related gene of disease, the method for the invention is the inspection of non-disease diagnosing and treating purpose It surveys.The quantity of target gene is preferably 2~50 in same detection architecture, is chosen as 10~35 or 15~30.The present invention couple The design method of the specific primer pair of the target gene is not particularly limited, and the primer design method using this field routine is It can.The present invention draws the strip label sequence in the sequence label group with the opposite sex after obtaining target gene specific primer pair Any one connection of object centering, obtains the specific primer of target gene tape label.
The present invention is after the specific primer for obtaining the target gene tape label, by the DNA comprising target-gene sequence, fluorescence Label probe, the specific primer of the target gene tape label, target gene not the specific primer of tape label, dNTP, polymerase, After the mixing of PCR reaction buffer carries out Single gene system pcr amplification reaction, the fluorescence signal of melting curve is collected, determines target base The melting temperature Tm value of cause.In the present invention, the Single gene system PCR amplification program is as follows: 95 DEG C of initial denaturation, 10min；Become 95 DEG C of property, 10s；60 DEG C of annealing and extension, 30s；The denaturation, annealing and extension step carry out 40 circulations；Described collect is melted The fluorescence signal program of solution curve is as follows: 95 DEG C, 30s；30 DEG C, 4min；80 DEG C are warming up to the temperature inversion rate of 0.1 DEG C/s Afterwards, 40 DEG C are cooled the temperature to；The Single gene system PCR amplification and the system for collecting the fluorescence signal of melting curve are 25 μ L, comprising:
PCR buffer, 2.5 μ L；
50mM MgCl2, 1 μ L；
2.5mM 4 × dNTPs, 0.7 μ L；
5U/ μ L thermal starting archaeal dna polymerase, 0.5 μ L；
Each 0.1 μ L of specific primer of 10 μM of different target gene tape labels；
Each 0.6 μ L of specific primer of 10 μM of different target genes not tape label；
Each 0.4 μ L of 10 μM of fluorescence labeling probes；
DNA sample comprising single target gene, 2 μ L；
The water of surplus.
The present invention is after the melting temperature for obtaining single target gene, by sequence label different in set of tags and different target bases One connection of the specific primer centering of cause, will determine the melting temperature of multiple and different target genes one by one respectively according to the method described above Spend Tm1、Tm2、Tm3……Tmn。
The present invention is after the melting temperature for obtaining multiple target genes, by DNA sample to be checked, fluorescence labeling probe, different targets The specific primer of gene tape label, different the target genes not specific primer of tape label, dNTP, polymerase, MgCl2, PCR it is anti- After answering buffer mixing to carry out mixed base because of system pcr amplification reaction, the fluorescence signal of melting curve is collected, by mixed system The corresponding temperature value of trough or wave crest in melting curve is compared with the standard Tm value of above-mentioned target gene, if in melting curve Trough or the corresponding temperature value of wave crest it is identical as the standard Tm value of above-mentioned target gene, then illustrate in DNA sample to be checked exist produce The raw standard TmnThe target gene of value.Heretofore described mixing gene system PCR amplification and the fluorescence for collecting melting curve Signal procedure is as follows: 95 DEG C of initial denaturation, 10min；95 DEG C of denaturation, 10s；60 DEG C of annealing and extension, 30s；It is described denaturation, annealing and Extend step and carries out 40 circulations；The fluorescence signal program for collecting melting curve is as follows: 95 DEG C, 30s；30 DEG C, 4min；With After the temperature inversion rate of 0.1 DEG C/s is warming up to 80 DEG C, 40 DEG C are cooled the temperature to.Heretofore described mixing gene system PCR expands The system for increasing and collecting the fluorescence signal of melting curve is 25 μ l, comprising:
PCR buffer, 2.5 μ L；
50mM MgCl2, 1 μ L；
2.5mM 4 × dNTPs, 0.7 μ L；
5U/ μ L thermal starting archaeal dna polymerase, 0.5 μ L；
Each 0.1 μ L of specific primer of 10 μM of different target gene tape labels；
Each 0.6 μ L of specific primer of 10 μM of different target genes not tape label；
Each 0.4 μ L of 10 μM of fluorescence labeling probes；
DNA sample to be checked, 2 μ L；
The water of surplus.
Heretofore described PCR amplification is preferably ddH with water2O；The reaction system reagent of the PCR is preferably Bioline The IMMOLASE thermal starting enzyme system of company；In the present invention, the PCR melting curve analysis program preferably by II gene magnification detector of LightCycler480 executes, and can also have the gene magnification inspection of melting curve analysis function by other Instrument is surveyed to execute；The II gene magnification detector of LightCycler480 or other genes for having melting curve analysis function expand Increase detector and multiple and different fluorescence detection channels is set for different fluorophors.
Testing principle and the process of detection method of the present invention in the PCR amplification and collection as shown in Fig. 2, melt During the fluorescence signal of curve, the target gene specific primer of target gene tag-specific primers and not tape label respectively in connection with Complementary region onto two chains of DNA fragmentation comprising target gene, label is in free state at this time, with the progress of duplication, Contain sequence label in the subchain synthesized by target gene tape label specific primer-primed, in subsequent amplification, tape label Duplication is then guided by the primer without label with the complementary series without Tag primer in subchain, duplication generates the reversed of label Complementary series is the target sequence for the fluorescence labeling probe that the present invention designs, and temperature is warming up to 95 degrees Celsius, so that all complementations Chain is in dissociated state, and then temperature is reduced to 30 DEG C of lasting 4min, and probe is enabled sufficiently to be incorporated into tag complement Area；Then the system after heating hybridization in such a way that the temperature inversion rate of 0.1 DEG C/s is warming up to 80 DEG C, is incorporated into label reverse mutual Fluorescence labeling probe in complementary series can be split away off, in view of fluorescence labeling probe fluorophor meeting in single-stranded and hybridized state There is the variation of fluorescence intensity, temperature when using fluorescence intensity change amount maximum therein is as melting temperature, when the same spy There are the difference of melting temperature, the root in same fluorescence detection channel when needle is with there are in conjunction with the sequence of single or several base differences Target gene detected can be identified according to the difference of melting temperature.
In the specific implementation process, different fluorescence inspections are arranged in detection method provided by the invention in the same detection architecture Channel is surveyed, each channel only needs to design a kind of sequence probes.It can be detected in single reaction tube by the same channel A variety of different target genes, multiple channels are detected simultaneously can further increase detection flux, be it is a kind of time saving and energy saving and have compared with The detection method of high economic benefit, and the accuracy detected is high, is suitable for large-scale gene screening.Detection side of the present invention Method is not necessarily to open the lid of reaction tube in the detection process, can effectively reduce pollution.
The present invention also provides a kind of high-throughput kits for detecting a variety of target genes, and including following components: described is glimmering Signal probe, the specific primer of target gene tape label, target gene without tag-specific primers, dNTP, polymerase, MgCl2With PCR reaction buffer.The preferred kit further includes the ddH of PCR2O.In the present invention, in the kit Each component with it is above-mentioned it is high-throughput detect consistent in a variety of target gene methods, details are not described herein.
Technical solution provided by the invention is described in detail below with reference to embodiment, but they cannot be understood For limiting the scope of the present invention.
Embodiment 1
The DNA fragmentation for determining a variety of target genes detected simultaneously in same reaction system, as one-time detection system Test object, have chosen in the present embodiment in human papillomavirus (Human Papilloma Virus, HPV) 16,18,31, 33,35,45,51,52,58,59,68 types and people's globin (hemoglobin beta, HBB) gene are detected as this Target gene, the DNA fragmentation of the augmentation detection of selection are 100bp or so.Wherein the segment of 16,18,31,33,35 type HPV is same One fluorescence channel detection, the segment of 45,51,52,58,59,68 type HPV are detected in the same fluorescence channel, and HBB is individually being examined Survey Air conduct measurement.
The fluorescence labeling probe being made of oligonucleotides and fluorophor is prepared, herein the probe sequence confirmation of Random Design After not will lead to nonspecific reaction, fluorophor label is carried out as probe sequence, the oligonucleotides of fluorescence labeling probe Only one end is combined with fluorophor, and fluorophor can mark at the 5 ' of oligonucleotides or 3 ' ends, when fluorescent marker is at 5 ' end, 3 ' ends of probe must be closed using phosphate group or other groups, with FAM label 16 in this example, 18,31,33, The probe of 35 type HPV sense channels uses ROX with the probe of 45,51,52,58,59,68 type HPV segment sense channel of HEX label Mark the probe in the channel HBB.
The nucleotide sequence of design and the reversed complete complementary of the fluorescence labeling probe sequence, into row stochastic difference The base mutation of quantity and different loci forms a sequence group with homology including fully-complementary sequence, Each of sequence be put into PCR reaction system with corresponding probe and carry out PCR melting curve analysis respectively, filter out with together The sequence of melting temperature difference (difference >=1 DEG C) when one probe does melting curve analysis, it is anti-to synthesize all sequences filtered out To complementary series as sequence label group, in this application example, detected with 16,18,31,33,35 type HPV of FAM label logical The probe in road marks HBB probe with ROX with the probe of 45,51,52,58,59,68 type HPV segment sense channel of HEX label, Fluorophor label uses phosphorylation modification at 5 ' ends, the end of probe 3 ', and particular sequence is shown in Table 2；
Specific primer pair is prepared respectively for the DNA fragmentation of 11 kinds to be checked different HPV hypotypes and people's cell HBB, is wrapped Include specific forward primer and specific downstream primer；
The end of one of two primers by the synthesis 5 ' and 3 ' ends of sequence label connect, and synthesis is special with label The prime end label of primer, different DNA fragmentations to be checked is different, special primer used, the sequence label, spy of this application example Needle sequence is shown in Tables 1 and 2；
By excessive dNTP, archaeal dna polymerase, Oligonucleolide primers, fluorescence labeling probe and contain DNA fragmentation to be measured DNA anabolic reaction system, carries out polymerase chain reaction in above-mentioned reaction system, and makes above-mentioned DNA piece to be measured Section expands, and single target sequence detection reaction system is prepared in this example and response procedures are as follows: the reaction system reagent of PCR is The IMMOLASE thermal starting enzyme system of Bioline company, each reaction system are 25 μ L, including 10 × PCR buffer, 2.5 μ L, 50mM MgCl214 × dNTPs of μ L, 2.5mM, 0.7 μ L, 5U/ μ L thermal starting archaeal dna polymerase, 0.2 μ L, 10 μM of different target genes Each 0.1 μ L of primer before tape label, primer 0.6 μ L, 10 μM of fluorescence labeling probes each 0.4 μ L, ddH after 10 μM of different target genes2OμL 23 μ L are complemented to, the PCR for first carrying out mixed system single sample respectively is reacted to confirm in each channel of last melting temperature The melting temperature of each target sequence primer label, therefore target sequence sample to be detected in this example is separately added into each reaction system This 2 μ L, which is put into Roche Lightcycler 480II PCR instrument and carries out polymerase chain reaction, is existed first 10min activates thermal starting enzyme at a temperature of 95 DEG C, and then 95 DEG C of 10s make template denaturation, cools the temperature to 60 DEG C of lasting 30s, at this time Primer is bound to template strand and starts to replicate, and the primer of tape label and the primer without label are respectively incorporated to mutual on two chains of segment Region is mended, label is in free state at this time, carries out 40 circulations, with the progress of duplication, is guided and is closed by the primer of tape label At subchain on contain sequence label, in subsequent amplification, in the subchain of tape label with without Tag primer complementary sequence For column then by the primer guidance duplication without label, the reverse complementary sequence that duplication generates label is the fluorescent marker of the invention designed The target sequence of probe, then carries out the fluorescence signal collection of melting curve, and program is 95 DEG C of 30s, 30 DEG C of 4min, then with 0.1 DEG C/the temperature inversion rate of s is warming up to 80 DEG C, 40 DEG C are cooled the temperature to after the completion of the process completes entire PCR reaction process.Heating System after hybridization, the fluorescence labeling probe being incorporated on label reverse complementary sequence can be split away off, and be visited in view of fluorescent marker Needle fluorophor in single-stranded and hybridized state will appear the variation of fluorescence intensity, when by fluorescence intensity change amount maximum therein Temperature as melting temperature, have melting temperature when the same probe is with there are in conjunction with the sequence of single or several base differences Difference, target gene detected can be identified in same fluorescence detection channel according to the difference of melting temperature.
As a result as shown in attached drawing 3,5 and 7, wherein Fig. 3 detects for the channel FAM institute's this single sample of test sample in mixed system: A Figure is HPV16 type DNA fragmentation melting curve figure, 41.8~42 DEG C of Tm value；Figure B is HPV18 type DNA fragmentation melting curve figure, Tm 47.8~48 DEG C of value；C figure is HPV31 type DNA fragmentation melting curve figure, 53.8~54 DEG C of Tm value；D figure is HPV33 type DNA fragmentation Melting curve figure, 59.8~60 DEG C of Tm value；E figure is HPV35 type DNA fragmentation melting curve figure, 64.8~65 DEG C of Tm value.
Fig. 5 is the detection melting curve analysis figure of single sample in HEX Air conduct measurement sample in mixed system: A figure is HPV45 type DNA fragmentation melting curve figure, 45.8~46 DEG C of Tm value；B figure is HPV51 type DNA fragmentation melting curve figure, Tm value 51.8~52 DEG C；C figure is HPV52 type DNA fragmentation melting curve figure, 57.8~58 DEG C of Tm value；D figure is that HPV58 type DNA fragmentation is molten Solution curve figure, 61.8~62 DEG C of Tm value；E figure is HPV59 type DNA fragmentation melting curve figure, 65.8~66 DEG C of Tm value；F figure is HPV68 type DNA fragmentation melting curve figure, 71.8~72 DEG C of Tm value.
Fig. 7 is HBB mono- pattern detection melting curve analysis figure in the channel ROX in mixed system.
By this detection it can be seen that Tm value is 41.8~42 DEG C when HPV16 type melting curve analysis in FAM sense channel, 18 47.8~48 DEG C of types, 31 53.8~54 DEG C of types, 33 59.8~60 DEG C of types, 35 64.8~65 DEG C of types, in HEX sense channel Tm value is 45.8~46 DEG C in HPV45 type melting curve analysis, 51 51.8~52 DEG C of types, 52 57.8~58 DEG C of types, 58 types 60.8 ~61 DEG C, 59 65~65.2 DEG C of types, 68 71.8~72 DEG C of types, ROX sense channel HBB melting curve Tm value is 70.8~71 DEG C.
After the completion of the single target sequence detection of mixed system, the detection of mixing sample in mixing PCR reaction system, PCR are carried out Reaction system is identical as above-mentioned hybrid reaction system preparation, i.e., are as follows: reagent is the IMMOLASE thermal starting enzyme body of Bioline company System, each reaction system are 25 μ L, including 10 × PCR buffer, 2.5 μ L, 50mM MgCl214 × dNTPs of μ L, 2.5mM 0.7 μ L, 5U/ μ L thermal starting archaeal dna polymerase, 0.2 μ L, each 0.1 μ L of primer before 10 μM of different target gene tape labels, 10 μM of different targets 0.6 μ L, 10 μM of probe each 0.4 μ Ls, ddH corresponding with label of primer after gene2O complements to 23 μ L, and sample be added is this reality The 2 μ L of sequence fragment and people's HBB gene segment mixing sample of used 11 kinds of different HPV types in example, response procedures are also and individually Pattern detection is identical, that is, 10min activates thermal starting enzyme at a temperature of 95 DEG C first, and then 95 DEG C of 10s make template denaturation, will be warm Degree is down to 60 DEG C of lasting 30s, carries out 40 circulations, then carries out the fluorescence signal collection of melting curve, and program is 95 DEG C of 30s, Then 30 DEG C of 4min are warming up to 80 DEG C with the temperature inversion rate of 0.1 DEG C/s, it is whole to cool the temperature to 40 DEG C of completions after the completion of the process A PCR reaction process.
In the melting curve figure that the mixing sample multichannel multiplex PCR of this application example detects as shown in Fig. 4,6 and 8. The result shows that being distinguished when all sample standard deviations can detect at the same time by the position that trough occurs, it was confirmed that this method is superior Detectability.
Embodiment 2
It is in the same manner as in Example 1 that target gene is chosen in the present embodiment, that is, includes human papillomavirus (Human Papilloma Virus, HPV) in 16,18,31,33,35,45,51,52,58,59,68 types and people's globin (hemoglobin beta, HBB) gene, the DNA fragmentation of the augmentation detection of selection is more than 100 bp.Wherein 16,18,31,33, The segment of 35 type HPV is detected in the same fluorescence channel, and the segment of 45,51,52,58,59,68 type HPV is logical in the same fluorescence Road detection, HBB are independent sense channel.
The fluorescence labeling probe being made of oligonucleotides and fluorophor is prepared, herein the probe sequence confirmation of Random Design After not will lead to nonspecific reaction, fluorophor label is carried out as probe sequence, the oligonucleotides of fluorescence labeling probe Only one end is combined with fluorophor for one end, and fluorophor can mark at 5 ' or 3 ' ends of the oligonucleotides of fluorescence labeling probe, When fluorescent marker is at 5 ' end, 3 ' ends of probe must be closed using phosphate group or other groups, the side in the present invention Different fluorescence detection channels of the method in the same detection architecture, each channel only need one probe of design.This example The middle probe with 16,18,31,33,35 type HPV sense channel of FAM label, with 45,51,52,58,59,68 type HPV of HEX label Probe used in the probe of segment sense channel, the channel FAM and the channel HEX and targeted target gene are same as Example 1, CY5 The HBB probe sequence in channel is identical as the probe sequence in the channel ROX in embodiment 1, and 5 ' fluorescent markers are different, is changed by ROX label For CY5 label probe.
The nucleotide sequence of design and the reversed complete complementary of fluorescence labeling probe sequence while prepared by probe, into The base mutation of row stochastic different number and different loci, forming one has homology including fully-complementary sequence Sequence group, each of these sequence is put into PCR reaction system with corresponding probe and carries out PCR melting curve point respectively Analysis filters out the sequence that melting temperature is different when doing melting curve analysis from the same probe, synthesizes all sequences filtered out Reverse complementary sequence is as primer label sequence group, in this application example, designs 3 groups altogether for 3 fluorescence detection channels Different label reverse complementary sequence groups picks out Tm value on melting curve and differs 4~6 DEG C of synthesis reverse complementary sequences as mark Label group, it is corresponding respectively at the probe in this 3 channels FAM, HEX, CY5；
Suitable two specificity are prepared respectively for the DNA fragmentation of 11 kinds to be checked different HPV hypotypes and people's cell HBB Primer.
The end of one of two primers by the synthesis 5 ' and 3 ' ends of sequence label connect, and synthesis is special with label The prime end label of primer, different DNA fragmentations to be checked is different, tape label used in this application example and without Tag primer sequence It arranges identical with application example 1；
By excessive dNTP, archaeal dna polymerase, Oligonucleolide primers, fluorescence labeling probe and contain DNA fragmentation to be measured DNA anabolic reaction system, carries out polymerase chain reaction in above-mentioned reaction system, and makes above-mentioned DNA piece to be measured Section expands, and single target sequence detection reaction system is prepared in mixed system in this example and response procedures are as follows: PCR's is anti- Answering system reagent is the IMMOLASE thermal starting enzyme system of Bioline company, and each reaction system is 25 μ L, including 10 × PCR 2.5 μ L, 50mM MgCl2 of buffer, 14 × dNTPs of μ L, 2.5mM, 0.7 μ L, 5U/ μ L thermal starting archaeal dna polymerase 0.2 μ L, 10 μ Each 0.1 μ L of primer before M difference target gene tape label, 0.6 μ L of primer after 10 μM of different target genes, 10 μM of probes corresponding with label are each 0.4 μ L, ddH2O complements to 23 μ L, and the PCR for first carrying out single sample respectively is reacted to confirm each channel of last melting temperature The melting temperature of interior each target sequence primer label, therefore target sequence to be detected in this example is separately added into each reaction system The reaction system is put into Roche Lightcycler 480II PCR instrument and carries out polymerase chain reaction, first 95 by sample 10min activates thermal starting enzyme at a temperature of DEG C, and then 95 DEG C of 10s make template denaturation, cools the temperature to 60 DEG C of lasting 30s, draws at this time Object is bound to template strand and starts to replicate, and the primer of tape label and the primer without label are respectively incorporated to the complementation on two chains of segment Region, label is in free state at this time, carries out 40 circulations, with the progress of duplication, is synthesized by the primer guidance of tape label Subchain on contain sequence label, in subsequent amplification, in the subchain of tape label with without Tag primer complementary series Duplication is then guided by the primer without label, the reverse complementary sequence that duplication generates label is that the fluorescent marker that the present invention designs is visited The target sequence of needle, then carry out melting curve fluorescence signal collection, program be 95 DEG C of 30s, 30 DEG C of 4min, then with 0.1 DEG C/ The temperature inversion rate of s is warming up to 80 DEG C, and 40 DEG C are cooled the temperature to after the completion of the process and completes entire PCR reaction process.It heats miscellaneous System after friendship, the fluorescence labeling probe being incorporated on label reverse complementary sequence can be split away off, in view of fluorescence labeling probe In single-stranded and hybridized state, fluorophor will appear the variation of fluorescence intensity, when by fluorescence intensity change amount maximum therein Temperature has melting temperature when the same probe is with there are in conjunction with the sequence of single or several base differences as melting temperature Difference can identify target gene detected according to the difference of melting temperature in same fluorescence detection channel.
By this detection it can be seen that Tm value is 41.8~42 DEG C when HPV16 type melting curve analysis in FAM sense channel, 18 47.8~48 DEG C of types, 31 53.8~54 DEG C of types, 33 59.8~60 DEG C of types, 35 64.8~65 DEG C of types, in HEX sense channel Tm value is 45.8~46 DEG C in HPV45 type melting curve analysis, 51 51.8~52 DEG C of types, 52 57.8~58 DEG C of types, 58 types 60.8 ~61 DEG C, 59 65~65.2 DEG C of types, 68 71.8~72 DEG C of types, CY5 sense channel HBB melting curve Tm value is 70.8~71 DEG C.
After the completion of the single target sequence detection of mixed system, the detection of mixing sample in mixing PCR reaction system, PCR are carried out Reaction system is identical as above-mentioned hybrid reaction system preparation, i.e., are as follows: reagent is the IMMOLASE thermal starting enzyme body of Bioline company System, each reaction system are 25 μ L, including 10 × PCR buffer, 2.5 μ L, 50mM MgCl214 × dNTPs of μ L, 2.5mM 0.7 μ L, 5U/ μ L thermal starting archaeal dna polymerase, 0.2 μ L, each 0.1 μ L of primer before 10 μM of different target gene tape labels, 10 μM of different targets 0.6 μ L, 10 μM of probe each 0.4 μ Ls, ddH corresponding with label of primer after gene2O complements to 23 μ L, and sample be added is this reality The 2 μ L of sequence fragment and people's HBB gene segment mixing sample of used 11 kinds of different HPV types in example, response procedures are also and individually Pattern detection is identical, that is, 10min activates thermal starting enzyme at a temperature of 95 DEG C first, and then 95 DEG C of 10s make template denaturation, will be warm Degree is down to 60 DEG C of lasting 30s, carries out 40 circulations, then carries out the fluorescence signal collection of melting curve, and program is 95 DEG C of 30s, Then 30 DEG C of 4min are warming up to 80 DEG C with the temperature inversion rate of 0.1 DEG C/s, it is whole to cool the temperature to 40 DEG C of completions after the completion of the process A PCR reaction process.
