CN104560746B - One plant can handle high salinity organic chemical waste water candida tropicalis and application thereof - Google Patents
One plant can handle high salinity organic chemical waste water candida tropicalis and application thereof Download PDFInfo
- Publication number
- CN104560746B CN104560746B CN201410829927.6A CN201410829927A CN104560746B CN 104560746 B CN104560746 B CN 104560746B CN 201410829927 A CN201410829927 A CN 201410829927A CN 104560746 B CN104560746 B CN 104560746B
- Authority
- CN
- China
- Prior art keywords
- waste water
- organic chemical
- chemical waste
- nyzj6
- candida tropicalis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/16—Yeasts; Culture media therefor
- C12N1/165—Yeast isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
- C12R2001/72—Candida
- C12R2001/74—Candida tropicalis
-
- C—CHEMISTRY; METALLURGY
- C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
- C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
- C02F3/00—Biological treatment of water, waste water, or sewage
- C02F3/34—Biological treatment of water, waste water, or sewage characterised by the microorganisms used
- C02F3/347—Use of yeasts or fungi
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Environmental & Geological Engineering (AREA)
- Water Supply & Treatment (AREA)
- Hydrology & Water Resources (AREA)
- Botany (AREA)
- Biodiversity & Conservation Biology (AREA)
- Medicinal Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Biomedical Technology (AREA)
- Purification Treatments By Anaerobic Or Anaerobic And Aerobic Bacteria Or Animals (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides the thermophilic salt fungi of simultaneous oxygen that one plant of advantage handles high salinity organic chemical waste water --- candida tropicalis NYZJ6 14 and its application.The candida tropicalis (Candida Tropicalis NYZJ6 14) is preserved in China General Microbiological culture presevation administrative center, preservation date September in 2014 19 days, and deposit number is CGMCC No.9682.The bacterial strain that the present invention is provided is resistant to the change procedure from Low-salinity to high salinity, and can show excellent CODCrDegrading activity and growth activity, have a good application prospect in the biological cleaning of high salinity organic chemical waste water.
Description
Technical field
The invention belongs to technical field of microbe application, the facultative of high salinity organic chemical waste water can be handled by being related to one plant
Aerobic halophilic fungi and its application.
Background technology
Organic high-salinity wastewater refers to that total salinity (with NaCl content meters) is at least 10 ‰ waste water, and it is not only containing a huge sum of money
The many kinds of substance such as category, organic matter, also containing a large amount of Cl-、SO4 2-、Na+、Ca2+Etc. dissolubility inorganic ion.High salinity organic waste
Water process difficulty is big, and Major Difficulties are not only containing substantial amounts of salinity but also containing high concentration organic contaminant in the waste water of its discharge, right
Environment causes high risks.Therefore, in water resource increasingly short today, effective organic high-salinity wastewater processing is explored
Technology has become one of hot fields of wastewater treatment research.
The Processing tecchnics technology of current organic high-salinity wastewater is more, such as Physical, chemical method, bioanalysis, but these
Method respectively has its weak point.Such as, conventional physico-chemical process includes burning method, deep oxidation method, ion-exchange, electrification
Method and membrane separation process etc., these methods have its feasible one side, but cumbersome and costly, may cause secondary dirt
Dye, treatment effect is also be not as obvious as bioanalysis.Therefore, bioanalysis is increasingly favored.
At present, the study hotspot of bioanalysis focuses primarily upon two aspects, and one is that Facultative Halophiles are enriched with and tamed,
Utilize its degradation；Another is that different biological treatments are furtherd investigate.Biological method is because operating condition is gentle, warp
Ji, processing that is efficient and being widely used in high salinity waste water.But, although traditional biological method is when handling Low-salinity organic wastewater
Substantially, but when salinity is more than 35 ‰, the growth of microorganism can be suppressed effect by a certain degree of, or even dead.Therefore, it is deep
Enter research in high salinity environment can the effectively halophilic microorganism of degradation of contaminant action condition it is necessary.
It is different with production process.The constituent of organic matter is in terms of species and physicochemical property in organic high-salinity wastewater
It is far different, but salt component is generally inorganic salts.Although these inorganic ions are all the necessary growth conditions of strain, enzyme is played
Promote, adjust osmotic pressure, keep the effect of film internal and external equilibrium, but when salinity is too high, strain metabolic imbalance, main table can be made again
It is now：When organic high-salinity wastewater salinity is high, the osmotic pressure of solution can be caused to raise, so that microbial cell occurs
Plasm is separated；Because the effect saltoutd reduces dehydrogenase activity in microbial cell, so its growing power is suppressed；It is high
The chlorion of a large amount is too high to the toxic effect of microbial cell in salinity organic wastewater；Salinity is high, the density increase of waste water,
Microorganism is as the floating of growth substrate is lost in and floats, so as to have a strong impact on the clean-up effect of biological treatment system.At present, people
Numerous studies have been done to organic high-salinity wastewater Biochemical method, however, organic on degrade high salinity of bioanalysis both at home and abroad
The research report of thing is few, is especially furtheing investigate the property of its degradation bacteria and its digestive enzyme and its applied to biological reinforced
Also in the starting stage in terms of reparation.
The premise for studying the degradation bacteria of organic high-salinity wastewater and its property of degrading is to obtain pure dominant degradation bacteria strain, this
It is that this area has key issue to be solved at present.
The content of the invention
It is an object of the invention to provide fungi and its application that one plant of advantage handles high salinity organic chemical waste water.
The purpose of the present invention is achieved through the following technical solutions.
On the one hand, the present invention, which provides one plant, can handle the candida tropicalis (Candida of high salinity organic chemical waste water
Tropicalis) NYZJ6-14, it is common that it has been preserved in China Committee for Culture Collection of Microorganisms on 19th in September in 2014
(abbreviation CGMCC, address is Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3 Chinese Academy of Sciences microbe research at microorganism center
Institute), deposit number is CGMCC No.9682.
The candida tropicalis NYZJ6-14 is by the activity in the backflow pool of Yancheng City city east, Jiangsu Province sewage waterworks
It is isolated in sludge, with following biological property：Bacterium colony is circle, and opaque, the smooth of the edge, surface is smooth, in culture
The positive face color of base is pure white, and reverse side color is pink；Gram-positive, V.P negatives, methyl red test is positive, it is impossible to which hydrolysis is formed sediment
Powder.
ITS region sequences (the SEQ ID NO of the candida tropicalis NYZJ6-14:1) it is as follows：
SEQ ID NO:1
CGAAGATTTGGTAGTCTTCCTGATTTGAGGTCAAGTTATGAAATAAATTGTGGTGGCCACTAGCAAAAT
AAGCGTTTTGGATAAACCTAAGTCGCTTAAAATAAGTTTCCACGTTAAATTCTTTCAAACAAACCTAGCGTATTGCT
CAACACCAAACCCGGGGGTTTGAGGGAGAAATGACGCTCAAACAGGCATGCCCTTTGGAATACCAAAGGGCGCAATG
TGCGTTCAAAGATTCGATGATTCACGAATATCTGCAATTCATATTACGTATCGCATTTCGCTGCGTTCTTCATCGAT
GCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTGACTATTGTAATAATAAATCAAGTTTGACTGTAAATAAAAAGTT
TGGTTTAGTTATAACCTCTGGCGGTAGGATTGCTCCCGCCACCAAAGAAATTTGTTCAATAAAAAACACATGTGGTG
CAATAAGCCAATCAAGAAATCCC
It is demonstrated experimentally that the candida tropicalis NYZJ6-14 can the high salinity organic chemical waste water of advantage processing.
Therefore, on the other hand, the present invention provides the candida tropicalis NYZJ6-14 in processing organic chemical waste water, spy
It is not the purposes in high salinity organic chemical waste water.
Wherein, the processing organic chemical waste water includes, and the candida tropicalis NYZJ6-14 is inoculated in and organised
Cultivated in work waste water.
Preferably, the salinity of the organic chemical waste water is 0~68 ‰, preferably 0~34 ‰, more preferably 3~34 ‰,
Further preferred 14~34 ‰.The salinity of organic chemical waste water is represented with ‰ in the present invention, is measured with hand-held salinometer.
Preferably, the COD of the organic chemical waste waterCrFor 1.0 × 103~2.5 × 104Mg/L, preferably 1.5 × 103~
1.3×104Mg/L, more preferably 2.5 × 103~1.3 × 104Mg/L, further preferred 5 × 103~1.3 × 104mg/L。
The pH of the organic chemical waste water is 2.0~7.6, preferably 2.0~7.0, further preferred 2.7~4.0.
Preferably, the inoculum concentration of the candida tropicalis NYZJ6-14 is 1.0 × 107~6.0 × 107Individual bacterial strain/ml institutes
State organic chemical waste water, preferably 2.0 × 107~5.0 × 107Organic chemical waste water described in individual bacterial strain/ml, more preferably 3.0 ×
107~4.0 × 107Organic chemical waste water described in individual bacterial strain/ml.
When cultivating bacterial strain in waste water and it is played a role, the condition of culture of bacterial strain of the present invention is 25~30 DEG C, 140~
160r/min, is 30~40% (V/V) as the bottled amount of the organic chemical waste water of nutrient solution.
According to the embodiment of the present invention, by candida tropicalis NYZJ6-14 with 3.48 × 107Bacterial strain/ml's connects
Kind of amount is inoculated in organic chemical waste water, the shaken cultivation in 28 DEG C, the salinity of the organic chemical waste water up to 14~34 ‰,
CODCrFor 5 × 103~1.3 × 104Mg/L, pH are 2.7~4.0.After culture 4 days, measuring realizes 42~56% CODCrDrop
Solution rate.
Therefore another aspect, of the invention to provide a kind of method for handling organic chemical waste water, and methods described includes, will be described
Candida tropicalis NYZJ6-14, which is inoculated in organic chemical waste water, to be cultivated.
Preferably, the salinity of the organic chemical waste water is 0~68 ‰, preferably 0~34 ‰, more preferably 3~34 ‰,
Further preferred 14~34 ‰.
Preferably, the COD of the organic chemical waste waterCrFor 1.0 × 103~2.5 × 104Mg/L, preferably 1.5 × 103~
1.3×104Mg/L, more preferably 2.5 × 103~1.3 × 104Mg/L, further preferred 5 × 103~1.3 × 104mg/L。
Preferably, the pH of the organic chemical waste water be 2.0~7.6, preferably 2.0~7.0, further preferred 2.7~
4.0。
Preferably, the inoculum concentration of the candida tropicalis NYZJ6-14 is 1.0 × 107~6.0 × 107Individual bacterial strain/ml institutes
State organic chemical waste water, preferably 2.0 × 107~5.0 × 107Organic chemical waste water described in individual bacterial strain/ml, more preferably 3.0 ×
107~4.0 × 107Organic chemical waste water described in individual bacterial strain/ml；Condition of culture is 25~30 DEG C, and 140~160r/min is used as training
The bottled amount of the machine wastewater from chemical industry of nutrient solution is 30~40% (V/V).
Another further aspect, the present invention provides the candida tropicalis NYZJ6-14 and prepared for handling organic chemical waste water
Biodegradation agent in purposes.
Further aspect, the present invention provides the candida tropicalis NYZJ6-14 and is building the work of processing organic chemical waste water
Purposes in journey bacterium.
It can be survived present invention obtains one plant in high salinity organic chemical waste water and have a good CODCrDegradation capability it is true
Bacterium.For high salinity organic chemical waste water raw water, (salinity is 68 ‰, CODCrFor 2.5 × 104Mg/L, pH are 2.4) experiment card
Bright, the candida tropicalis NYZJ6-14 that the present invention is provided can be somebody's turn to do not diluted and 1 times, 4 times, 9 times and 14 times of dilution
Grown in waste water, and COD can be significantly reducedCr, it is indicated above the bacterial strain and can be resistant to from 2~68 ‰ Low-salinity to become to high salinity
Change, and excellent COD can be shown under this salinityCrDegrading activity and growth activity.
Also, for 4 times high salinity organic chemical waste water of dilution, candida tropicalis NYZJ6-14 is in aerobic condition
Under CODCrDegradation rate and bacteria containing amount are highest, respectively 55.9% and 5.4 × 108Individual bacterial strain/ml；Under anaerobic,
CODCrDegradation rate and bacteria containing amount are respectively 49.3% and 4.7 × 108Individual bacterial strain/ml.This explanation, in high Variation of Salinity Condition and anaerobism
Or under aerobic either condition, candida tropicalis NYZJ6-14 shows excellent CODCrDegrading activity.
Therefore, the facultative aerobic halophilic fungi of high salinity organic chemical waste water, candida tropicalis are handled as advantage
NYZJ6-14 can be resistant to large-scale salinity, while can realize significant COD under the conditions of anaerobic and aerobicCrDegraded is made
With being had a good application prospect in the biological cleaning of wastewater from chemical industry.
Brief description of the drawings
Hereinafter, embodiment of the present invention is described in detail with reference to accompanying drawing, wherein：
Fig. 1 is candida tropicalis NYZJ6-14 colonial morphologies.
Fig. 2 is candida tropicalis NYZJ6-14 phylogenetic tree.
Embodiment
Illustrate the present invention referring to specific embodiment.It will be appreciated by those skilled in the art that these embodiments are only
For illustrating the present invention, it does not limit the scope of the present invention in any way.
Experimental method in following embodiments, is conventional method unless otherwise specified.Medicine used in following embodiments
Material raw material, reagent material etc., unless otherwise specified, are commercially available products.Wherein, the organic chemical industry used in embodiment gives up
Hydromining is from Jiangsu Province Yancheng chemical industrial park, and salinity is 68 ‰, CODCrFor 2.5 × 104Mg/L, ammonia-nitrogen content is 1.42mg/
L, nitrite nitrogen content is 0.190mg/L, and nitrate nitrogen content is 6.72mg/L, and solid suspension content is 8.6mg/L, pH
For 2.4.
Embodiment 1Candida tropicalis NYZJ6-14 separation, purifying and identification
1. separation and purifying
Enrichment culture：Take Yancheng City city east, the Jiangsu Province sewage waterworks backflow pool not polluted by organic high-salinity wastewater
In activated sludge (water content is that 16.94%, pH is 5.09, and the soil organism is 304.85gkg-1, full nitrogen is 41.90g kg-1, full phosphorus is 24.95g kg-1), it is packaged in sterile bag and is placed in 4 DEG C of refrigerator preservations.Activated sludge about 10L is measured to be inoculated in
100mL enriched medium (i.e. not diluted, 1 times, 4 times, 9 times, 14 times and 19 times of dilution high salinity organic chemical waste water)
In, (cultivate 7 in 150r/min constant-temperature table with atoleine fluid-tight Anaerobic culturel in carrying out aerobic cultivate at 28 DEG C respectively
My god), obtain enrichment culture liquid.
Primary dcreening operation：Take 1ml enrichment culture liquid to be coated on rose-bengal agar medium, trained in 28 DEG C of biochemical cultivation case
Support 2 days, the bacterium colony grown is chosen one by one, and the conventional method purified according to strain isolation, obtain many plants of pure bacterial strains.By these
Pure bacterial strain is chosen into 96 holes that about 130 μ L selective mediums (not diluted high salinity organic chemical waste water) are housed in advance one by one
On flat board, after cultivating 1 day, it is affixed on after absorbing nutrient solution with 6mm aseptic filter papers piece on rose-bengal agar medium, it is uniform per ware
Ground pastes 6, respectively at being cultivated 1-2 days in 28~30 DEG C of biochemical cultivation case, according to filter paper surrounding growth circle size, judges bacterium
The degradation capability of strain, picking goes out the larger multiple dominant strains of growth circle.
Secondary screening：Being diluted to the bacteria suspension of debita spissitudo after the bacterial strain activation that primary dcreening operation is obtained with sterilized water, (bacteria containing amount is
3.21×108Individual/ml), accessing 100mL nutrient solutions with 10% (V/V) inoculum concentration, (not diluted high salinity organic chemical industry gives up
Water) in, respectively at 28~30 DEG C of water-bath constant temperature oscillator cultures 4 days, determine COD in nutrient solutionCrContent and micro organism quantity, choosing
To organic high-salinity wastewater unit cell CODCrThe higher bacterial strain of degradation rate is named as advantage degraded salt-enduring strain
“NYZJ6-14”。
2. identification
Thermophilic salt fungi of being degraded to the advantage filtered out carries out morphological observation (colonial morphology and hypha form), entrusts simultaneously
Sangon Biotech (Shanghai) Co., Ltd. carries out ITS region sequence analyses, the SEQ ID that sequencing result is shown in sequence table
NO:1。
Morphological observation finds that the bacterium colony of bacterial strain is circle, and opaque, the smooth of the edge, surface is smooth, in culture medium front
Color is pure white, and reverse side color is pink.Further qualification test and result include, and the Gram-positive of bacterial strain, V.P experiments are cloudy
Property, methyl red test is positive, it is impossible to hydrolysis starch.Colonial morphology is shown in Fig. 1.
NYZJ6-14 ITS region sequences are obtained, it is subjected to tetraploid rice with the gene order in Genbank, found
It belongs to Candida (Candida) category, then by the foundation (Fig. 2) of phylogenetic tree, and it may be heat to judge NYZJ6-14
Band Candida (Candida tropicalis).Combining form observation result (Fig. 1), it is final to determine that NYZJ6-14 is the torrid zone
Candida (Candida tropicalis).
3. and oxygen
Candida tropicalis NYZJ6-14 is coated on rose-bengal agar medium, respectively at 28~30 DEG C of biochemistry
Cultivated 2~7 days in aerobic incubator and in anaerobic culture box, daily observation lawn growing state.As a result show, torrid zone vacation silk ferment
Female NYZJ6-14 equal energy normal growths under aerobic and anaerobic conditions, accordingly, it is determined that candida tropicalis NYZJ6-14 is and oxygen
Bacterium.
Embodiment 2Salt tolerances and organic chemical waste water of the candida tropicalis NYZJ6-14 under aerobic and oxygen free condition
Processing is acted on
High salinity organic chemical waste water is taken, by 1 times, 4 times, 9 times, 14 times and 19 times of the wastewater dilution, 1/2 times of original is obtained
Water, 1/5 times of raw water, 1/10 times of raw water, 1/15 times of raw water and 1/20 times of raw water, with not diluted waste water (1 times of raw water) conduct
Nutrient solution.
The candida tropicalis NYZJ6-14 that embodiment 1 is obtained is diluted to the bacteria suspension of debita spissitudo with sterilized water, point
Be not inoculated in different diluent that 100mL obtains and not diluted waste water in, make NYZJ6-14 inoculum concentration for 3.48 ×
107Individual bacterial strain/ml nutrient solutions, then respectively at 28 DEG C of water-bath constant temperature oscillator cultures 4 days.Done culture is divided into aerobic group and nothing
Oxygen group, wherein aerobic group is 150r/min shaken cultivations, the bottled amount of nutrient solution is 35% (V/V), and anaerobic group is in nutrient solution
Surface adds about 1cm atoleine, and other conditions are identical with aerobic group.
Above-mentioned experiment is parallel to carry out 2 groups, 1 and examination 2 is respectively tried, while will not be inoculated with candida tropicalis NYZJ6-14's
Nutrient solution determines COD in nutrient solution as blank, culture after 4 daysCr, pH, salinity, bacteria containing amount, CODCrDegradation rate (%), as a result
As shown in table 1.
The Candida Tropicalis NYZJ6-14 of table 1 cultivate the result of the test of 4 days
As a result show, candida tropicalis NYZJ6-14 is in the not diluted high salt with diluting 1 times, 4 times, 9 times and 14 times
Spend energy normal growth, and keep higher COD in organic chemical waste waterCrDegradation rate and bacteria containing amount.Wherein, through 4 times of dilutions
The high salinity organic chemical waste water nutrient solution in, CODCrDegradation rate and the equal highest of bacteria containing amount, the COD under aerobic conditionCrDrop
Solution rate is up to 55.9%, and bacteria containing amount is up to 5.4 × 108Individual bacterial strain/ml；COD under anaerobicCrDegradation rate is up to 49.3%, containing bacterium
Measure up to 4.7 × 108Individual bacterial strain/ml.And in 19 times of high salinity organic chemical waste water is diluted, the COD of nutrient solutionCrIt is molten compared with blank
Liquid change is little, and bacteria containing amount is substantially reduced compared with inoculum concentration, shows that bacterial strain is drastically dead, it is impossible to grow.As a result prove, the torrid zone is false
Silk yeast NYZJ6-14 can be resistant to large-scale salinity, while can realize significant COD under the conditions of anaerobic and aerobicCrDrop
Solution is acted on, therefore is had a good application prospect in the biological cleaning of wastewater from chemical industry.
Specific description of embodiments of the present invention above is not intended to limit the present invention, and those skilled in the art can be according to this
Invention is variously modified or deformed, and without departing from the spirit of the present invention, all should belong to the model of appended claims of the present invention
Enclose.
Claims (30)
1. one plant can handle high salinity organic chemical waste water candida tropicalis (Candida tropicalis)NYZJ6-
14, its deposit number is CGMCC No.9682.
2. purposes of the candida tropicalis NYZJ6-14 in processing organic chemical waste water described in claim 1.
3. purposes according to claim 2, it is characterised in that the processing organic chemical waste water includes, by the torrid zone
Candida NYZJ6-14, which is inoculated in organic chemical waste water, to be cultivated, and the salinity of the organic chemical waste water is 3~34 ‰.
4. purposes according to claim 3, it is characterised in that the salinity of the organic chemical waste water is 14~34 ‰.
5. purposes according to claim 3, it is characterised in that the COD of the organic chemical waste waterCrFor 1.0 × 103~
2.5×104mg/L。
6. the purposes according to claim 5, it is characterised in that the COD of the organic chemical waste waterCrFor 1.5 × 103~
1.3×104mg/L。
7. the purposes according to claim 6, it is characterised in that the COD of the organic chemical waste waterCrFor 2.5 × 103~
1.3×104mg/L。
8. the purposes according to claim 7, it is characterised in that the COD of the organic chemical waste waterCrFor 5 × 103~
1.3×104mg/L。
9. purposes according to claim 3, it is characterised in that the pH of the organic chemical waste water is 2.0~7.6.
10. purposes according to claim 9, it is characterised in that the pH of the organic chemical waste water is 2.0~7.0.
11. purposes according to claim 10, it is characterised in that the pH of the organic chemical waste water is 2.7~4.0.
12. the purposes according to any one of claim 3 to 11, it is characterised in that the candida tropicalis NYZJ6-
14 inoculum concentration is 1.0 × 107~6.0 × 107Organic chemical waste water described in individual bacterial strain/ml.
13. purposes according to claim 12, it is characterised in that the inoculum concentration is 2.0 × 107~5.0 × 107Individual bacterium
Organic chemical waste water described in strain/ml.
14. purposes according to claim 13, it is characterised in that the inoculum concentration is 3.0 × 107~4.0 × 107Individual bacterium
Organic chemical waste water described in strain/ml.
15. purposes according to claim 3, it is characterised in that condition of culture is 25~30 DEG C, 40~160r/min；Make
It is 30~40% (V/V) for the bottled amount of the organic chemical waste water of nutrient solution.
16. a kind of method for handling organic chemical waste water, methods described includes, by the candida tropicalis described in claim 1
NYZJ6-14 is inoculated in organic chemical waste water and cultivated, and the salinity of the organic chemical waste water is 3~34 ‰.
17. method according to claim 16, it is characterised in that the salinity of the organic chemical waste water is 14~34 ‰.
18. method according to claim 17, it is characterised in that the COD of the organic chemical waste waterCrFor 1.0 × 103~
2.5×104mg/L。
19. method according to claim 18, it is characterised in that the COD of the organic chemical waste waterCrFor 1.5 × 103~
1.3×104mg/L。
20. method according to claim 19, it is characterised in that the COD of the organic chemical waste waterCrFor 2.5 × 103~
1.3×104mg/L。
21. method according to claim 20, it is characterised in that the COD of the organic chemical waste waterCrFor 5 × 103~
1.3×104mg/L。
22. method according to claim 16, it is characterised in that the pH of the organic chemical waste water is 2.0~7.6.
23. method according to claim 22, it is characterised in that the pH of the organic chemical waste water is 2.0~7.0.
24. method according to claim 23, it is characterised in that the pH of the organic chemical waste water is 2.7~4.0.
25. the method according to any one of claim 16 to 24, it is characterised in that the candida tropicalis NYZJ6-
14 inoculum concentration is 1.0 × 107~6.0 × 107Organic chemical waste water described in individual bacterial strain/ml.
26. method according to claim 25, it is characterised in that the inoculum concentration of the candida tropicalis NYZJ6-14 is
2.0×107~5.0 × 107Organic chemical waste water described in individual bacterial strain/ml.
27. method according to claim 26, it is characterised in that the inoculum concentration of the candida tropicalis NYZJ6-14 is
3.0×107~4.0 × 107Organic chemical waste water described in individual bacterial strain/ml.
28. method according to claim 16, it is characterised in that condition of culture is 25~30 DEG C, 40~160r/min；
It is 30~40% (V/V) as the bottled amount of the organic chemical waste water of nutrient solution.
29. the candida tropicalis NYZJ6-14 described in claim 1 is preparing the biological drop for handling organic chemical waste water
Solve the purposes in agent.
30. the candida tropicalis NYZJ6-14 described in claim 1 is in the engineering bacteria for building processing organic chemical waste water
Purposes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410829927.6A CN104560746B (en) | 2014-12-26 | 2014-12-26 | One plant can handle high salinity organic chemical waste water candida tropicalis and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410829927.6A CN104560746B (en) | 2014-12-26 | 2014-12-26 | One plant can handle high salinity organic chemical waste water candida tropicalis and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104560746A CN104560746A (en) | 2015-04-29 |
| CN104560746B true CN104560746B (en) | 2017-07-28 |
Family
ID=53077828
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410829927.6A Active CN104560746B (en) | 2014-12-26 | 2014-12-26 | One plant can handle high salinity organic chemical waste water candida tropicalis and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104560746B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105154344A (en) * | 2015-09-10 | 2015-12-16 | 中蓝连海设计研究院 | Method for preparing halophilic yeast agent and halophilic yeast agent |
| TWI757003B (en) * | 2020-12-21 | 2022-03-01 | 國立屏東科技大學 | Candida palmioleophila sw4’-w6 and method for treating water in culture pond using the same |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101906388A (en) * | 2010-01-29 | 2010-12-08 | 清华大学 | Yeast and application thereof in decolorization |
| CN101955925A (en) * | 2009-07-14 | 2011-01-26 | 南开大学 | Method for improving cadmium tolerance of bacillus through mutagenesis |
| CN101955889A (en) * | 2010-10-12 | 2011-01-26 | 天津科技大学 | Cadmium salt resistant Candida tropicalis and application thereof |
| CN103642707A (en) * | 2013-12-03 | 2014-03-19 | 湖北工业大学 | Method for producing candida for feeds by fermenting high-salt-content amino acid wastewater |
| CN104212728A (en) * | 2014-05-13 | 2014-12-17 | 范明星 | High temperature-resistant Candidasp. FD-1 for phenolated water degradation |
-
2014
- 2014-12-26 CN CN201410829927.6A patent/CN104560746B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101955925A (en) * | 2009-07-14 | 2011-01-26 | 南开大学 | Method for improving cadmium tolerance of bacillus through mutagenesis |
| CN101906388A (en) * | 2010-01-29 | 2010-12-08 | 清华大学 | Yeast and application thereof in decolorization |
| CN101955889A (en) * | 2010-10-12 | 2011-01-26 | 天津科技大学 | Cadmium salt resistant Candida tropicalis and application thereof |
| CN103642707A (en) * | 2013-12-03 | 2014-03-19 | 湖北工业大学 | Method for producing candida for feeds by fermenting high-salt-content amino acid wastewater |
| CN104212728A (en) * | 2014-05-13 | 2014-12-17 | 范明星 | High temperature-resistant Candidasp. FD-1 for phenolated water degradation |
Non-Patent Citations (1)
| Title |
|---|
| 五株分离酵母菌的甘油酯和脂肪酸降解活性比较;韩云 等;《中国环境科学》;20051231;第25卷;39-42 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104560746A (en) | 2015-04-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wang et al. | Removal of nutrients from undiluted anaerobically treated piggery wastewater by improved microalgae | |
| CN103756947B (en) | The preparation method of a kind of acinetobacter calcoaceticus and microbial inoculum thereof | |
| US20210269341A1 (en) | Las-degrading and/or n-removing bacterium and application thereof | |
| CN109456926A (en) | A kind of microbial bacterial agent and its application containing thermophilic salt denitrifying bacterium YL5-2 | |
| CN107177532A (en) | A kind of organic nitrogen contaminant degradation microbial inoculum and its application | |
| CN113846039B (en) | Bacillus bailii and application thereof | |
| CN101139140A (en) | Aerugo microcapsule algae degradation method using animalcule | |
| CN110217895A (en) | A kind of complex micro organism fungicide and its application for water environment treatment | |
| CN104560777B (en) | One plant height is resistant to microphenomenon of degradation of aniline and its application | |
| CN109536426A (en) | One plant of psychrophile and its application | |
| CN101811779B (en) | Preparation method of halophilic decontamination bacterial agent and bacterial agent prepared by same | |
| CN101429486B (en) | Brood cell bacillus MK3-1 for purification of heavy metal pollution and uses thereof | |
| CN104312957A (en) | Denitrifying bacterium and fermenting production method thereof | |
| CN101386822B (en) | Special effect phosphate accumulating organisms and waste water processing method using thereof | |
| CN102250776A (en) | Acid-resistance heterotrophic bacterium strain Z3 used for bioleaching treatment of sludge and livestock and poultry manure | |
| CN104593296B (en) | Paper waste dirt fills reed Tanaka's typical bacteria --- screening of spindle lysine bacillus and application thereof | |
| CN110408565A (en) | A kind of efficient denitrification composite bacteria agent, preparation and its application | |
| CN104560746B (en) | One plant can handle high salinity organic chemical waste water candida tropicalis and application thereof | |
| CN113604407A (en) | Composite microbial algaecide and preparation method and application thereof | |
| CN106635855B (en) | Microbacterium and its culture application are seen in a kind of north | |
| CN105502805B (en) | Enhancement microbiological multistep treatment sanitary sewage and the processing system and domestic sewage processing method of recycling | |
| CN104694435B (en) | One plant of Shinella sp. with triazole degradation function and its application | |
| CN114292798B (en) | Anaerobic denitrifying strain and application thereof in riverway water body remediation | |
| CN106591173A (en) | Bacillus flexus HL-37 capable of activating soil heavy metal cadmium, and applications thereof | |
| CN108911452A (en) | A method of improving citric acid wastewater dewatering performance of sludge using penicillium oxalicum |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |