CN104560746A - Candida tropicalis capable of treating high-salinity organic chemical wastewater, and application of candida tropicalis - Google Patents
Candida tropicalis capable of treating high-salinity organic chemical wastewater, and application of candida tropicalis Download PDFInfo
- Publication number
- CN104560746A CN104560746A CN201410829927.6A CN201410829927A CN104560746A CN 104560746 A CN104560746 A CN 104560746A CN 201410829927 A CN201410829927 A CN 201410829927A CN 104560746 A CN104560746 A CN 104560746A
- Authority
- CN
- China
- Prior art keywords
- organic chemical
- waste water
- chemical waste
- candida tropicalis
- nyzj6
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
- C12R2001/72—Candida
- C12R2001/74—Candida tropicalis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/16—Yeasts; Culture media therefor
- C12N1/165—Yeast isolates
-
- C—CHEMISTRY; METALLURGY
- C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
- C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
- C02F3/00—Biological treatment of water, waste water, or sewage
- C02F3/34—Biological treatment of water, waste water, or sewage characterised by the microorganisms used
- C02F3/347—Use of yeasts or fungi
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Environmental & Geological Engineering (AREA)
- Water Supply & Treatment (AREA)
- Hydrology & Water Resources (AREA)
- Botany (AREA)
- Biodiversity & Conservation Biology (AREA)
- Medicinal Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Biomedical Technology (AREA)
- Purification Treatments By Anaerobic Or Anaerobic And Aerobic Bacteria Or Animals (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a facultativeaerobic halophilic fungi, namely candida tropicalis NYZJ6-14 for superiorly treating high-salinity organic chemical wastewater and application of the candida tropicalis. The candida tropicalis NYZJ6-14 is preserved at the China General Microbiological Culture Collection Center, the preserved date is September 19th, 2014, and the preservation number is CGMCC No. 9682. The candida tropicalis provided by the invention can tolerate the changing process from low salinity to high salinity, and can show excellent CODCr (Chemical Oxygen Demand) degradation activities and growth activities, and therefore, the candida tropicalis has good application prospect in the biological purification of high-salinity organic chemical wastewater.
Description
Technical field
The invention belongs to technical field of microbe application, relate to facultative aerobic halophilic fungi and application thereof that a strain can process high salinity organic chemical waste water.
Background technology
Organic high-salinity wastewater refers to that total salinity (with NaCl content meter) is at least the waste water of 10 ‰, and it is not only containing the many kinds of substance such as heavy metal, organism, also containing a large amount of Cl
-, SO
4 2-, Na
+, Ca
2+etc. solvability inorganic ion.Organic high-salinity wastewater intractability is large, and Major Difficulties is not only to contain a large amount of salinities but also containing high concentration organic contaminant, cause high risks to environment in its waste water discharged.Therefore, in today of water resources day by day shortage, exploring effective organic high-salinity wastewater treatment technology has become one of hot fields of wastewater treatment research.
The Processing tecchnics technology of current organic high-salinity wastewater is more, and as Physical, chemical method, biological process etc., but these methods respectively have its weak point.As, conventional physico-chemical process comprises burning method, deep oxidation method, ion exchange method, electrochemical process and membrane separation process etc., the one side that these methods have it feasible, but equal complex operations and costly, may cause secondary pollution, treatment effect is also be not as obvious as biological process.Therefore, biological process is more and more favored.
At present, the study hotspot of biological process mainly concentrates on two aspects, and one, for carry out enrichment and domestication to Facultative Halophiles, utilizes its Degradation; Another is for further investigate different biological treatment.Biological method is widely used in the process of high salinity waste water because operational condition is gentle, economical, efficient.But although traditional biological method successful when processing Low-salinity organic waste water, when salinity is more than 35 ‰, microbial growth can by suppression to a certain extent, even death.Therefore, to further investigate in high salinity environment can the action condition of the effective halophilic microorganism of degradation of contaminant necessary.
Different with production process.In organic high-salinity wastewater, organic moiety is also far different in kind and physico-chemical property, but salt component mostly is inorganic salt.Although these inorganic ions are all the necessary growth conditionss of bacterial classification, play a part enzymatic, regulate osmotic pressure, keep film internal and external equilibrium, but when salt concn is too high, bacterial classification metabolic imbalance can be made again, main manifestations is: when organic high-salinity wastewater salt concn height, the osmotic pressure of solution can be caused to raise, thus microorganism cells generation protoplasma is separated; Because the effect of saltouing makes dehydrogenase activity in microorganism cells reduce, so its growing ability is suppressed; In organic high-salinity wastewater, the chlorion of a large amount is too high to the toxic effect of microorganism cells; Salt concn is high, and the density of waste water increases, and microorganism floats along with the floating loss of growth matrix, thus has a strong impact on the decontamination effect improving of biological treatment system.At present, people have done large quantity research to organic high-salinity wastewater Biochemical method, but, few about biological process degraded high salinity organic research report both at home and abroad, especially furtheing investigate the character of its degradation bacteria and degrading enzyme thereof and be applied in biological reinforced reparation and be also in the starting stage.
The degradation bacteria of research organic high-salinity wastewater and the prerequisite of degraded character thereof obtain pure dominant degradation bacteria strain, and this is that this area has key issue to be solved at present.
Summary of the invention
The object of this invention is to provide fungi and the application thereof of a strain advantage process high salinity organic chemical waste water.
The object of the invention is to be achieved through the following technical solutions.
On the one hand, the invention provides candida tropicalis (Candida tropicalis) NYZJ6-14 that a strain can process high salinity organic chemical waste water, it is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center on September 19th, 2014 and (is called for short CGMCC, address is No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City Institute of Microorganism, Academia Sinica), deposit number is CGMCC No.9682.
Described candida tropicalis NYZJ6-14 obtains by being separated in the active sludge in the backflow pool of sewage waterworks, Yancheng City city east, Jiangsu Province, has following biological property: bacterium colony is for circular, opaque, the smooth of the edge, smooth surface, in substratum front, color is pure white, and reverse side color is pink; Gram-positive, V.P negative, methyl red test is positive, can not hydrolyzed starch.
The ITS region sequence (SEQ ID NO:1) of described candida tropicalis NYZJ6-14 is as follows:
SEQ ID NO:1
CGAAGATTTGGTAGTCTTCCTGATTTGAGGTCAAGTTATGAAATAAATTGTGGTGGCCACTAGCAAAATAAGCGTTTTGGATAAACCTAAGTCGCTTAAAATAAGTTTCCACGTTAAATTCTTTCAAACAAACCTAGCGTATTGCTCAACACCAAACCCGGGGGTTTGAGGGAGAAATGACGCTCAAACAGGCATGCCCTTTGGAATACCAAAGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGAATATCTGCAATTCATATTACGTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTGACTATTGTAATAATAAATCAAGTTTGACTGTAAATAAAAAGTTTGGTTTAGTTATAACCTCTGGCGGTAGGATTGCTCCCGCCACCAAAGAAATTTGTTCAATAAAAAACACATGTGGTGCAATAAGCCAATCAAGAAATCCC
Experiment proves, described candida tropicalis NYZJ6-14 can advantage process high salinity organic chemical waste water.
Therefore, on the other hand, the invention provides the purposes of described candida tropicalis NYZJ6-14 in process organic chemical waste water, particularly high salinity organic chemical waste water.
Wherein, described process organic chemical waste water comprises, and is inoculated in organic chemical waste water by described candida tropicalis NYZJ6-14 and cultivates.
Preferably, the salinity of described organic chemical waste water is 0 ~ 68 ‰, is preferably 0 ~ 34 ‰, is more preferably 3 ~ 34 ‰, further preferably 14 ~ 34 ‰.In the present invention, the salinity of organic chemical waste water represents with ‰, records with hand-held salometer.
Preferably, the COD of described organic chemical waste water
crbe 1.0 × 10
3~ 2.5 × 10
4mg/L, is preferably 1.5 × 10
3~ 1.3 × 10
4mg/L, is more preferably 2.5 × 10
3~ 1.3 × 10
4mg/L, further preferably 5 × 10
3~ 1.3 × 10
4mg/L.
The pH of described organic chemical waste water is 2.0 ~ 7.6, is preferably 2.0 ~ 7.0, further preferably 2.7 ~ 4.0.
Preferably, the inoculum size of described candida tropicalis NYZJ6-14 is 1.0 × 10
7~ 6.0 × 10
7organic chemical waste water described in individual bacterial strain/ml, is preferably 2.0 × 10
7~ 5.0 × 10
7organic chemical waste water described in individual bacterial strain/ml, is more preferably 3.0 × 10
7~ 4.0 × 10
7organic chemical waste water described in individual bacterial strain/ml.
In waste water, cultivate bacterial strain when making it play a role, the culture condition of bacterial strain of the present invention is 25 ~ 30 DEG C, 140 ~ 160r/min, and the bottled amount as the organic chemical waste water of nutrient solution is 30 ~ 40% (V/V).
According to the specific embodiment of the present invention, by candida tropicalis NYZJ6-14 with 3.48 × 10
7the inoculum size of bacterial strain/ml is inoculated in organic chemical waste water, shaking culture in 28 DEG C, and the salinity of described organic chemical waste water reaches 14 ~ 34 ‰, COD
crbe 5 × 10
3~ 1.3 × 10
4mg/L, pH are 2.7 ~ 4.0.Cultivate after 4 days, record the COD achieving 42 ~ 56%
crdegradation rate.
Therefore another aspect, the invention provides a kind of method processing organic chemical waste water, described method comprises, and is inoculated in organic chemical waste water by described candida tropicalis NYZJ6-14 and cultivates.
Preferably, the salinity of described organic chemical waste water is 0 ~ 68 ‰, is preferably 0 ~ 34 ‰, is more preferably 3 ~ 34 ‰, further preferably 14 ~ 34 ‰.
Preferably, the COD of described organic chemical waste water
crbe 1.0 × 10
3~ 2.5 × 10
4mg/L, is preferably 1.5 × 10
3~ 1.3 × 10
4mg/L, is more preferably 2.5 × 10
3~ 1.3 × 10
4mg/L, further preferably 5 × 10
3~ 1.3 × 10
4mg/L.
Preferably, the pH of described organic chemical waste water is 2.0 ~ 7.6, is preferably 2.0 ~ 7.0, further preferably 2.7 ~ 4.0.
Preferably, the inoculum size of described candida tropicalis NYZJ6-14 is 1.0 × 10
7~ 6.0 × 10
7organic chemical waste water described in individual bacterial strain/ml, is preferably 2.0 × 10
7~ 5.0 × 10
7organic chemical waste water described in individual bacterial strain/ml, is more preferably 3.0 × 10
7~ 4.0 × 10
7organic chemical waste water described in individual bacterial strain/ml; Culture condition is 25 ~ 30 DEG C, 140 ~ 160r/min, and the bottled amount as the machine wastewater from chemical industry of nutrient solution is 30 ~ 40% (V/V).
Again on the one hand, the invention provides the purposes of described candida tropicalis NYZJ6-14 in the biodegradation agent for the preparation of process organic chemical waste water.
Also on the one hand, the invention provides the purposes of described candida tropicalis NYZJ6-14 in the engineering bacteria building process organic chemical waste water.