The result and embodiment 1 of the target gene of FAM and HEX Air conduct measurement are consistent, the mono- sample of HBB of CY5 sense channel detection This detection melting curve analysis figure as shown in figure 9, when detecting triple channel mixing sample in mixed system CY5 Air conduct measurement it is all The melting curve analysis figure of sample is as shown in Figure 10.It is detected in the mixing sample multichannel multiplex PCR of this application example molten It can be seen that, after the fluorescent marker for having replaced HBB probe, all samples pass through wave when can still detect at the same time in solution curve figure The position that paddy occurs distinguishes, and Tm value and indifference when Tm value and CY5 are marked on HBB melting curve when ROX is marked, into One step embodies the superior detectability of this method.
Primer sequence used in 1 embodiment of the present invention 1 and 2 of table (underscore part is sequence label)
Probe sequence used in 2 embodiment of the present invention 1 and 2 of table
The end probe 5' mark fluorescent group Without label probe sequence (5 ' to3 ')
FAM ccattacaacccttatactactccac(SEQ ID No.27)
HEX cctatctctcaacctccacccctttcac(SEQ ID No.28)
ROX ctctatgtcacttccccttggttctctcatc(SEQ ID No.29)
CY5 ctctatgtcacttccccttggttctctcatc(SEQ ID No.30)
The above is only a preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art For member, various improvements and modifications may be made without departing from the principle of the present invention, these improvements and modifications are also answered It is considered as protection scope of the present invention.
Sequence table
<110>Changzhou First People's Hospital
<120>a kind of high-throughput method for detecting a variety of target genes
<160> 30
<170> SIPOSequenceListing 1.0
<210> 1
<211> 54
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
ccattactac cgttatatta ctccacagac actaatagta atgcaagtgc cttt 54
<210> 2
<211> 29
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
attttatcca ttgactcata ctcatttgt 29
<210> 3
<211> 48
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
ccattagaac ccttaagcta ctccacgaca gcacaggcat tgttccat 48
<210> 4
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
ctccagccgc tcccctaat 19
<210> 5
<211> 52
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
ccattacttg ccttatacta ctccacgcag gcaaaaatag ttaaagattg tg 52
<210> 6
<211> 26
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
cagtcacctt cgtcactaac tttgtc 26
<210> 7
<211> 44
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
ccattactac ccttatacta ctccactttc gggtcgttgg gcag 44
<210> 8
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
ctctcatggc gtttttacac gtc 23
<210> 9
<211> 52
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
ccattacaac ccttatacta ctccacattc gcaagctaaa attgtaaaag at 52
<210> 10
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 10
ctatgtccct ccagtcaccg tc 22
<210> 11
<211> 52
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 11
cctgtctttc aacctccact actttcacta aaaagtaact gccaagccaa at 52
<210> 12
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 12
ctccaatccc caccttcatc t 21
<210> 13
<211> 53
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 13
cctatctctt aacctccact gctttcacac aggagataat gtttcggatg atg 53
<210> 14
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 14
tcctgttccg cctgactgc 19
<210> 15
<211> 54
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 15
cctatctctc agcctccact cctttcacac aaacaggaga taacatttca gagg 54
<210> 16
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 16
tgcctcatgt tctgcctgtt c 21
<210> 17
<211> 55
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 17
cctatctcgt aacctccacc cctttcacat gatagatgat gtaacagcca taagc 55
<210> 18
<211> 30
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 18
gtactaatgc cctatgtttt acatctattg 30
<210> 19
<211> 56
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 19
ccttactctc aacctccacc cctttcacgg caatagtaga taaaaaaaca ggtgac 56
<210> 20
<211> 24
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 20
gctctgcctg tacacaaatt gttg 24
<210> 21
<211> 50
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 21
cctatctctc aacctccacc cctttcacta gccatgytag atgacgcaac 50
<210> 22
<211> 30
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 22
ggtgtctgtg ttttctrtct aaacttattg 30
<210> 23
<211> 53
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 23
ctctatgtca cttccccttg gttctctcat caggttcttt gagtcctttg ggg 53
<210> 24
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 24
gaggttgtcc aggtgagcca g 21
<210> 25
<211> 53
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 25
ctctatgtca cttccccttg gttctctcat caggttcttt gagtcctttg ggg 53
<210> 26
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 26
gaggttgtcc aggtgagcca g 21
<210> 27
<211> 26
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 27
ccattacaac ccttatacta ctccac 26
<210> 28
<211> 28
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 28
cctatctctc aacctccacc cctttcac 28
<210> 29
<211> 31
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 29
ctctatgtca cttccccttg gttctctcat c 31
<210> 30
<211> 31
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 30
ctctatgtca cttccccttg gttctctcat c 31

Claims (8)

1. a kind of method that the high throughput of non-disease diagnosing and treating purpose detects a variety of target genes, comprising the following steps:
1) random probe sequence is designed, and fluorescent marker is carried out to random probe sequence and obtains fluorescence labeling probe；
2) reverse complementary sequence of the probe sequence is subjected to random mutation, obtains the prominent of the reverse complementary sequence of probe sequence Become sequence group, combine complementary with probe sequence of the sequence in the mutant nucleotide sequence group is obtained into double-stranded DNA group, screens the double-strand In DNA group two-by-two between double-stranded DNA with the double-stranded DNA of melting temperature difference, the corresponding sequence in mutant nucleotide sequence group is reversely to mark Sequence group is signed, the complementary series for synthesizing the reversed sequence label group is sequence label group；
3) specific primer pair of target gene is designed, the specific primer is to including specific forward primer and specific Down Stream Primer；One of a strip label sequence and the specific primer centering in the sequence label group is connect, band mark is obtained Sign the specific primer of sequence；
It 4) will the DNA fragmentation comprising target gene described in step 3), fluorescence labeling probe, the tape label sequence and not tape label Specific primer, dNTPs, archaeal dna polymerase, PCR reaction buffer mixing carry out Single gene system pcr amplification reaction after, into Row melting curve analysis obtains the melting temperature Tm value of target gene, the standard Tm value as the target gene；
5) according to step 3)~4) method operate to obtain the standard Tm value of multiple and different target genes, respectively Tm1、Tm2、 Tm3……Tmn；The specific primer Connection Step 2 of different target genes) described in different sequence labels in sequence label group；
6) by DNA sample to be checked, fluorescence labeling probe, the tape label of each target gene and not the specific primer of tape label, After dNTPs, archaeal dna polymerase, the mixing of MgCl, PCR reaction buffer carry out mixed base because of system pcr amplification reaction, melted Tracing analysis, by the standard Tm value of trough or the corresponding temperature value of wave crest and each target gene in step 5) in the melting curve It is compared, if the corresponding temperature value of trough or wave crest in melting curve is identical as the standard Tm value of target gene in step 5), Then illustrate there is the target gene for generating the standard Tm value in DNA sample to be checked；
The sequence of the fluorescence labeling probe is one or more；It is various when the sequence of the fluorescence labeling probe is a variety of Different fluorophors is marked on fluorescence labeling probe；
When the sequence of the fluorescence labeling probe is a variety of, after mixing gene system pcr amplification reaction described in step 6), lead to It crosses different fluorescence channels and collects the fluorescence signal for marking the fluorescence labeling probe melting curve of different fluorophors.
2. the method that the high throughput of non-disease diagnosing and treating purpose according to claim 1 detects a variety of target genes, It is characterized in that, the number of the target gene is 2~50.
3. the method that the high throughput of non-disease diagnosing and treating purpose according to claim 1 detects a variety of target genes, Be characterized in that, the fluorophor of fluorescence labeling probe described in step 1) include FAM, HEX, TET, JOE, VIC, NED, TAMRA, One of Texas Red, ROX, CY3 and CY5.
4. the method that the high throughput of non-disease diagnosing and treating purpose according to claim 1 detects a variety of target genes, It being characterized in that, melting temperature described in step 2) is poor >=and 0.8 DEG C.
5. the method that the high throughput of non-disease diagnosing and treating purpose according to claim 1 detects a variety of target genes, It is characterized in that, Single gene system PCR amplification or the middle mixing gene system PCR amplification program of step 6) are as follows in step 4): pre- to become 95 DEG C of property, 10min；95 DEG C of denaturation, 10s；60 DEG C of annealing and extension, 30s；The denaturation, annealing and extension step carry out 40 Circulation.
6. the method that the high throughput of non-disease diagnosing and treating purpose according to claim 1 detects a variety of target genes, It is characterized in that, is collected after Single gene system PCR amplification in step 4) and mix gene system PCR in melting curve signal or step 6) The program that melting curve signal is collected after amplification is as follows: 95 DEG C, 30s；30 DEG C, 4min；It is heated up with the temperature inversion rate of 0.1 DEG C/s To after 80 DEG C, 40 DEG C are cooled the temperature to.
7. the method that the high throughput of non-disease diagnosing and treating purpose according to claim 1 detects a variety of target genes, It is characterized in that, the system of the fluorescence signal of mixing gene system PCR amplification and collection melting curve is 25 μ l, packet in step 6) It includes: PCR buffer, 2.5 μ L；50mM MgCl2 , 1 μ L；2.5mM 4 × dNTPs, 0.7 μ L；5U/ μ L thermal starting archaeal dna polymerase, 0.5μL；Each 0.1 μ L of specific primer of 10 μM of different target gene tape labels；The not tape label specificity of 10 μM of different target genes Each 0.6 μ L of primer；Each 0.4~1.6 μ L of 10 μM of fluorescence labeling probes；DNA sample to be checked, 2 μ L；The water of surplus.
8. a kind of high-throughput kit for detecting a variety of target genes, which is characterized in that including following components: institute in claim 1 The fluorescence labeling probe stated, the specific primer of target gene tape label, the specific primer of target gene not tape label, dNTP, DNA Polymerase, MgCl2 With PCR reaction buffer.
CN201811087448.6A 2018-09-18 2018-09-18 A kind of high-throughput method for detecting a variety of target genes Active CN109182481B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201811087448.6A CN109182481B (en) 2018-09-18 2018-09-18 A kind of high-throughput method for detecting a variety of target genes

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811087448.6A CN109182481B (en) 2018-09-18 2018-09-18 A kind of high-throughput method for detecting a variety of target genes

Publications (2)

Publication Number Publication Date
CN109182481A CN109182481A (en) 2019-01-11
CN109182481B true CN109182481B (en) 2019-07-26

Family

ID=64911976

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811087448.6A Active CN109182481B (en) 2018-09-18 2018-09-18 A kind of high-throughput method for detecting a variety of target genes

Country Status (1)

Country Link
CN (1) CN109182481B (en)

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111549063A (en) * 2020-05-07 2020-08-18 西南大学 Method for high-throughput screening of cell response environment extreme temperature target gene
CN111793676A (en) * 2020-07-21 2020-10-20 北京安智因生物技术有限公司 Method and kit for detecting gene polymorphism and application thereof
CN114457196A (en) * 2022-02-28 2022-05-10 上海中医药大学附属龙华医院 Method for detecting multiple high-risk HPV (human papillomavirus) through high-throughput two-dimensional PCR (polymerase chain reaction) single closed tube
CN114675038B (en) * 2022-04-25 2023-02-10 陕西科技大学 Thermal fluorescence analysis and detection method and kit for protein content
CN116386726A (en) * 2023-03-22 2023-07-04 深圳市天大生物医疗器械有限公司 Genotyping on-line detection system fusing PCR melting curve and application method thereof

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103276094B (en) * 2013-06-08 2015-09-09 瀚吉康生物科技（北京）有限公司 Multi-PCR detection method and test kit
CN104328190A (en) * 2014-11-05 2015-02-04 中国海洋大学 PCR (polymerase chain reaction) product melting point analysis method for quantitatively detecting species composition of mixed-type sample

Also Published As

Publication number Publication date
CN109182481A (en) 2019-01-11

Similar Documents

Publication Publication Date Title
CN109182481B (en) A kind of high-throughput method for detecting a variety of target genes
KR101830700B1 (en) Method for the detection of multiple target nucleic acids using clamping probes and detection probes
CN105821138B (en) A kind of method that double loop-stem structure DNA profiling detection nucleic acid are built based on coupled reaction
CN109576352A (en) Single tube detects method, probe and its kit of multiple object to be measured nucleic acid sequences
CN101381766B (en) Quantitative detection method of gene rare mutation
KR102098772B1 (en) Adenovirus screening method associated gastrointestinal Infections and acute respiratory infections by PNA based real-timc PCR
CN105018646B (en) A kind of primer, probe and the kit of detection bovine epizootic fever virus
CN108220480B (en) RPA fluorescent quantitative primer pair, probe and kit for specific detection of HPV18
CN103409552B (en) The primer sets of the various high risk HPV genotypes of synchronous detecting, probe groups, method and test kit
CN104561372A (en) Combined primer for amplification and typing of human papilloma virogenes and application of combined primer
CN104884638A (en) Compositions and methods for detecting human papillomavirus nucleic acid
CN107012237A (en) A kind of fluorescence PCR method and kit of specific detection gondii nucleic acid
CN102459631B (en) A method for detection of human papillomavirus (HPV) type
CN106868140A (en) The method of multiple fluorescence quantitative PCR
CN106916907A (en) The fluorescence PCR method and kit of a kind of specific detection herpes simplex virus I, II type nucleic acid
CN110317861A (en) A kind of kit detecting pathogen
CN106148484B (en) A kind of kit that diagnosis Y chromosome is micro-deleted
WO2019080595A1 (en) Preparation method for in situ hybridisation probe
CN107760763A (en) A kind of application of stem ring primer and stem ring primer rolling circle amplification for the reaction of stem ring primer rolling circle amplification
KR100914911B1 (en) Method and kit for detecting human papillomavirus quantitatively and qualitatively using real-time pcr and hpv dna chip
CN104593524B (en) Nucleic acid detection kit for rapidly detecting respiratory syncytial virus A and B and application thereof
WO2018235109A1 (en) Molecular fingerprinting methods to detect and genotype dna targets through polymerase chain reaction
CN110938708B (en) Kit for detecting H7N9 avian influenza virus based on isothermal amplification technology and application thereof
CN116356079A (en) RPA-CRISPR-Cas12a based visual detection kit for detecting Gaota virus and application
CN113215325B (en) Reaction system, method and kit for detecting multiple HPV subtypes by two-dimensional PCR single tube closed tube

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant