CN102250776A - Acid-resistance heterotrophic bacterium strain Z3 used for bioleaching treatment of sludge and livestock and poultry manure - Google Patents
Acid-resistance heterotrophic bacterium strain Z3 used for bioleaching treatment of sludge and livestock and poultry manure Download PDFInfo
- Publication number
- CN102250776A CN102250776A CN 201110158682 CN201110158682A CN102250776A CN 102250776 A CN102250776 A CN 102250776A CN 201110158682 CN201110158682 CN 201110158682 CN 201110158682 A CN201110158682 A CN 201110158682A CN 102250776 A CN102250776 A CN 102250776A
- Authority
- CN
- China
- Prior art keywords
- bioleaching
- bacteria
- livestock
- sludge
- mud
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Treatment Of Sludge (AREA)
- Purification Treatments By Anaerobic Or Anaerobic And Aerobic Bacteria Or Animals (AREA)
Abstract
The invention relates to an acid-resistance heterotrophic bacterium strain Z3 used for bioleaching treatment of sludge and livestock and poultry manure and belongs to the technical field of environmental engineering. The bacteria are cylindrical single-celled bacteria, the arthrospore size of the bacteria is 6<-12>mu m *3<-6>mu m, the bacterial colony is diffused on a plane, the bacteria grow quickly, the bacteria are flat, high in center and flock-like, the liquid culturing the bacteria is turbid, the precipitate is loose, the reproductive mode of the bacteria is fissiparism, and the formed arthrospores are single ones or connected into a chain. The bacteria can grow normally in an extremely acidic environment in which the pH value is 2.5, the most suitable pH is 2.5 to 6, and according to morphological and physiological biochemical characters and molecular biological assay, the bacterial strain belongs to Galactomyces geotrichum and the collection number of the bacterial strain is CGMCC No.4298. The strain in a pig manure and urban sludge bioleaching environment can quickly use water soluble small molecular weight organic matters or simple organic acids as a carbon source and an energy source, so the bioleaching efficiency is improved, the rate of removal of heavy metals from the pig manure and urban sludge reaches over 90 percent, and the dehydration rates for the pig manure and urban sludge are 48 and 80 percent respectively.
Description
One, technical field
The present invention relates to the acid resistance heterotrophic bacterium Z3 that a strain is applied to mud and the processing of livestock and poultry feces bioleaching, be one and utilize heterotrophic bacterium and autotrophic bacteria to do mutually to carry out the technology that bioleaching is handled, belong to field of environment engineering technology.
Two, technical background
China is annual at present produces about more than 700 ten thousand tons of (dry-matter meter) all kinds of municipal sludges, and organic solid wastes such as more industrial sludge and livestock and poultry feces.These solid organic waste substances all exist concentration not wait diverse heavy metal, because the municipal sewage plant tends to the receiving portion trade effluent, plant then can add some metal-salts as additive in feed, make that heavy metal also obviously improves in the excrement dirt.In addition, also there are a difficult problem that is difficult to dewater in these mud or excrement dirt.For example, China's municipal sludge adopts and adds the capable again mechanical dehydration of flocculation agent PAM, and its dehydrated sludge water ratio is still up to about 85%, and these mud are difficult to dispose.Therefore, realizing deeply dehydrating sludge and remove harmful heavy metal from mud, is to realize that mud is rationally disposed and the important prerequisite of recycling, also is the important technique measure of dissolving a sludge disposal difficult problem.
In recent years, discover and utilize liquid mud of bioleaching technology (Bioleaching) pre-treatment or livestock and poultry feces to have the effect that promotes its dehydration and stripping heavy metal.This seminar has set up first municipal sludge bioleaching processing plant in the world by 10 years of researches and groping in the jiangsu wuxi city on August 24th, 2010, scale is for day handling 50,000 tons of mud that sewage produced.Handle back mud and under the condition that does not add any flocculation agent, directly pass through mechanical dehydration, moisture percentage in sewage sludge is reached about 55%, and this technology also can make extrusion rate of heavy metals reach more than 80%, stench is eliminated, pathogen also is killed, and shows good industrial prospect.
This seminar once disclosed two kinds of patents that efficiently act on the autotrophic type bioleaching microorganism of mud (ZL02112924.X, ZL02137921.1), i.e. acidophilia thiobacillus ferrooxidant LX5 and thiobacillus thiooxidans TS6.But in actual motion, must cooperate the acid resistance heterotrophic bacterium, could keep permanent activity.This is because these two kinds of thiobacilluss all are the obligate chemoautotrophic bacterias, and the sludge water soluble organism is had certain susceptibility, and water soluble organic substance content has often surpassed its toxic levels in the mud, needs heterotrophic bacterium to decompose these to the deleterious material of thiobacillus.This seminar invented a kind of acid resistance rhodotorula bacterium and has been used for the patent (ZL200410044843.8) of method of the biological eliminating of mud heavy metal on May 31st, 2004, by inoculating simultaneously in mud with the water soluble organic substance is the rhodotorula bacterium R30 of energy derive and carbon source, to reduce the concentration of these deleterious small molecules in mud significantly, improved the activity of thiobacillus in sludge bioleaching greatly, sludge bioleaching processing efficiency and stability are further enhanced.This explanation is in the sludge bioleaching system, and the adding of acid resistance heterotrophic bacterium is very useful.Evidence, in the sludge bioleaching system, microbial diversity is abundant more, and the bioleaching effect is good more.After the R30 bacterium, we have found a kind of new acid resistance heterotrophic bacterium D13 again, and (number of patent application: 201010225268.7), they can both be at normal growth under the sour environment.Be the fungi of yeast belong in view of above-mentioned two strain heterotrophic bacteriums, for seeking more efficient different types of heterotrophic bacterium, make the microbial diversity of sludge bioleaching system abundanter, we are separated to the new heterotrophic bacterium of a strain from the livestock and poultry feces of bioleaching, and find its well effect of volatilizing in mud and livestock and poultry feces bioleaching.
Three, summary of the invention
Technical problem the object of the present invention is to provide a kind of acid resistance heterotrophic bacterium with eliminate sludge bioleaching handle in to the influential small organic molecule of growth of thiobacillus, thereby improve the stability of bioleaching efficient and long-time running.
Be main contents of the present invention below the technical scheme:
A strain provided by the invention is acid proof heterotrophic bacterium bacterial strain Z3 in mud and livestock and poultry feces bioleaching, separates and soaks the acidifying livestock and poultry feces from biological drop, confirms as Geotrichum (Galactomyces geotrichum) Z3 through identifying.This bacterial strain is preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center (Institute of Microorganism, Academia Sinica, BeiJing, China) on November 5th, 2010, and its deposit number is CGMCC No.4298.Bacterial strain is behind pcr amplification, and 18S rRNA portion gene, ITS1 zone, 5.8S rRNA, ITS2,28S rRNA portion gene sequence are HM566199 in nucleic acid database GenBank (NCBI) (http://www.ncbi.nlm.nih.gov/) accession number.
Above-mentioned bacterial strains Z3 is through identifying to have following biological property:
(1) morphological specificity of bacterial strain: unicellular cylindrical, the arthrospore size is 6-12 μ m * 3-6 μ m, and bacterium colony is planar diffusion, and growth is fast, flat, umbo, white, short flannel shape, the liquid culture muddiness, throw out is loose, and modes of reproduction is fragmentation, the single or connection chaining of the arthrospore of formation.
(2) physiological and biochemical property of bacterial strain: this bacterial strain is well-grown under 25～35 ℃ of conditions, is easy to cultivate under the normal temperature, and its optimum growth temperature is 28 ℃.All can grow in pH2～9, optimal pH is 2.5～6, and growth is under some influence when pH＞7, and growth is subjected to bigger inhibition when pH＜2.5.Test is found to reach at 2.0 o'clock at the later stage pH of the dirty bioleaching of pig manure excrement, still can detect bacterial strain Z3, illustrates that it is very strong to the tolerance of sour environment.Bacterial strain Z3 can glucose fermentation, fructose and nonfermented lactose, and faint fermentation sucrose can assimilate KNO
3(NH
4)
2SO
4, can not utilize inositol, Virahol as sole carbon source, do not form the kind of starch compound.
(3) the molecular biosciences qualification result of bacterial strain: the 18S rRNA portion gene of bacterial strain Z3, ITS1 zone, 5.8S rRNA, ITS2,28S rRNA portion gene are measured 325 base pairs altogether, are HM566199 in nucleic acid database GenBank (NCBI) (http://www.ncbi.nlm.nih.gov/) accession number.The sequence of 18S rRNA-ITS1-5.8S rRNA-ITS2-28S rRNA is as follows:
gggcttgcat?ttcagtattt?gtgatttacc?acagcaaaca?aaaatcatac?aatcaaaaca?aaaataattaaaacttttaa?caatggatct?cttggttctc?gtatcgatga?agaacgcagc?gaaacgcgat?atttcttgtgaattgcagaa?gtgaatcatc?agtttttgaa?cgcacattgc?actttggggt?atcccccaaa?gtatacttgtttgagcgttg?tttctctctt?ggaattgctt?tgctcttcta?aaatttcgaa?tcaaattcgt?ttgaaaaacaacactattca?acctcagatc?aagtaggatt?acccgctgaa?cttaa
Bacterial strain Z3 and Galactomyces geotrichum strain YF01f similarity are the highest, and homology reaches 99.69%, therefore, is accredited as Galactomyces sp.Z3, in conjunction with physiological and biochemical property it is classified as Geotrichum.
Beneficial effect
This bacterial strain is compared with existing similar bacterial strain has obvious advantage:
In the dirty and sludge bioleaching system, can tolerate the sour environment of pH2 at the pig manure excrement, therefore the fine growth of energy when pH2.5, can keep more permanent vigor and not need frequent interpolation in bioleaching.
This bacterium can utilize dissolved organic matter (DOM) in dirt of pig manure excrement and the sludge bioleaching system fast, reduces the murder by poisoning of DOM to thiobacillus.
This bacterium can produce the solvability CO of higher concentration rapidly when utilizing DOM or small molecular organic acid
2, promote with CO greatly
2Growth of thiobacillus for carbon source.
Therefore, in dirt of pig manure excrement and sludge bioleaching, inoculation Galactomyces sp.Z3 can make the dirty and sludge bioleaching time shortening of pig manure excrement, and the heavy metal solubility rate improves, and processing back pig manure excrement is dirty and dewatering performance of sludge is significantly improved.
Four, embodiment
Narrate embodiments of the invention below.
1, the separation of bacterial strain Z3 and enlarged culturing
Preparation PDA substratum, composition: potato 200g, sucrose or glucose 20g, water 1000mL, pH nature, 121 ℃, 30min sterilization.The sample that is used to separate the acid resistance heterotrophic bacterium is taken from the acidifying pig manure excrement dirt (the pH value is about 2.0) after the dirty bioleaching of the pig manure excrement of before having finished is handled.Get acidifying pig manure excrement soiling solution one ring with transfering loop, line separates on the PDA flat board, has the flat board of the dirty suspension of acidifying pig manure excrement to be inverted under 28 ℃ above-mentioned inoculation and cultivates 3～4d, to growing bacterium colony.Separate the representational preferably single bacterium colony of growth and do the coating microscopy on the PDA flat board, impure as if having, then further this bacterium colony of picking is rule repeatedly, until the pure bacterium that obtains the purpose bacterial strain, and shifts the inclined-plane and preserves standby.The liquid culture condition: get the Z3 lawn from the inclined-plane, be inoculated in the PDA liquid nutrient medium, 28-30 ℃, to cultivate 2 days in the reciprocating type shaking table of 180rpm, the bacterium number reaches 10
7Individual/mL.Morphologic observation and microscope inspection find that this bacterial strain is unicellular cylindrical, and the arthrospore size is 6-12 μ m * 3-6 μ m.Bacterium colony is planar diffusion, and growth is fast, and is flat, umbo, and white, the short flannel shape, the liquid culture muddiness, throw out is loose, and modes of reproduction is fragmentation, the single or connection chaining of the arthrospore of formation.Bacterial strain further is defined as the Geotrichum bacterial strain, called after Galactomyces sp.Z3 after Physiology and biochemistry evaluation and molecular biology identification.
2, Z3 the pH of suitable growth measure
The PDA liquid nutrient medium of certain volume is sub-packed in a series of 150mL triangular flasks according to every bottle of 50mL.Use 4N H
2SO
4The medium pH value is adjusted to 1.5,2.0,2.5,3.0 respectively, and 10 gradients of 4.0,5.0,6.0,7.0,8.0 and 8.5 are subsequently in 121 ℃ of 15min that sterilize down.Get a ring Galactomyces sp.Z3 inclined-plane lawn after cooling respectively and be inoculated in the above-mentioned substratum, placing rotating speed is 28 ℃ of constant temperature culture 48h of 180r/min shaking table.Its growth characterizes with the light absorption value (OD) of nutrient solution at the 600nm place, and each pH handles and all establishes 3 repetitions, the results are shown in Table 1.
Table 1Galactomyces sp.Z3 upgrowth situation in different pH substratum
The result shows that Galactomyces sp.Z3 can tolerate the extreme sour environment of pH2.0, still has a spot of growth under this environment.When pH reaches 2.5, the just fine growth of energy of this bacterium, but arrive pH greater than 7.0 o'clock, it is influenced to grow.
3, Galactomyces sp.Z3 is to the utilization of the dirty DOM of pig manure excrement
Get the dirt of 150mL pig manure excrement and be put in respectively in the different triangular flasks with municipal sludge DOM solution (regulating pH in advance is 5), behind the high-temperature heat sterilization, cooling, each triangular flask is inoculated Galactomyces sp.Z3 lawn one ring respectively, cultivates 48h down in 28 ℃.And the control treatment of not inoculating Galactomyces sp.Z3 is set separately, other conditionally completes are identical.Measure cultivation front and back DOM change in concentration with the TOC instrument, the results are shown in Table 2.
Table 2Galactomyces sp.Z3 is to the utilization ratio of dirt of pig manure excrement and mud DOM
The result shows that Z3 reaches 59% to the utilization ratio of DOM in the pig manure in 48h, and control treatment only is 0.3%, the utilization ratio of DOM in the mud is reached 86%, and control treatment only is 3.2%.Illustrate that Z3 can decompose it rapidly by utilizing DOM, thereby reduced the murder by poisoning of DOM thiobacillus.Meanwhile, Z3 may produce a large amount of CO when utilizing DOM
2, therefore may promote again with CO
2Growth for the thiobacillus of carbon source.
4, the action effect of Z3 in dirt of pig manure excrement and municipal sludge bioleaching
Thiobacillus Thiobacillus sp. is mainly this laboratory strain separated Thiobacillus thiooxidans TS6 (CGMCC NO.0759) and Thiobacillus ferrooxidans LX5 (CGMCC No.0727).(its prescription is seen the patent that this seminar applies for: number of patent application 201010221264.1) to add water ratio and be 96% dirty 20L of pig manure excrement and the microorganism composite nutrient of 4g/L in the bio-reactor (patent No. ZL200520072316.8) of this seminar invention, and inoculate 10% composite sulfur bacillus bacterium liquid, under 28 ℃, tame cultivation, be about at 3 o'clock to sludge pH and formally begin to test.At this moment, adopt continuously feeding, the continuous pulp discharge mode is handled, promptly pump into new pig manure excrement dirt, and simultaneously by the 5% disposable inoculation Z3 liquid fermenting bacterium liquid of handling the dirty weight of pig manure excrement in one day (no longer adding later on), the dirty residence time of excrement (SRT) is 2 days, after 1 week of steady running, gather the bioleaching of discharging and handle the excrement dirt, measure heavy metal in the excrement dirt (Cu, Zn) solubility rate and its dewatering, do the control treatment that does not add Z3 simultaneously, the dirty dewatering of excrement adopts mensuration resistivity (γ) to weigh, and than the big more difficult more dehydration of resistance, measurement result sees Table 3.Adopt above-mentioned same method, change the dirt of pig manure excrement into municipal sludge, adding and not adding under the situation of Z3, carry out bioleaching, measurement result sees Table 4.
Table 3 is the dirty bioleaching treatment effect of pig manure excrement under the situation of inoculating and do not inoculate Z3
Table 4 is municipal sludge bioleaching treatment effect under the situation of inoculating and do not inoculate Z3
The result shows, is that inoculation Z3 treatment effect will improve many under 2 days the bioleaching condition in the residence time, mainly shows the heavy metal solubility rate and handle highly than not inoculating that the heavy metal solubility rate on average reaches more than 90%, and resistivity also has decline significantly.Compare with mud with the bioleaching pig manure excrement that does not add Z3 is dirty, the dirt of bioleaching pig manure excrement and the dehydration property of inoculation Z3 bacterial strain improve 48% and 80% respectively.Clearly, this bacterium has the effect of effective raising bioleaching.
Claims (4)
1. a strain is applied to the acid resistance heterotrophic bacterium Z3 of mud and the processing of livestock and poultry feces bioleaching, name Geotrichum Z3 (Galactomycesgeotrichum Z3), on November 5th, 2010 was preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center, and deposit number is CGMCC No.4298.
2. according to claim 1ly be applied to the acid resistance heterotrophic bacterium Z3 that mud and livestock and poultry feces bioleaching are handled, it is characterized in that described Geotrichum Z3 can be in the extreme sour environment of pH2.5 normal growth, optimal pH is 2.5-6.
3. the acid resistance heterotrophic bacterium Z3 that is applied to mud and the processing of livestock and poultry feces bioleaching according to claim 1, the GenBank number of registration that it is characterized in that described Geotrichum Z3 is HM566199, and the sequence of its 18S rRNA-ITS1-5.8S rRNA-ITS2-28S rRNA is as follows:
gggcttgcat?ttcagtattt?gtgatttacc?acagcaaaca?aaaatcatac?aatcaaaaca?aaaataattaaaacttttaa?caatggatct?cttggttctc?gtatcgatga?agaacgcagc?gaaacgcgat?atttcttgtgaattgcagaa?gtgaatcatc?agtttttgaa?cgcacattgc?actttggggt?atcccccaaa?gtatacttgtttgagcgttg?tttctctctt?ggaattgctt?tgctcttcta?aaatttcgaa?tcaaattcgt?ttgaaaaacaacactattca?acctcagatc?aagtaggatt?acccgctgaa?cttaa
4. the acid resistance heterotrophic bacterium Z3 that is applied to mud and the processing of livestock and poultry feces bioleaching according to claim 1, it is characterized in that described Geotrichum Z3 is seeded in livestock and poultry feces and the sludge bioleaching system reaction and can makes their dehydration property improve 48% and 80% respectively in 2 days, the heavy metal solubility rate is brought up to more than 90%.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110158682 CN102250776B (en) | 2011-06-14 | 2011-06-14 | Acid-resistance heterotrophic bacterium strain Z3 used for bioleaching treatment of sludge and livestock and poultry manure |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110158682 CN102250776B (en) | 2011-06-14 | 2011-06-14 | Acid-resistance heterotrophic bacterium strain Z3 used for bioleaching treatment of sludge and livestock and poultry manure |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102250776A true CN102250776A (en) | 2011-11-23 |
| CN102250776B CN102250776B (en) | 2013-07-24 |
Family
ID=44978348
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110158682 Active CN102250776B (en) | 2011-06-14 | 2011-06-14 | Acid-resistance heterotrophic bacterium strain Z3 used for bioleaching treatment of sludge and livestock and poultry manure |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102250776B (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103936246A (en) * | 2014-03-27 | 2014-07-23 | 南京农业大学 | New method for deeply dewatering sludge through bio-leaching process rapid conditioning |
| CN104496140A (en) * | 2014-11-11 | 2015-04-08 | 北京中科国通环保工程技术有限公司 | Municipal sludge bioleaching method |
| CN104743761A (en) * | 2015-03-12 | 2015-07-01 | 交通运输部天津水运工程科学研究所 | Method for alleviating density of float sludge of silt port by using heterotrophic bacteria microorganisms |
| CN104876420A (en) * | 2014-02-27 | 2015-09-02 | 香港浸会大学 | Biogenic Flocculant Composition To Enhance Flocculation And Dewaterability Of Chemically Enhanced Primary Treatment Sludge |
| CN111876339A (en) * | 2020-09-15 | 2020-11-03 | 深圳大学 | Heavy metal tolerant yeast and application thereof |
| CN115490407A (en) * | 2022-09-13 | 2022-12-20 | 浙江科技学院 | Large-scale dairy farm excrement treatment method |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101838612A (en) * | 2009-03-06 | 2010-09-22 | 青海大学 | New geotrichum and application thereof in degradation of single-cell seaweed polysaccharide |
-
2011
- 2011-06-14 CN CN 201110158682 patent/CN102250776B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101838612A (en) * | 2009-03-06 | 2010-09-22 | 青海大学 | New geotrichum and application thereof in degradation of single-cell seaweed polysaccharide |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104876420A (en) * | 2014-02-27 | 2015-09-02 | 香港浸会大学 | Biogenic Flocculant Composition To Enhance Flocculation And Dewaterability Of Chemically Enhanced Primary Treatment Sludge |
| CN104876420B (en) * | 2014-02-27 | 2018-02-09 | 香港浸会大学 | For strengthening the biological flocculant composition of CEPT sludge flocculations and water separation capability |
| CN103936246A (en) * | 2014-03-27 | 2014-07-23 | 南京农业大学 | New method for deeply dewatering sludge through bio-leaching process rapid conditioning |
| CN103936246B (en) * | 2014-03-27 | 2016-04-13 | 南京农业大学 | A kind of sludge bioleaching method nurses one's health the method for deep dehydration fast |
| CN104496140A (en) * | 2014-11-11 | 2015-04-08 | 北京中科国通环保工程技术有限公司 | Municipal sludge bioleaching method |
| CN104743761A (en) * | 2015-03-12 | 2015-07-01 | 交通运输部天津水运工程科学研究所 | Method for alleviating density of float sludge of silt port by using heterotrophic bacteria microorganisms |
| CN104743761B (en) * | 2015-03-12 | 2017-03-22 | 交通运输部天津水运工程科学研究所 | Method for alleviating density of float sludge of silt port by using heterotrophic bacteria microorganisms |
| CN111876339A (en) * | 2020-09-15 | 2020-11-03 | 深圳大学 | Heavy metal tolerant yeast and application thereof |
| CN115490407A (en) * | 2022-09-13 | 2022-12-20 | 浙江科技学院 | Large-scale dairy farm excrement treatment method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102250776B (en) | 2013-07-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Lee et al. | Microbial flocculation, a potentially low-cost harvesting technique for marine microalgae for the production of biodiesel | |
| EP3800243B1 (en) | Bacterium degrading las and n and use thereof | |
| CN102250776B (en) | Acid-resistance heterotrophic bacterium strain Z3 used for bioleaching treatment of sludge and livestock and poultry manure | |
| CN104673715B (en) | There is fixed effect to cadmium and enterobacteria and its application of plant growth can be promoted | |
| CN102703351B (en) | Bacillus sp. UTM03 and application thereof | |
| CN102766579A (en) | Yeast strain for generating surfactant and application thereof | |
| Wang et al. | Degradation of slime extracellular polymeric substances and inhibited sludge flocs destruction contribute to sludge dewaterability enhancement during fungal treatment of sludge using filamentous fungus Mucor sp. GY-1 | |
| CN101245327B (en) | Bacillus licheniformis and method for producing alkali proteinase with sewage sludge as raw material | |
| CN104862244A (en) | Efficient composite bacterial agent for removing mixed grease-containing wastewater COD, and applications thereof | |
| CN114854605B (en) | Geotrichum candidum and application thereof | |
| CN104726366A (en) | Denitrifying phosphorus accumulation organism (DPAO) with function of efficiently removing nitrogen and phosphorus and application of DPAO | |
| CN1869199A (en) | A strain denitrogen paracoccus and its culturing method and application | |
| CN103114062A (en) | Denitrifying phosphate-accumulating organism with nitrogen and phosphorus removal functions and applications thereof | |
| CN105331552A (en) | Efficient denitrification novel Acinetobacter and application thereof | |
| CN109337825B (en) | Paecilomyces beijing strain LYZ7 and application thereof | |
| CN105154349B (en) | A kind of heterotrophic nitrification Facultative Halophiles and its application | |
| Hariz et al. | Growth and biomass production of native microalgae Chlorella sp., chlamydomonas sp. and Scenedesmus sp. cultivated in Palm Oil Mill Effluent (POME) at different Cultivation conditions | |
| CN104694435B (en) | One plant of Shinella sp. with triazole degradation function and its application | |
| CN102766580A (en) | Yeast strain for producing biosurfactant and application thereof | |
| CN101942407B (en) | Producing strain and production method for producing microbial flocculant from wheat starch waste water | |
| CN115851450A (en) | Cladosporium tenuissima NXY8, mycelial ball and application thereof in high-salt wastewater treatment | |
| CN108911452A (en) | A method of improving citric acid wastewater dewatering performance of sludge using penicillium oxalicum | |
| CN102250779B (en) | Acid resistant heterotrophic bacterium D13 applied in bioleaching of municipal sludge | |
| CN108102943A (en) | A kind of efficient denitrification microorganism and its application | |
| CN109251866B (en) | Chlamydomonas strain and application thereof in biogas slurry purification |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| ASS | Succession or assignment of patent right |
Owner name: NANJING BEIKETE ENVIRONMENTAL PROTECTION TECHNOLOG Free format text: FORMER OWNER: NANJING AGRICULTURAL UNIVERSITY Effective date: 20131105 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| COR | Change of bibliographic data |
Free format text: CORRECT: ADDRESS; FROM: 210095 NANJING, JIANGSU PROVINCE TO: 211505 NANJING, JIANGSU PROVINCE |
|
| TR01 | Transfer of patent right |
Effective date of registration: 20131105 Address after: 211505, C11 building, Zhongshan science and Technology Park, Jiangsu, Nanjing Patentee after: NANJING BEIKE ENVIRONMENT PROTECTION TECHNOLOGY CO., LTD. Address before: Nanjing City, Jiangsu Province, No. 1 210095 Weigang Patentee before: Nanjing Agricultural University |