Present invention obtains a strain can survive in high salinity organic chemical waste water and have good COD
crthe fungi of degradation capability.For the former water of high salinity organic chemical waste water, (salinity is 68 ‰, COD
crbe 2.5 × 10
4mg/L, pH are 2.4), experiment proves, candida tropicalis NYZJ6-14 provided by the invention can grow in not diluted and dilution 1 times, 4 times, 9 times and this waste water of 14 times, and significantly can reduce COD
cr, show that the Low-salinity that this bacterial strain can tolerate from 2 ~ 68 ‰ changes to high salinity thus, and excellent COD can be shown under this salinity
crdegrading activity and growth activity.
Further, for this high salinity organic chemical waste water of dilution 4 times, the COD of candida tropicalis NYZJ6-14 under aerobic condition
crdegradation rate and bacteria containing amount are the highest, are respectively 55.9% and 5.4 × 10
8individual bacterial strain/ml; Under anaerobic, COD
crdegradation rate and bacteria containing amount are respectively 49.3% and 4.7 × 10
8individual bacterial strain/ml.This illustrates, under high salinity condition and anaerobism or aerobic arbitrary condition, candida tropicalis NYZJ6-14 all shows excellent COD
crdegrading activity.
Therefore, as the facultative aerobic halophilic fungi of advantage process high salinity organic chemical waste water, candida tropicalis NYZJ6-14 can tolerate large-scale salinity, all can realize significant COD under anaerobic and aerobic condition simultaneously
crdegradation, has a good application prospect in the biopurification of wastewater from chemical industry.
Accompanying drawing explanation
Below, describe embodiment of the present invention in detail by reference to the accompanying drawings, wherein:
Fig. 1 is candida tropicalis NYZJ6-14 colonial morphology.
Fig. 2 is the phylogenetic tree of candida tropicalis NYZJ6-14.
Embodiment
Referring to specific embodiment, the present invention is described.It will be appreciated by those skilled in the art that these embodiments are only for illustration of the present invention, its scope do not limited the present invention in any way.
Experimental technique in following embodiment, if no special instructions, is ordinary method.Medicinal raw material used in following embodiment, reagent material etc., if no special instructions, be commercially available purchase product.Wherein, the organic chemical waste water used in embodiment picks up from Yancheng chemical industrial park, Jiangsu Province, and salinity is 68 ‰, COD
crbe 2.5 × 10
4mg/L, ammonia-nitrogen content is 1.42mg/L, and nitrite nitrogen content is 0.190mg/L, and nitrate nitrogen content is 6.72mg/L, and solid suspension content is 8.6mg/L, pH is 2.4.
embodiment 1the separation of candida tropicalis NYZJ6-14, Isolation and characterization
1. be separated and purifying
Enrichment culture: get not by organic high-salinity wastewater pollute sewage waterworks, Yancheng City city east, Jiangsu Province backflow pool in active sludge (water content is 16.94%, pH is 5.09, and the soil organism is 304.85gkg
-1, full nitrogen is 41.90g kg
-1, full phosphorus is 24.95g kg
-1), be packaged in sterile bag and be placed in 4 DEG C of Refrigerator stores.Measure active sludge to be about 10L and to be inoculated in the enrichment medium (i.e. not diluted, dilution 1 times, 4 times, 9 times, 14 times and the high salinity organic chemical waste water of 19 times) of 100mL, at 28 DEG C, carry out aerobic cultivation and whiteruss fluid-tight Anaerobic culturel (cultivating 7 days in the constant-temperature table of 150r/min) respectively, obtain enrichment culture liquid.
Primary dcreening operation: get 1ml enrichment culture liquid and coat on rose-bengal nutrient agar, cultivates 2 days, is chosen one by one by the bacterium colony grown in the biochemical cultivation case of 28 DEG C, and according to the ordinary method of strains separation purifying, obtains the pure bacterial strain of many strains.These pure bacterial strains are chosen one by one on the 96 hole flat boards that about 130 μ L selective mediums (the high salinity organic chemical waste water of not diluted) is housed in advance, cultivate after 1 day, be affixed on rose-bengal nutrient agar after absorbing nutrient solution with 6mm aseptic filter paper sheet, every ware pastes 6 equably, 1-2 days is cultivated respectively in the biochemical cultivation cases of 28 ~ 30 DEG C, according to filter paper surrounding growth circle size, judge the degradation capability of bacterial strain, picking goes out the larger multiple dominant strains of growth circle.
Multiple sieve: (bacteria containing amount is 3.21 × 10 to be diluted to the bacteria suspension of proper concn with sterilized water after the bacterial strain activation obtained by primary dcreening operation
8individual/ml), with in 10% (V/V) inoculum size access 100mL nutrient solution (the high salinity organic chemical waste water of not diluted), cultivate 4 days respectively at 28 ~ 30 DEG C of water-bath constant temperature oscillators, measure COD in nutrient solution
crcontent and microbe population, select organic high-salinity wastewater unit cell COD
crthe higher bacterial strain of degradation rate to be degraded salt-enduring strain as advantage, called after " NYZJ6-14 ".
2. identify
Addicted to salt fungi, morphological observation (colonial morphology and hypha form) is carried out to the advantage degraded filtered out, student on commission's work biotechnology (Shanghai) limited-liability company carries out the analysis of ITS region sequence simultaneously, and sequencing result is shown in the SEQ ID NO:1 in sequence table.
Morphological observation finds, the bacterium colony of bacterial strain is circular, and opaque, the smooth of the edge, smooth surface, in substratum front, color is pure white, and reverse side color is pink.Further qualification test and result comprise, the Gram-positive of bacterial strain, V.P negative, and methyl red test is positive, can not hydrolyzed starch.Colonial morphology is shown in Fig. 1.
Obtain the ITS region sequence of NYZJ6-14, gene order in itself and Genbank is carried out tetraploid rice, find that it belongs to candiyeast (Candida) and belongs to, then by the foundation (Fig. 2) of phylogenetic tree, judge that NYZJ6-14 may as candida tropicalis (Candida tropicalis).Combining form observations (Fig. 1), finally determines that NYZJ6-14 is candida tropicalis (Candidatropicalis).
3. double oxygen
Candida tropicalis NYZJ6-14 is coated on rose-bengal nutrient agar, cultivate 2 ~ 7 days respectively in the aerobic incubator of the biochemistry of 28 ~ 30 DEG C and in anaerobic culture box, observe lawn growing state every day.Result shows, candida tropicalis NYZJ6-14 is equal energy normal growth under aerobic and anaerobic conditions, therefore, determines that candida tropicalis NYZJ6-14 is for oxygen bacterium of holding concurrently.
embodiment 2the salt tolerance of candida tropicalis NYZJ6-14 under aerobic and oxygen free condition and organic chemical waste water process effect
Get high salinity organic chemical waste water, by this wastewater dilution 1 times, 4 times, 9 times, 14 times and 19 times, obtain 1/2 times of former water, 1/5 times of former water, 1/10 times of former water, 1/15 times of former water and 1/20 times of former water, with the waste water (1 times of former water) of not diluted as nutrient solution.
Candida tropicalis NYZJ6-14 sterilized water embodiment 1 obtained is diluted to the bacteria suspension of proper concn, is inoculated in respectively in the waste water of different diluent that 100mL obtains and not diluted, makes the inoculum size of NYZJ6-14 be 3.48 × 10
7individual bacterial strain/ml nutrient solution, then cultivates 4 days respectively at 28 DEG C of water-bath constant temperature oscillators.Cultivation of doing is divided into aerobic group and anaerobic group, and wherein aerobic group is 150r/min shaking culture, and the bottled amount of nutrient solution is 35% (V/V), and anaerobic group is the whiteruss adding about 1cm on nutrient solution surface, and other condition is identical with aerobic group.
Above-mentioned experiment is parallel carries out 2 groups, is respectively examination 1 and examination 2, will inoculate the nutrient solution of candida tropicalis NYZJ6-14 as blank simultaneously, cultivates and measures COD in nutrient solution afterwards in 4 days
cr, pH, salinity, bacteria containing amount, COD
crdegradation rate (%), result is as shown in table 1.
Table 1 Candida Tropicalis NYZJ6-14 cultivates the test-results of 4 days
Result shows, candida tropicalis NYZJ6-14 all can normal growth in not diluted with dilution 1 times, 4 times, 9 times and the high salinity organic chemical waste water of 14 times, and keeps higher COD
crdegradation rate and bacteria containing amount.Wherein, in this high salinity organic chemical waste water nutrient solution through 4 times of dilutions, COD
crdegradation rate and bacteria containing amount all the highest, the COD under aerobic condition
crdegradation rate reaches 55.9%, and bacteria containing amount reaches 5.4 × 10
8individual bacterial strain/ml; COD under anaerobic
crdegradation rate reaches 49.3%, and bacteria containing amount reaches 4.7 × 10
8individual bacterial strain/ml.And in the high salinity organic chemical waste water of dilution 19 times, the COD of nutrient solution
crcompared with blank solution change very micro-, and bacteria containing amount comparatively inoculum size obviously reduce, show that bacterial strain is sharply dead, can not grow.Result proves, candida tropicalis NYZJ6-14 can tolerate large-scale salinity, all can realize significant COD under anaerobic and aerobic condition simultaneously
crdegradation, therefore has a good application prospect in the biopurification of wastewater from chemical industry.
Specific description of embodiments of the present invention does not above limit the present invention, and those skilled in the art can make various change or distortion according to the present invention, only otherwise depart from spirit of the present invention, all should belong to the scope of claims of the present invention.
Claims (10)
1. a strain can process candida tropicalis (Candidatropicalis) NYZJ6-14 of high salinity organic chemical waste water, and its deposit number is CGMCC No.9682.
2. the purposes of candida tropicalis NYZJ6-14 according to claim 1 in process organic chemical waste water.
3. purposes according to claim 2, is characterized in that, described process organic chemical waste water comprises, and is inoculated in organic chemical waste water by described candida tropicalis NYZJ6-14 and cultivates.
4. the purposes according to Claims 2 or 3, is characterized in that, the salinity of described organic chemical waste water is 0 ~ 68 ‰, is preferably 0 ~ 34 ‰, is more preferably 3 ~ 34 ‰, further preferably 14 ~ 34 ‰;
Preferably, the COD of described organic chemical waste water
crbe 1.0 × 10
3~ 2.5 × 10
4mg/L, is preferably 1.5 × 10
3~ 1.3 × 10
4mg/L, is more preferably 2.5 × 10
3~ 1.3 × 10
4mg/L, further preferably 5 × 10
3~ 1.3 × 10
4mg/L;
Preferably, the pH of described organic chemical waste water is 2.0 ~ 7.6, is preferably 2.0 ~ 7.0, further preferably 2.7 ~ 4.0.
5. the purposes according to any one of claim 2 to 4, is characterized in that, the inoculum size of described candida tropicalis NYZJ6-14 is 1.0 × 10
7~ 6.0 × 10
7organic chemical waste water described in individual bacterial strain/ml, is preferably 2.0 × 10
7~ 5.0 × 10
7organic chemical waste water described in individual bacterial strain/ml, is more preferably 3.0 × 10
7~ 4.0 × 10
7organic chemical waste water described in individual bacterial strain/ml;
Preferably, culture condition is 25 ~ 30 DEG C, 40 ~ 160r/min; Bottled amount as the organic chemical waste water of nutrient solution is 30 ~ 40% (V/V).
6. process a method for organic chemical waste water, it is characterized in that, described method comprises, and is inoculated in organic chemical waste water by candida tropicalis NYZJ6-14 according to claim 1 and cultivates.
7. method according to claim 6, is characterized in that, the salinity of described organic chemical waste water is 0 ~ 68 ‰, is preferably 0 ~ 34 ‰, is more preferably 3 ~ 34 ‰, further preferably 14 ~ 34 ‰;
Preferably, the COD of described organic chemical waste water
crbe 1.0 × 10
3~ 2.5 × 10
4mg/L, is preferably 1.5 × 10
3~ 1.3 × 10
4mg/L, is more preferably 2.5 × 10
3~ 1.3 × 10
4mg/L, further preferably 5 × 10
3~ 1.3 × 10
4mg/L;
Preferably, the pH of described organic chemical waste water is 2.0 ~ 7.6, is preferably 2.0 ~ 7.0, further preferably 2.7 ~ 4.0.
8. the method according to claim 6 or 7, is characterized in that, the inoculum size of described candida tropicalis NYZJ6-14 is 1.0 × 10
7~ 6.0 × 10
7organic chemical waste water described in individual bacterial strain/ml, is preferably 2.0 × 10
7~ 5.0 × 10
7organic chemical waste water described in individual bacterial strain/ml, is more preferably 3.0 × 10
7~ 4.0 × 10
7organic chemical waste water described in individual bacterial strain/ml;
Preferably, culture condition is 25 ~ 30 DEG C, 40 ~ 160r/min; Bottled amount as the organic chemical waste water of nutrient solution is 30 ~ 40% (V/V).
9. the purposes of candida tropicalis NYZJ6-14 according to claim 1 in the biodegradation agent for the preparation of process organic chemical waste water.
10. the purposes of candida tropicalis NYZJ6-14 according to claim 1 in the engineering bacteria building process organic chemical waste water.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410829927.6A CN104560746B (en) | 2014-12-26 | 2014-12-26 | One plant can handle high salinity organic chemical waste water candida tropicalis and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410829927.6A CN104560746B (en) | 2014-12-26 | 2014-12-26 | One plant can handle high salinity organic chemical waste water candida tropicalis and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104560746A true CN104560746A (en) | 2015-04-29 |
| CN104560746B CN104560746B (en) | 2017-07-28 |
Family
ID=53077828
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410829927.6A Active CN104560746B (en) | 2014-12-26 | 2014-12-26 | One plant can handle high salinity organic chemical waste water candida tropicalis and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104560746B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105154344A (en) * | 2015-09-10 | 2015-12-16 | 中蓝连海设计研究院 | Method for preparing halophilic yeast agent and halophilic yeast agent |
| TWI757003B (en) * | 2020-12-21 | 2022-03-01 | 國立屏東科技大學 | Candida palmioleophila sw4’-w6 and method for treating water in culture pond using the same |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101906388A (en) * | 2010-01-29 | 2010-12-08 | 清华大学 | Yeast and application thereof in decolorization |
| CN101955889A (en) * | 2010-10-12 | 2011-01-26 | 天津科技大学 | Cadmium salt resistant Candida tropicalis and application thereof |
| CN101955925A (en) * | 2009-07-14 | 2011-01-26 | 南开大学 | Method for improving cadmium tolerance of bacillus through mutagenesis |
| CN103642707A (en) * | 2013-12-03 | 2014-03-19 | 湖北工业大学 | Method for producing candida for feeds by fermenting high-salt-content amino acid wastewater |
| CN104212728A (en) * | 2014-05-13 | 2014-12-17 | 范明星 | High temperature-resistant Candidasp. FD-1 for phenolated water degradation |
-
2014
- 2014-12-26 CN CN201410829927.6A patent/CN104560746B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101955925A (en) * | 2009-07-14 | 2011-01-26 | 南开大学 | Method for improving cadmium tolerance of bacillus through mutagenesis |
| CN101906388A (en) * | 2010-01-29 | 2010-12-08 | 清华大学 | Yeast and application thereof in decolorization |
| CN101955889A (en) * | 2010-10-12 | 2011-01-26 | 天津科技大学 | Cadmium salt resistant Candida tropicalis and application thereof |
| CN103642707A (en) * | 2013-12-03 | 2014-03-19 | 湖北工业大学 | Method for producing candida for feeds by fermenting high-salt-content amino acid wastewater |
| CN104212728A (en) * | 2014-05-13 | 2014-12-17 | 范明星 | High temperature-resistant Candidasp. FD-1 for phenolated water degradation |
Non-Patent Citations (1)
| Title |
|---|
| 韩云 等: "五株分离酵母菌的甘油酯和脂肪酸降解活性比较", 《中国环境科学》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105154344A (en) * | 2015-09-10 | 2015-12-16 | 中蓝连海设计研究院 | Method for preparing halophilic yeast agent and halophilic yeast agent |
| TWI757003B (en) * | 2020-12-21 | 2022-03-01 | 國立屏東科技大學 | Candida palmioleophila sw4’-w6 and method for treating water in culture pond using the same |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104560746B (en) | 2017-07-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103756947B (en) | The preparation method of a kind of acinetobacter calcoaceticus and microbial inoculum thereof | |
| CN106635861B (en) | A kind of de- COD denitrification microorganism microbial inoculum of salt tolerant and preparation method thereof | |
| CN102443542B (en) | High-density culture process of autotrophic oil-producing microalgae | |
| EP3800243B1 (en) | Bacterium degrading las and n and use thereof | |
| CN105985917B (en) | Method for increasing biomass of chlorella in pig-raising wastewater | |
| CN110217895A (en) | A kind of complex micro organism fungicide and its application for water environment treatment | |
| CN104560777B (en) | One plant height is resistant to microphenomenon of degradation of aniline and its application | |
| CN102220240A (en) | PM-I sludge reduction microbial agent | |
| CN105296398A (en) | Low-temperature-resistant composite microbial agent used for treating contaminated water, and preparation method and application thereof | |
| CN101429486B (en) | Brood cell bacillus MK3-1 for purification of heavy metal pollution and uses thereof | |
| CN103305443B (en) | Preparation and method for restoring ammonia nitrogen-containing industrial sewage | |
| CN113234636B (en) | Denitrifying bacterium pseudomonas strain F1 and application thereof | |
| CN102250776A (en) | Acid-resistance heterotrophic bacterium strain Z3 used for bioleaching treatment of sludge and livestock and poultry manure | |
| CN104630112A (en) | Acinetobacter as well as preparation method and application of acinetobacter | |
| CN106635855B (en) | Microbacterium and its culture application are seen in a kind of north | |
| CN104694435B (en) | One plant of Shinella sp. with triazole degradation function and its application | |
| CN104560746A (en) | Candida tropicalis capable of treating high-salinity organic chemical wastewater, and application of candida tropicalis | |
| CN104263686B (en) | One plant of low-temperature denitrification acinetobacter calcoaceticus and its application | |
| CN102994393B (en) | Fungal strain LP-19-3 and application of fungal strain LP-19-3 in copper-containing wastewater treatment | |
| CN104745515A (en) | Acinetobacter sp. for degrading polycyclic aromatic hydrocarbon and application of acinetobacter sp. | |
| CN104862256B (en) | A kind of bacillus cereus FNXJ1 23 of resistance to aluminium section bar electronickelling tank liquor and its application | |
| CN102108334B (en) | Chromium-removing rhodobacterium and application thereof | |
| CN106635860A (en) | Salt-tolerant microbial agent as well as preparation method and application thereof | |
| CN102250779A (en) | Acid resistant heterotrophic bacterium D13 applied in bioleaching of municipal sludge | |
| CN114836355B (en) | Pseudomonas DT04 and application thereof in sewage denitrification |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |