CN102250776B - Acid-resistance heterotrophic bacterium strain Z3 used for bioleaching treatment of sludge and livestock and poultry manure - Google Patents
Acid-resistance heterotrophic bacterium strain Z3 used for bioleaching treatment of sludge and livestock and poultry manure Download PDFInfo
- Publication number
- CN102250776B CN102250776B CN 201110158682 CN201110158682A CN102250776B CN 102250776 B CN102250776 B CN 102250776B CN 201110158682 CN201110158682 CN 201110158682 CN 201110158682 A CN201110158682 A CN 201110158682A CN 102250776 B CN102250776 B CN 102250776B
- Authority
- CN
- China
- Prior art keywords
- bioleaching
- bacteria
- livestock
- sludge
- mud
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Treatment Of Sludge (AREA)
- Purification Treatments By Anaerobic Or Anaerobic And Aerobic Bacteria Or Animals (AREA)
Abstract
The invention relates to an acid-resistance heterotrophic bacterium strain Z3 used for bioleaching treatment of sludge and livestock and poultry manure and belongs to the technical field of environmental engineering. The bacteria are cylindrical single-celled bacteria, the arthrospore size of the bacteria is 6<-12>mu m *3<-6>mu m, the bacterial colony is diffused on a plane, the bacteria grow quickly, the bacteria are flat, high in center and flock-like, the liquid culturing the bacteria is turbid, the precipitate is loose, the reproductive mode of the bacteria is fissiparism, and the formed arthrospores are single ones or connected into a chain. The bacteria can grow normally in an extremely acidic environment in which the pH value is 2.5, the most suitable pH is 2.5 to 6, and according to morphological and physiological biochemical characters and molecular biological assay, the bacterial strain belongs to Galactomyces geotrichum and the collection number of the bacterial strain is CGMCC No.4298. The strain in a pig manure and urban sludge bioleaching environment can quickly use water soluble small molecular weight organic matters or simple organic acids as a carbon source and an energy source, so the bioleaching efficiency is improved, the rate of removal of heavy metals from the pig manure and urban sludge reaches over 90 percent, and the dehydration rates for the pig manure and urban sludge are 48 and 80 percent respectively.
Description
One, technical field
The present invention relates to the acid resistance heterotrophic bacterium Z3 that a strain is applied to mud and the processing of livestock and poultry feces bioleaching, be one and utilize heterotrophic bacterium and autotrophic bacteria to make mutually the technology of carrying out the bioleaching processing, belong to field of environment engineering technology.
Two, technical background
China is annual at present produces approximately more than 700 ten thousand tons of (dry-matter meter) all kinds of municipal sludges, and the organic solid wastes such as more industrial sludge and livestock and poultry feces.These solid organic waste substances all exist concentration not wait diverse heavy metal, because municipal sewage plant tends to the receiving portion trade effluent, plant can add some metal-salts as additive in feed, makes heavy metal in the excrement dirt also obviously improve.In addition, also there are a difficult problem that is difficult to dehydration in these mud or excrement dirt.For example, China's municipal sludge adopts and adds flocculation agent PAM capable mechanical dehydration again, and its dehydrated sludge water ratio is still up to 85% left and right, and these mud are difficult to dispose.Therefore, realizing deeply dehydrating sludge and remove harmful heavy metal from mud, is to realize that mud is rationally disposed and the important prerequisite of recycling, is also the important technique measure of dissolving a sludge disposal difficult problem.
In recent years, research finds to utilize the liquid mud of bioleaching technology (Bioleaching) pre-treatment or livestock and poultry feces to have the effect that promotes its dehydration and stripping heavy metal.This seminar, by 10 years of researches and groping, has set up first municipal sludge bioleaching processing plant in the world in the jiangsu wuxi city on August 24th, 2010, scale is for day processing 50,000 tons of mud that sewage produces.After processing, mud directly passes through mechanical dehydration under the condition that does not add any flocculation agent, can make moisture percentage in sewage sludge reach 55% left and right, and this technology also can make extrusion rate of heavy metals reach more than 80%, stench is eliminated, pathogen also is killed, and shows good industrialization prospect.
This seminar once disclosed two kinds of patents (ZL02112924.X, ZL02137921.1) that efficiently act on the autotrophic type bioleaching microorganism of mud, i.e. Acidithiobacillus ferrooxidans LX5 and Thiobacilus thiooxidans TS6s.But in actual motion, must coordinate the acid resistance heterotrophic bacterium, could keep permanent activity.This is because these two kinds of thiobacilluss are all the obligate chemoautotrophic bacterias, and the sludge water soluble organism is had to certain susceptibility, and in mud, water soluble organic substance content has often surpassed its toxic levels, needs heterotrophic bacterium to decompose these materials poisonous to thiobacillus.A kind of acid resistance Rhodotorula sp has been invented and for the patent (ZL200410044843.8) of the method for the biological eliminating of Heavy Metals in Sludge on May 31st, 2004 by this seminar, take by inoculate simultaneously the Rhodotorula sp R30 that water soluble organic substance is energy derive and carbon source in mud, with the concentration of these poisonous small molecules of decrease in mud, greatly improved the activity of thiobacillus in sludge bioleaching, sludge bioleaching processing efficiency and stability are further enhanced.This explanation is in the sludge bioleaching system, and adding of acid resistance heterotrophic bacterium is very useful.Evidence, in the sludge bioleaching system, microbial diversity is abundanter, and the bioleaching effect is better.After the R30 bacterium, we have found again a kind of new acid resistance heterotrophic bacterium D13, and (number of patent application: 201010225268.7), they can be at normal growth under sour environment.In view of above-mentioned two strain heterotrophic bacteriums are the fungi of yeast belong, for finding more efficient different types of heterotrophic bacterium, make the microbial diversity of sludge bioleaching system abundanter, we are separated to the new heterotrophic bacterium of a strain from the livestock and poultry feces of bioleaching, and find its well effect of volatilizing in mud and livestock and poultry feces bioleaching.
Three, summary of the invention
Technical problem the object of the present invention is to provide a kind of acid resistance heterotrophic bacterium with eliminate sludge bioleaching process in to the influential small organic molecule of growth of thiobacillus, thereby improve the stability of bioleaching efficiency and long-time running.
Below technical scheme, be main contents of the present invention:
A strain provided by the invention is acid proof heterotrophic bacterium bacterial strain Z3 in mud and livestock and poultry feces bioleaching, separates the livestock and poultry feces from biological drop pickling, through identifying, confirms as Geotrichum (Galactomyces geotrichum) Z3.This bacterial strain is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center (Institute of Microorganism, Academia Sinica, BeiJing, China) on November 5th, 2010, and its deposit number is CGMCC No.4298.Bacterial strain is after pcr amplification, and 18S rRNA portion gene, ITS1 zone, 5.8S rRNA, ITS2,28S rRNA portion gene sequence are HM566199 in nucleic acid database GenBank (NCBI) (http://www.ncbi.nlm.nih.gov/) accession number.
Above-mentioned bacterial strains Z3, through identifying, has following biological property:
(1) morphological specificity of bacterial strain: unicellular cylindrical, the arthrospore size is 6-12 μ m * 3-6 μ m, and bacterium colony is planar diffusion, and growth is fast, flat, umbo, white, short flannel shape, the liquid culture muddiness, throw out is loose, and modes of reproduction is fragmentation, and the arthrospore of formation is single or connect chaining.
(2) physiological and biochemical property of bacterial strain: this bacterial strain is well-grown under 25～35 ℃ of conditions, is easy to cultivate under normal temperature, and its optimum growth temperature is 28 ℃.In pH2～9, all can grow, optimal pH is 2.5～6, and when pH>7, growth is under some influence, and when pH<2.5, growth is subject to larger inhibition.Test is found to reach at 2.0 o'clock at the later stage pH of the dirty bioleaching of pig manure excrement, still bacterial strain Z3 can be detected, illustrates that it is very strong to the tolerance of sour environment.Bacterial strain Z3 can glucose fermentation, fructose and nonfermented lactose, and faint fermentation sucrose, can assimilate KNO
3(NH
4)
2sO
4, can not utilize inositol, Virahol as sole carbon source, do not form the kind of starch compound.
(3) the molecular biosciences qualification result of bacterial strain: the 18S rRNA portion gene of bacterial strain Z3, ITS1 zone, 5.8S rRNA, ITS2,28S rRNA portion gene is measured 325 base pairs altogether, in nucleic acid database GenBank (NCBI) (http://www.ncbi.nlm.nih.gov/) accession number, is HM566199.The sequence of 18S rRNA-ITS1-5.8S rRNA-ITS2-28S rRNA is as follows:
gggcttgcat?ttcagtattt?gtgatttacc?acagcaaaca?aaaatcatac?aatcaaaaca?aaaataattaaaacttttaa?caatggatct?cttggttctc?gtatcgatga?agaacgcagc?gaaacgcgat?atttcttgtgaattgcagaa?gtgaatcatc?agtttttgaa?cgcacattgc?actttggggt?atcccccaaa?gtatacttgtttgagcgttg?tttctctctt?ggaattgctt?tgctcttcta?aaatttcgaa?tcaaattcgt?ttgaaaaacaacactattca?acctcagatc?aagtaggatt?acccgctgaa?cttaa
Bacterial strain Z3 and Galactomyces geotrichum strain YF01f similarity are the highest, and homology reaches 99.69%, therefore, is accredited as Galactomyces sp.Z3, in conjunction with physiological and biochemical property, it is classified as to Geotrichum.
Beneficial effect
This bacterial strain is compared and is had obvious advantage with existing similar bacterial strain:
In dirty and sludge bioleaching system, can tolerate the sour environment of pH2 at the pig manure excrement, the fine growth of energy when pH2.5 therefore, can keep more permanent vigor and not need frequent interpolation in bioleaching.
This bacterium can utilize dissolved organic matter (DOM) in the dirt of pig manure excrement and sludge bioleaching system fast, reduces the murder by poisoning of DOM to thiobacillus.
This bacterium, when utilizing DOM or small molecular organic acid, can produce rapidly the solvability CO of higher concentration
2, greatly promote with CO
2growth of thiobacillus for carbon source.
Therefore, in the dirt of pig manure excrement and sludge bioleaching, inoculation Galactomyces sp.Z3 can make the dirt of pig manure excrement and sludge bioleaching time shorten, and the leaching ability of heavy metal rate improves, and the rear pig manure excrement of processing is dirty and dewatering performance of sludge is significantly improved.
Four, embodiment
Below narrate embodiments of the invention.
1, the separation of bacterial strain Z3 and enlarged culturing
Preparation PDA substratum, composition: potato 200g, sucrose or glucose 20g, water 1000mL, pH nature, 121 ℃, 30min sterilizing.Sample for separating of the acid resistance heterotrophic bacterium is taken from the acidifying pig manure excrement dirty (the pH value is 2.0 left and right) after the dirty bioleaching of the pig manure excrement before completed is processed.Get acidifying pig manure excrement soiling solution one ring with transfering loop, on the PDA flat board, line separates, and has the flat board of the dirty suspension of acidifying pig manure excrement to be inverted under 28 ℃ above-mentioned inoculation and cultivates 3～4d, to growing bacterium colony.On the PDA flat board, separate growth preferably representational single bacterium colony do the coating microscopy, if having impurely, further this bacterium colony of picking is rule repeatedly, until obtain the pure bacterium of purpose bacterial strain, and shifts inclined-plane and saves backup.The liquid culture condition: get the Z3 lawn from inclined-plane, be inoculated in the PDA liquid nutrient medium, 28-30 ℃, cultivate 2 days in the reciprocating shaking table of 180rpm, and the bacterium number reaches 10
7individual/mL.Morphologic observation and microscope inspection discovery, this bacterial strain is unicellular cylindrical, and the arthrospore size is 6-12 μ m * 3-6 μ m.Bacterium colony is planar diffusion, and growth is fast, flat, umbo, and white, the short flannel shape, the liquid culture muddiness, throw out is loose, and modes of reproduction is fragmentation, and the arthrospore of formation is single or connect chaining.Bacterial strain further is defined as the Geotrichum bacterial strain, called after Galactomyces sp.Z3 after Physiology and biochemistry evaluation and molecular biology identification.
2, the pH of Z3 the most suitable growth measures
The PDA liquid nutrient medium of certain volume is sub-packed in a series of 150mL triangular flasks according to every bottle of 50mL.Use 4N H
2sO
4medium's PH Value is adjusted to respectively to 1.5,2.0,2.5,3.0, and 10 gradients of 4.0,5.0,6.0,7.0,8.0 and 8.5, subsequently in 121 ℃ of lower sterilizing 15min.Get respectively after cooling a ring Galactomyces sp.Z3 inclined-plane lawn and be inoculated in above-mentioned substratum, being placed in rotating speed is 28 ℃ of constant temperature culture 48h of 180r/min shaking table.With nutrient solution, the light absorption value (OD) at the 600nm place characterizes in its growth, and each pH processes and all establishes 3 repetitions, the results are shown in Table 1.
Table 1Galactomyces sp.Z3 upgrowth situation in different pH substratum
Result shows, Galactomyces sp.Z3 can tolerate the extreme acid condition of pH2.0, still has a small amount of growth under this environment.When pH reaches 2.5, the just fine growth of energy of this bacterium, but be greater than at 7.0 o'clock to pH, grow influenced.
3, the utilization of Galactomyces sp.Z3 to the dirty DOM of pig manure excrement
Get the dirt of 150mL pig manure excrement and municipal sludge DOM solution (regulating in advance pH is 5) and be put in respectively in different triangular flasks, after high-temperature heat sterilization, cooling, each triangular flask is inoculated respectively Galactomyces sp.Z3 lawn one ring, under 28 ℃, cultivates 48h.And the control treatment of not inoculating Galactomyces sp.Z3 is set separately, other conditionally completes are identical.Measure and cultivate front and back DOM change in concentration with the TOC instrument, the results are shown in Table 2.
The utilization ratio of table 2Galactomyces sp.Z3 to the dirt of pig manure excrement and mud DOM
Result shows, Z3 reaches 59% to the utilization ratio of DOM in pig manure in 48h, and control treatment is only 0.3%, the utilization ratio of DOM in mud is reached to 86%, and control treatment is only 3.2%.Illustrate that Z3 can decompose it rapidly by utilizing DOM, thereby reduced the murder by poisoning of DOM to thiobacillus.Meanwhile, Z3 may produce a large amount of CO when utilizing DOM
2, therefore may promote with CO again
2growth for the thiobacillus of carbon source.
4, the action effect of Z3 in the dirt of pig manure excrement and municipal sludge bioleaching
Thiobacillus Thiobacillus sp., be mainly bacterial strain Thiobacillus thiooxidans TS6 (CGMCC NO.0759) and the Thiobacillus ferrooxidans LX5 (CGMCC No.0727) that separate in this laboratory.(its formula is shown in the patent of this seminar application: number of patent application 201010221264.1) to add the dirty 20L of pig manure excrement that water ratio is 96% and the microorganism composite nutrient of 4g/L in the bio-reactor (patent No. ZL200520072316.8) of this seminar invention, and inoculate 10% composite sulfur bacillus bacterium liquid, under 28 ℃, tame cultivation, be about at 3 o'clock to sludge pH and formally start to be tested.Now, adopt continuously feeding, the continuous pulp discharge mode is processed, pump into new pig manure excrement dirt, and simultaneously by the 5% disposable inoculation Z3 liquid fermenting bacterium liquid of processing the dirty weight of pig manure excrement in one day (no longer adding) later, the dirty residence time of excrement (SRT) is 2 days, after steady running 1 week, gather the bioleaching of discharging and process the excrement dirt, measure heavy metal (Cu, Zn) solubility rate and its dewatering in the excrement dirt, do the control treatment that does not add Z3 simultaneously, the dirty dewatering of excrement adopts mensuration resistivity (γ) to weigh, and than the more difficult more greatly dehydration of resistance, measurement result is in Table 3.Adopt above-mentioned same method, change the dirt of pig manure excrement into municipal sludge, in the situation that add and do not add Z3, carry out bioleaching, measurement result is in Table 4.
Table 3 is in the situation that inoculate and do not inoculate the dirty bioleaching treatment effect of Z3 pig manure excrement
Table 4 is in the situation that inoculate and do not inoculate Z3 municipal sludge bioleaching treatment effect
Result shows, under the residence time bioleaching condition that is 2 days, inoculation Z3 treatment effect will improve many, is mainly manifested in the leaching ability of heavy metal rate and processes highly than not inoculating, and the leaching ability of heavy metal rate on average reaches more than 90%, and resistivity also has significantly decline.With the bioleaching pig manure excrement that does not add Z3 is dirty, with mud, compare, the dirt of bioleaching pig manure excrement and the dehydration property of inoculation Z3 bacterial strain improve respectively 48% and 80%.Clearly, this bacterium has the effect of effective raising bioleaching.
Claims (4)
1. a strain is applied to the acid resistance heterotrophic bacterium Z3 of mud and the processing of livestock and poultry feces bioleaching, name Geotrichum Z3 (Galactomyces geotrichum Z3), on November 5th, 2010 is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center, and deposit number is CGMCC No.4298.
2. according to claim 1ly be applied to the acid resistance heterotrophic bacterium Z3 that mud and livestock and poultry feces bioleaching are processed, it is characterized in that described Geotrichum Z3 can be in the extreme acid condition of pH2.5 normal growth, optimal pH is 2.5-6.
3. according to claim 1ly be applied to the acid resistance heterotrophic bacterium Z3 that mud and livestock and poultry feces bioleaching are processed, it is characterized in that described Geotrichum Z3 bacterial strain is after pcr amplification, the GenBank accession number of 18S rRNA portion gene, ITS1 zone, 58S rRNA, ITS2,28S rRNA portion gene sequence is HM566199, and its sequence is:
gggcttgcat?ttcagtattt?gtgatttacc?acagcaaaca?aaaatcatac?aatcaaaaca?aaaataatta
aaacttttaa?caatggatct?cttggttctc?gtatcgatga?agaacgcagc?gaaacgcgat?atttcttgtg
aattgcagaa?gtgaatcatc?agtttttgaa?cgcacattgc?actttggggt?atcccccaaa?gtatacttgt
ttgagcgttg?tttctctctt?ggaattgctt?tgctcttcta?aaatttcgaa?tcaaattcgt?ttgaaaaaca
acactattca?acctcagatc?aagtaggatt?acccgctgaa?cttaa?。
4. according to claim 1ly be applied to the acid resistance heterotrophic bacterium Z3 that mud and livestock and poultry feces bioleaching are processed, it is characterized in that described Geotrichum Z3 is seeded in reaction in livestock and poultry feces and sludge bioleaching system and within 2 days, can makes their dehydration property improve respectively 48% and 80%, the leaching ability of heavy metal rate is brought up to more than 90%.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110158682 CN102250776B (en) | 2011-06-14 | 2011-06-14 | Acid-resistance heterotrophic bacterium strain Z3 used for bioleaching treatment of sludge and livestock and poultry manure |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110158682 CN102250776B (en) | 2011-06-14 | 2011-06-14 | Acid-resistance heterotrophic bacterium strain Z3 used for bioleaching treatment of sludge and livestock and poultry manure |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102250776A CN102250776A (en) | 2011-11-23 |
| CN102250776B true CN102250776B (en) | 2013-07-24 |
Family
ID=44978348
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110158682 Active CN102250776B (en) | 2011-06-14 | 2011-06-14 | Acid-resistance heterotrophic bacterium strain Z3 used for bioleaching treatment of sludge and livestock and poultry manure |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102250776B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9328007B2 (en) * | 2014-02-27 | 2016-05-03 | Hong Kong Baptist University | Biogenic flocculant composition to enhance flocculation and dewaterability of chemically enhanced primary treatment sludge |
| CN103936246B (en) * | 2014-03-27 | 2016-04-13 | 南京农业大学 | A kind of sludge bioleaching method nurses one's health the method for deep dehydration fast |
| CN104496140B (en) * | 2014-11-11 | 2017-01-11 | 北京中科国通环保工程技术有限公司 | Municipal sludge bioleaching method |
| CN104743761B (en) * | 2015-03-12 | 2017-03-22 | 交通运输部天津水运工程科学研究所 | Method for alleviating density of float sludge of silt port by using heterotrophic bacteria microorganisms |
| CN111876339B (en) * | 2020-09-15 | 2022-06-10 | 深圳大学 | Heavy metal tolerant yeast and application thereof |
| CN115490407A (en) * | 2022-09-13 | 2022-12-20 | 浙江科技学院 | Large-scale dairy farm excrement treatment method |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101838612A (en) * | 2009-03-06 | 2010-09-22 | 青海大学 | New geotrichum and application thereof in degradation of single-cell seaweed polysaccharide |
-
2011
- 2011-06-14 CN CN 201110158682 patent/CN102250776B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101838612A (en) * | 2009-03-06 | 2010-09-22 | 青海大学 | New geotrichum and application thereof in degradation of single-cell seaweed polysaccharide |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102250776A (en) | 2011-11-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Lee et al. | Microbial flocculation, a potentially low-cost harvesting technique for marine microalgae for the production of biodiesel | |
| CN102250776B (en) | Acid-resistance heterotrophic bacterium strain Z3 used for bioleaching treatment of sludge and livestock and poultry manure | |
| CN104673715B (en) | There is fixed effect to cadmium and enterobacteria and its application of plant growth can be promoted | |
| CN109234167B (en) | Chlorella and application thereof in biogas slurry purification | |
| CN102766579A (en) | Yeast strain for generating surfactant and application thereof | |
| EP3800243B1 (en) | Bacterium degrading las and n and use thereof | |
| Wang et al. | Degradation of slime extracellular polymeric substances and inhibited sludge flocs destruction contribute to sludge dewaterability enhancement during fungal treatment of sludge using filamentous fungus Mucor sp. GY-1 | |
| CN103074277A (en) | Denitrifying bacterium and application thereof | |
| CN114703095B (en) | Pseudomonas adulthood and application thereof in field of sewage and wastewater purification | |
| CN102703351A (en) | Bacillus sp. UTM03 and application thereof | |
| CN104726366A (en) | Denitrifying phosphorus accumulation organism (DPAO) with function of efficiently removing nitrogen and phosphorus and application of DPAO | |
| CN105331552A (en) | Efficient denitrification novel Acinetobacter and application thereof | |
| CN109337825B (en) | Paecilomyces beijing strain LYZ7 and application thereof | |
| CN105154349B (en) | A kind of heterotrophic nitrification Facultative Halophiles and its application | |
| CN115386520B (en) | Rhodococcus pyridine-philic RL-GZ01 strain and application thereof | |
| CN111454861A (en) | Bacillus amyloliquefaciens for efficiently purifying sewage, microbial agent and application | |
| CN106591173A (en) | Bacillus flexus HL-37 capable of activating soil heavy metal cadmium, and applications thereof | |
| CN107794238B (en) | BFX-01 strain for high yield of biological flocculant and biological flocculant obtained thereby | |
| CN102766580A (en) | Yeast strain for producing biosurfactant and application thereof | |
| CN105039225A (en) | Aerobic denitrifying bacterium strain and application thereof | |
| CN102250779B (en) | Acid resistant heterotrophic bacterium D13 applied in bioleaching of municipal sludge | |
| CN101942407B (en) | Producing strain and production method for producing microbial flocculant from wheat starch waste water | |
| CN108102943A (en) | A kind of efficient denitrification microorganism and its application | |
| CN107164280A (en) | One plant of vomitoxin degradation bacteria and its application | |
| CN109251866B (en) | Chlamydomonas strain and application thereof in biogas slurry purification |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| ASS | Succession or assignment of patent right |
Owner name: NANJING BEIKETE ENVIRONMENTAL PROTECTION TECHNOLOG Free format text: FORMER OWNER: NANJING AGRICULTURAL UNIVERSITY Effective date: 20131105 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| COR | Change of bibliographic data |
Free format text: CORRECT: ADDRESS; FROM: 210095 NANJING, JIANGSU PROVINCE TO: 211505 NANJING, JIANGSU PROVINCE |
|
| TR01 | Transfer of patent right |
Effective date of registration: 20131105 Address after: 211505, C11 building, Zhongshan science and Technology Park, Jiangsu, Nanjing Patentee after: NANJING BEIKE ENVIRONMENT PROTECTION TECHNOLOGY CO., LTD. Address before: Nanjing City, Jiangsu Province, No. 1 210095 Weigang Patentee before: Nanjing Agricultural University |