CN115851450A - Cladosporium tenuissima NXY8, mycelial ball and application thereof in high-salt wastewater treatment - Google Patents

Abstract

The invention relates to the technical field of biological wastewater treatment, in particular to Cladosporium exigucum NXY8, mycelial pellets and application thereof in high-salt wastewater treatment. The Cladosporium tenuissima NXY8 provided by the invention is a salt-tolerant bacterium, is preserved in China general microbiological culture collection center with the preservation number of CGMCC No.40141. The Cladosporium exigucum NXY8 can form mycelium pellets with salt resistance, and can be used for the degradation treatment process of organic matters (COD) of salt-containing wastewater with the salinity of 0-10 wt.%; meanwhile, the sedimentation velocity of mycelium pellets formed by the fungi can reach 0.4-2.5 cm/s, which is far higher than that of common activated sludge flocs, the independent structure of the mycelium pellets is easy for solid-liquid separation, and a simple sedimentation or filtration mode can be adopted for separation, thereby reducing the construction of a secondary sedimentation tank.

Description

Cladosporium gracilis NXY8, mycelial ball and application thereof in high-salt wastewater treatment

Technical Field

The invention relates to the technical field of biological wastewater treatment, in particular to Cladosporium exigucum NXY8, mycelial pellets and application thereof in high-salt wastewater treatment.

Background

The organic wastewater containing salt is commonly used in different industries such as oil refining, mining, textile, chemical industry, pharmacy, food processing and the like. The discharge of salt-containing organic wastewater is also aggravated for reasons such as direct use of seawater in coastal areas for life and production, permeation of seawater into freshwater layers, and the like. The discharge of the waste water can destroy the balance and stability of an ecological system and can also generate corrosion action on equipment such as metal pipelines and the like.

Before the desalting operation of the organic wastewater containing salt is carried out, the organic matters in the organic wastewater need to be treated. The search for a proper salt-containing organic wastewater treatment technology meets the development target of national ecological environment construction. At present, advanced oxidation methods such as electrocatalytic oxidation, fenton oxidation, ozone oxidation and the like are mainly adopted for the wastewater, but the wastewater has the problems of high energy consumption and reagent cost, high equipment investment and the like. The higher-level oxidation method of biological oxidation (including activated sludge method) has the advantages of low cost, easy expansion, low carbon and environmental protection.

However, the sludge of the activated sludge method has the problems of difficult sludge-water separation, secondary sedimentation tank requirement and poor anti-reverse performance in a salt-containing environment.

Disclosure of Invention

In order to solve the problems, the invention provides the Cladosporium tenuissimum NXY8, the mycelial pellets and the application thereof in high-salt wastewater treatment. The cladosporium superfine NXY8 provided by the invention has salt tolerance, can effectively degrade organic matters in salt-containing wastewater, and mycelium pellets of the cladosporium superfine NXY8 can adsorb activated sludge, accelerate sedimentation and reduce construction of a secondary sedimentation tank.

In order to achieve the above purpose, the invention provides the following technical scheme:

the invention provides Cladosporium tenuissimum NXY8 capable of forming balls, wherein the preservation number of the Cladosporium tenuissimum NXY8 is CGMCC No.40141.

The invention also provides a mycelial ball capable of reducing or assisting in reducing COD (chemical oxygen demand) in wastewater, which is obtained by culturing the Cladosporium exigua NXY8.

The invention also provides a preparation method of the mycelium pellet, which comprises the steps of inoculating the spore suspension containing the cladosporium tenuipilum NXY8 into a culture medium, and culturing to obtain the mycelium pellet;

the components of the culture medium comprise: glucose 5-80 g/L and NH ₄ Cl 0.5～8g/L、KH ₂ PO ₄ 0.3～6g/L、MgSO ₄ ·7H ₂ O0.25-4 g/L and NaCl 0-100 g/L.

Preferably, the culture conditions include: the temperature is 15-35 ℃, the time is 40-240 h, and the rotating speed is 100-400 rpm.

Preferably, the volume ratio of the spore suspension to the culture medium is 1:99; the spore suspension has a spore concentration of 10 ⁴ ～10 ⁹ spores/mL.

Preferably, the preparation method of the spore suspension comprises the following steps:

inoculating the Cladosporium exigua NXY8 in the scheme to a PDA culture medium, performing slant culture, and washing spores into sterile physiological saline to obtain the spore suspension.

Preferably, the conditions of the slant culture include: the temperature is 15-35 ℃, and the time is 2-10 days.

The invention also provides application of the N XY8 of the Cladosporium gracilis or the mycelium pellet prepared by the method in reducing or assisting in reducing COD (chemical oxygen demand) in wastewater.

Preferably, the wastewater comprises saline organic wastewater.

Preferably, the waste water comprises one or more of municipal sewage, tuber mustard waste water, fishery pickling waste water, oil and gas field waste water, chemical industry waste water, light industry waste water and prepared simulation waste water.

Has the advantages that:

the invention provides Cladosporium tenuissimum (Cladosporium tenuissimum) NXY8 capable of forming balls, wherein the preservation number of the Cladosporium tenuissimum NXY8 is CGMCC No.40141. The Cladosporium tenuissima NXY8 provided by the invention is a salt-tolerant bacterium, can form mycelium pellets with salt tolerance, and can be used for the organic matter degradation treatment process of salt-containing wastewater with the salinity of 0-10 wt.%; meanwhile, the sedimentation velocity of mycelium pellets formed by the fungi can reach 0.4-2.5 cm/s, which is far higher than that of common activated sludge flocs, and the independent structure of the mycelium pellets can make solid-liquid separation easier, and can adopt a simple sedimentation or filtration mode for separation, thereby reducing the construction of a secondary sedimentation tank.

Furthermore, the Cladosporium exigua NXY8 provided by the invention can be cultured to obtain a large number of mycelium pellets with high biological activity, and the mycelium pellets are added into a wastewater treatment reactor, so that the degradation and adsorption effects can be rapidly exerted.

Furthermore, the mycelium pellet formed by the Cladosporium tenuissimum NXY8 provided by the invention can be used as a carrier to adsorb functional microorganisms or activated sludge to jointly treat salt-containing organic wastewater, and can treat salt-containing organic wastewater with higher organic load compared with the independent action of the mycelium pellet.

Biological preservation Instructions

Cladosporium tenuissimum NXY8, latin name is Cladosporium tenuissimum, and is preserved in China general microbiological culture Collection center at 3.4.2022, with the preservation address of No.3 of Xilu No.1 of Beijing republic of the republic of Japan and the preservation number of CGMCC No.40141.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the embodiments will be briefly described below.

FIG. 1 is the colony morphology of NXY8 strain on medium and its morphological characteristics under microscope;

FIG. 2 is a phylogenetic tree of NXY8 strains;

FIG. 3 is a mycelium pellet morphology prepared in example 2;

FIG. 4 is a mycelium pellet morphology prepared in example 3;

FIG. 5 is a photograph of the mycelium pellet prepared in example 4;

FIG. 6 is a morphology of mycelial pellets prepared in example 5;

FIG. 7 is a mycelium pellet morphology prepared in example 6;

FIG. 8 is a mycelium pellet morphology prepared in example 7;

FIG. 9 is a mycelial pellet morphology prepared in comparative example 1;

FIG. 10 is the mycelium pellet morphology prepared in comparative example 2.

Detailed Description

The invention provides Cladosporium tenuissimum NXY8 capable of forming balls, wherein the preservation number of the Cladosporium tenuissimum NXY8 is CGMCC No.40141.

The spores of the cladosporium tenuipilum NXY8 are in a slender lemon shape, and the spores are all terminal but do not grow laterally.

After the cladosporium tenuipilum NXY8 is cultured on a CMA culture medium, a bacterial colony of the strain is velvet, flat and light green, and is light white and hair-shaped at the later stage; after being cultured on the PDA culture medium, the Cladosporium tenuissimum NXY8 strain colonies appear to be milky white velvet in the light yellow background of the PDA culture medium, wrinkles are formed and radiate from the middle to the edges, and a circle of dark colonies are arranged at the edges.

The cladosporium tenuipilum NXY8 disclosed by the invention can tolerate salinity of 0-10 wt%, and can efficiently reduce the content of organic matters (COD) in salt-containing wastewater aiming at the salt-containing wastewater with different salinity ranges.

In the present invention, the nucleotide sequence of ITS rDNA of cladosporium superfine NXY8 preferably includes the sequence shown in SEQ ID No.1, specifically as follows:

CCGTAGGTGAACCTGCGGAGGGATCATTACAAGTGACCCCGGTCTAACCACCGGGATGTTCATAACCCTTTGTTGTCCGACTCTGTTGCCTCCGGGGCGACCCTGCCTTCGGGCGGGGGCTCCGGGTGGACACTTCAAACTCTTGCGTAACTTTGCAGTCTGAGTAAACTTAATTAATAAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCAACGCGGTCCGCCGCGTGCCTCAAATCGACCGGCTGGGTCTTCTGTCCCCTAAGCGTTGTGGAAACTATTCGCTAAAGGGTGCTCGGGAGGCTACGCCGTAAAACAAACCCATTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA。

the Cladosporium tenuissima NXY8 disclosed by the invention has the characteristic of balling, has a better separation effect during mud-water separation, is short in required settling time, can save the separation time, correspondingly improves the reaction time and the organic load of water inflow, and improves the treatment efficiency; meanwhile, the construction of the secondary sedimentation tank can be reduced, the separation can be simple, and the method is suitable for removing or assisting in removing pollutants in the wastewater, particularly for removing or assisting in removing organic matters in the wastewater, and is particularly suitable for the salt-containing wastewater treatment process.

The invention also provides a mycelial ball capable of reducing or assisting in reducing COD (chemical oxygen demand) in wastewater, which is obtained by culturing the Cladosporium tenuissimum NXY8 in the scheme.

The mycelium pellet is spherical, ellipsoidal, club-shaped or radial spherical, is white or green with different depths, and has a diameter of 100-5000 microns; the sedimentation velocity of the mycelium pellet is 0.4-2.5 cm/s.

The mycelium pellet has the characteristics of easiness in solid-liquid separation, high settling speed and strong organic matter degradation and adsorption capacity, can independently adsorb and degrade organic matters in wastewater, has a unit biomass organic matter treatment load of 0.01-2 kg COD/(kg MLSS. D), or can adsorb organic matters in the wastewater together with activated sludge to degrade the organic matters in the wastewater, has a unit biomass organic matter treatment load of 0.01-4 kg COD/(kg MLSS. D), solves the problem that a secondary sedimentation tank is required for sludge-water separation by an activated sludge method, can reduce the construction of the secondary sedimentation tank, solves the problems of floating and disintegration of the activated sludge in a high-salt environment, and has obvious application potential in the field of salt-containing wastewater treatment.

The invention also provides a preparation method of the mycelium pellet, which comprises the step of inoculating the spore suspension containing the Cladosporium exigucum NXY8 in the scheme into a culture medium, and culturing to obtain the mycelium pellet.

In the present invention, the preparation method of the spore suspension preferably comprises:

1) Marking the Sclerotinia minutissima NXY8 on the inclined plane of a sterile potato glucose agar (PDA) culture medium by using an inoculating loop;

2) Placing the inclined plane scribed in the step 1) in an incubator at 15-35 ℃ for culturing for 2-10 days;

3) Washing the spores on the inclined plane in the step 2) into sterile physiological saline to prepare spore suspension.

In the present invention, the temperature of the culture in step 2) is preferably 25 to 32 ℃, more preferably 30 ℃; the culture time is preferably 2 to 10 days, more preferably 5 to 6 days or 8 to 10 days, and still more preferably 8 days.

After obtaining the spore suspension, the invention inoculates the spore suspension into a culture medium and cultures to obtain the mycelium pellet.

In the present invention, the ratio of the spore suspension to the culture medium is preferably 1:99; the spore concentration of the spore suspension is preferably 10 ⁴ ～10 ⁹ spores/mL, further preferably including 10 ⁴ 、10 ⁵ 、5×10 ⁵ 、10 ⁶ 、2×10 ⁶ 、10 ⁷ 、10 ⁸ 、10 ⁹ spores/mL, more preferably 10 ⁶ spores/mL. The invention can cultivate mycelium pellets with moderate volume, complete structure and high settling speed by proper inoculation amount.

The culture medium comprises 5-80 g/L glucose, preferably 10-50 g/L glucose, more preferably 15-20 g/L glucose, and even more preferably 15g/L glucose. In the present invention, the glucose preferably includes anhydrous glucose.

The medium of the invention comprises NH ₄ Cl is 0.5 to 8g/L, preferably 0.7 to 5g/L, more preferably 0.8 to 4g/L, and still more preferably 1.5g/L.

The culture medium comprises KH ₂ PO ₄ 0.3 to 6g/L, preferably 0.5 to 2g/L, more preferably 0.6 to 1g/L, and still more preferably 0.9g/L.

The culture medium bag of the inventionComprise MgSO ₄ ·7H ₂ O is 0.25 to 4g/L, preferably 0.4 to 2g/L, more preferably 0.6 to 1g/L, and still more preferably 0.7g/L.

The culture medium comprises 0-100 g/L of NaCl; the concentration of NaCl in the culture medium is preferably determined according to the salinity of the wastewater to be treated, and the method specifically comprises the following steps: the pre-percent value of the salinity of the wastewater to be treated is marked as A, for example, when the salinity is 10%, A is 10, and the concentration of NaCl in the culture medium = A x 10g/L; wherein when A is less than 1, naCl may not be added to the medium. According to the invention, the concentration of NaCl in the culture medium is determined according to the salinity of the wastewater to be treated, so that the mycelium pellet obtained by culture can directly play a role in degrading and adsorbing organic matters in the saline wastewater, an adaptive domestication process is not required, and the debugging time of a biochemical process is shortened.

In the present invention, the culturing preferably includes constant temperature culturing; the temperature of the culture is preferably 15 to 35 ℃, preferably 20 to 32 ℃, and more preferably 28 ℃; the culture time is preferably 40 to 240 hours, more preferably 50 to 120 hours or 144 to 192 hours, and more preferably 112 hours; the rotation speed of the culture is preferably 100 to 400rpm, more preferably 100 to 150rpm, or 160 to 190rpm, and still more preferably 180rpm.

The invention also provides application of the N XY8 of the Cladosporium gracilis or the mycelium pellet prepared by the method in reducing or assisting in reducing COD (chemical oxygen demand) in wastewater.

In the present invention, the wastewater preferably comprises salt-containing organic wastewater, and more preferably is high-salt wastewater; the salt-containing organic wastewater preferably comprises one or more of municipal sewage, tuber mustard wastewater, fishery pickling wastewater, oil-gas field wastewater, chemical industry wastewater, light industry wastewater and prepared simulation wastewater.

In the invention, the mycelium pellets are preferably used as a carrier for adsorbing activated sludge or other functional microorganisms and degrading organic matters in liquid, particularly organic matters in salt-containing wastewater.

In order to further illustrate the present invention, the Cladosporium gracilis NXY8, mycelial pellets and their use in high-salt wastewater treatment provided by the present invention are described in detail below with reference to examples, which should not be construed as limiting the scope of the present invention.

The settling rate of the following examples or comparative examples was determined as follows: and (3) filling the sodium chloride solution into a 1000mL measuring cylinder, randomly taking 30 mycelium pellets, taking one mycelium pellet each time, releasing at a non-initial speed from the top of the liquid surface, recording the time of the mycelium pellets settling to the bottom of the measuring cylinder, calculating the settling speed, and averaging to obtain the average settling speed of the mycelium pellets in the sodium chloride solution.

Example 1

Separation and identification of Cladosporium tenuissimum (Cladosporium tenuissimum) NXY8

The acremonium tenuissima NXY8 is obtained by separation in seaside soil in Fengxian areas of Shanghai city. The method comprises the following specific steps:

preparing high-salt liquid culture medium (containing glucose 20g/L and NH) ₄ Cl 1g/L、KH ₂ PO ₄ 1g/L、MgSO ₄ ·7H ₂ 0.8g/L of O, 1g/L of yeast powder and 50g/L of NaCl). Breaking soil, shaking with clear water, leaching, filtering with single layer gauze, adding 10mL of leaching solution into 100mL of high salt liquid culture medium, enriching and culturing for 1 day, transferring 10mL of leaching solution to 100mL of new high salt liquid culture medium, and repeatedly enriching for 5 times, each time for 2 days.

Adding agar (the mass-to-volume ratio of the agar to the high-salt liquid medium is 20g to 1L) into a high-salt liquid medium, and preparing a high-salt glucose agar plate after sterilization; dipping bacterial liquid in the high-salt liquid culture medium after enrichment for 5 times, carrying out streak separation on a high-salt glucose agar plate, and carrying out purification for multiple times to obtain a fungus strain with the number of NXY8. Then washing spores to dilute and coat to obtain single fungus colonies.

The single fungus colony is respectively inoculated on a Corn Meal Agar (CMA) culture medium and a Potato Dextrose Agar (PDA) culture medium and is cultured in an incubator at 30 ℃ for 10 days, the culture results are shown in figure 1, wherein, A to C are the results of the culture of the strains in the CMA culture medium, D to F are the results of the culture of the strains in the PDA culture medium, A and D are the front sides of the culture medium, B and E are the back sides of the culture medium, and C and F are the slide photos under a microscope.

After being cultured on a CMA culture medium, the bacterial colony is in a velvet shape, a flat spread, a light green color and a light white and hair shape in the later period. After being cultured on PDA culture medium, the bacterial colony appears milk white velvet in the light yellow background of PDA culture medium, and has wrinkles radiating from the middle to the edge, and a circle of bacterial colonies with dark color are arranged at the edge.

The structure of the NXY8 strain under the microscope is shown in FIGS. 1C and F. The spores are in the shape of slender lemon, and all the spores are apical without lateral growth.

Extracting genomic DNA of the NXY8 strain by using a fungal genomic DNA extraction kit, and performing PCR amplification by using fungal universal primers ITS1 (5 'TCCGTAGGTGAACCTGCGG-3', SEQ ID NO. 2) and ITS4 (5 'TCCTCCGCTTATTGATATGC-3', SEQ ID NO. 3) as templates for IT S rDNA amplification. PCR reaction (20. Mu.L): 10 XBuffer 2. Mu.L, dNTP Mix (2.5 mM) 1.6. Mu.L, ITS1 and ITS4 each 0.8. Mu.L, DNA template 0.5. Mu.L, taq enzyme (5U/. Mu.L) 0.2. Mu.L and sterile water 14.1. Mu.L. PCR reaction procedure: pre-denaturation at 95 ℃ for 5min; denaturation at 95 ℃ for 30s, annealing at 55 ℃ for 30s, extension at 72 ℃ for 40s, and 35 cycles; stretching for 10min at 72 ℃.

The PCR product obtained by amplification was recovered by 1% agarose electrophoresis, and the purification and sequencing by Beijing Liuhe Dageno science and technology Co. The ITS rDNA sequencing result of the NXY8 strain is shown in SEQ ID NO. 1. The obtained sequence was subjected to homology comparison analysis with the GenBank DNA sequence database of NCBI, and it was revealed that the obtained strain had high homology with the sequence of Cladosporium tenuissimum isolate 42 (MK 311278.1). The phylogenetic tree was constructed by the Neighbor-Joining method (Neighbor-Joining), as shown in FIG. 2. The strain is Cladosporium tenuissimum and named as Cladosporium tenuissimum NXY8 according to colony and spore morphology, homology comparison and phylogenetic analysis. The strain is preserved in China general microbiological culture Collection center (CGMCC) of China Committee for culture Collection of microorganisms in the sunward area in Beijing at 2022, 3 months and 4 days, and the preservation number is CGMCC No.40141.

Example 2

A mycelium pellet for removing or assisting in removing COD (chemical oxygen demand) in high-salinity wastewater is prepared by the following method:

1) Taking out the glycerol tube storing the N XY8 strain of Acremonium gracilis in example 1 from a refrigerator at the temperature of-80 ℃, and drawing a line in a Z shape on the inclined plane of a sterile PDA culture medium by adopting an inoculating loop; wherein the aseptic PDA culture medium is prepared by adding deionized water to a constant volume of 1L and sterilizing 15g of potato extract powder, 20g of anhydrous glucose and 15g of agar;

2) Placing the inclined plane with the marked line in an incubator at 30 ℃ for 8 days;

3) Washing the spores on the inclined plane into sterile normal saline in a super clean bench to prepare a spore suspension, and counting the number of spores in each milliliter of the spore suspension under a microscope by adopting a blood counting method; adjusting the spore concentration of the spore suspension to 10 with sterile physiological saline ⁹ spore/mL;

4) Inoculating 1mL of spore suspension into a shake flask containing 99mL of sterile medium; wherein the sterile culture medium comprises 15g of anhydrous glucose and 1.5g of NH ₄ Cl、0.9g KH ₂ PO ₄ 、0.7g MgSO ₄ ·7H ₂ Adding deionized water into O and 30g of NaCl, fixing the volume to 1L, and sterilizing to obtain the product;

5) And placing the shake flask inoculated with the spore suspension into a shaking table, and culturing at 28 ℃ and 180rpm for 112h at constant temperature to obtain mycelium pellets.

As shown in FIG. 3, the mycelium pellet is spherical and brownish green, and the average diameter can reach 1470 μm. The average sedimentation velocity in the 30g/L NaCl solution can reach 0.74cm/s.

Example 3

A mycelium pellet for removing or assisting in removing COD (chemical oxygen demand) in high-salinity wastewater is prepared by the following method:

steps 1) to 5) are similar to example 2, with the only difference that the spore suspension in step 3) has a spore concentration of 10 ⁸ spores/mL.

As shown in FIG. 4, the mycelium pellet appeared spherical and pale green with an average diameter of 1778 μm. The average sedimentation velocity in the 30g/L NaCl solution can reach 0.87cm/s.

Example 4

A mycelium pellet for removing or assisting in removing COD (chemical oxygen demand) in high-salinity wastewater is prepared by the following method:

step 1) 5) similar to example 2, the only difference being that the spore suspension in step 3) has a spore concentration of 10 ⁷ spores/mL.

As shown in FIG. 5, the mycelium pellet appeared spherical and light yellow with an average diameter of 2924 μm. The average sedimentation velocity in the 30g/L NaCl solution can reach 1.36cm/s.

Example 5

A mycelium pellet for removing or assisting in removing COD (chemical oxygen demand) in high-salinity wastewater is prepared by the following method:

steps 1) to 5) are similar to example 2, with the only difference that the spore suspension in step 3) has a spore concentration of 10 ⁶ spores/mL.

As shown in FIG. 6, the mycelium pellet is spherical and white, and the average diameter can reach 2696 μm. The average sedimentation velocity in the 30g/L NaCl solution can reach 1.19cm/s.

Example 6

A mycelium pellet for removing or assisting in removing COD (chemical oxygen demand) in high-salinity wastewater is prepared by the following method:

steps 1) to 5) are similar to example 5, with the only difference that the sterile medium in step 4) consists of 15g of anhydrous glucose, 1.5g of NH ₄ Cl、0.9g KH ₂ PO ₄ 、0.7g MgSO ₄ ·7H ₂ Adding deionized water into O and 100g NaCl, fixing the volume to 1L, and sterilizing to obtain the product.

As shown in FIG. 7, the mycelium pellet is spherical and white, and the average diameter can reach 2854 μm. The average sedimentation velocity in 100g/LNaCl solution can reach 1.05cm/s.

Example 7

A mycelium pellet for removing or assisting in removing COD (chemical oxygen demand) in high-salinity wastewater is prepared by the following method:

steps 1) to 5) are similar to example 5, with the only difference that the sterile medium in step 4) consists of 15g of anhydrous glucose, 1.5g of NH ₄ Cl、0.9g KH ₂ PO ₄ And 0.7g MgSO ₄ ·7H ₂ Adding deionized water to a constant volume of 1L, and sterilizing to obtain the product.

As shown in FIG. 8, the mycelium pellet is spherical and dark green, and the average diameter can reach 2590 μm. The average sedimentation velocity in 0g/LNaCl solution can reach 1.42cm/s.

Comparative example 1

A method for culturing fungus comprises the following steps:

steps 1) to 5) are similar to example 5, with the only difference that the shaker speed in step 5) is 20rpm. Finally, no shaped mycelium pellet could be obtained (see FIG. 9).

Comparative example 2

A method for culturing fungi comprises the following steps:

steps 1) to 5) are similar to example 5, with the only difference that the sterile medium in step 4) consists of 15g of anhydrous glucose, 1.5g of NH ₄ Cl、0.9g KH ₂ PO ₄ 、0.7g MgSO ₄ ·7H ₂ O and 140g NaCl, adding deionized water to a constant volume of 1L, and sterilizing to obtain the product. Eventually, a dense mycelium pellet could not be obtained (see FIG. 10).

Application example 1

The mycelium pellets prepared in example 2 were added to a shake flask (salinity of 3wt.%, COD concentration of 1200 mg/L) containing coal chemical wastewater at an amount of 2g/L, and the shake flask was placed in a shaker at 25 ℃ and 150rpm for 72 hours. The COD removal rate reaches 72 percent.

Application example 2

The mycelium pellets prepared in example 3 were added to coal chemical wastewater (salinity of 3wt.%, COD concentration of 1200 mg/L) at an amount of 2g/L, and the cylindrical reactor (height to diameter ratio of 3) was operated in a batch manner for 6 hours for a period of 50% water exchange ratio, pH of 6.0 to 8.0, temperature of 25 to 30 ℃ and dissolved oxygen concentration of 8 to 10mg/L. The organic load in the system is 2.4kg COD/(m) ³ ·d)。

After 1 day, the removal rate of organic matters can reach 50 percent; after the 5 th day, the removal rate of organic matters reaches 82%, at the moment, the mycelium pellets are used as carriers to adsorb functional microorganisms to jointly treat the salt-containing organic wastewater, and the total biomass reaches 3g/L.

Application example 3

The mycelium pellets prepared in example 4 were added to diluted mustard tuber wastewater (salinity of 3wt.%, COD concentration of 2000 mg/L) in an amount of 3g/L in a sequencing batch mannerThe cylindrical reactor (the height-diameter ratio is 3) is operated for 8 hours for a period, the water exchange ratio is 50 percent, the pH value is maintained between 6.0 and 8.0, the temperature is maintained between 25 and 30 ℃, and the concentration of dissolved oxygen is controlled between 8 and 10mg/L. The organic load in the system is 3kg COD/(m) ³ ·d)。

After 1 day, the removal rate of organic matters can reach 60 percent; after 8 days, the removal rate of organic matters reaches 95%, at the moment, the mycelium pellets are used as carriers to adsorb functional microorganisms to jointly treat the salt-containing organic wastewater, and the total biomass reaches 4.3g/L.

Application example 4

The mycelium pellets prepared in example 5 were added to pickling wastewater (salinity of 3wt.%, COD concentration of 2200 mg/L) at 3g/L, and the cylindrical reactor (height to diameter ratio of 3) was operated in a batch manner for 8 hours for a period of 50% water change ratio, pH of 6.0 to 8.0, temperature of 25 to 30 ℃, and dissolved oxygen concentration of 8 to 10mg/L. The organic load in the system is 3.3kg COD/(m) ³ ·d)。

After 1 day, the removal rate of organic matters can reach 40 percent; after 7 days, the removal rate of organic matters reaches 85%, at the moment, the mycelium pellets are used as carriers to adsorb functional microorganisms to jointly treat the salt-containing organic wastewater, and the total biomass reaches 3.8g/L.

Application example 5

The mycelium pellets prepared in example 6 were added to tuber mustard wastewater (salinity of 10wt.%, COD concentration of 4500 mg/L), the dosage was 4g/L, the cylindrical reactor (height to diameter ratio 3) was operated in a sequencing batch mode, the water change ratio was 50%, the pH was maintained at 6.0 to 8.0, the temperature was maintained at 25 to 30 ℃, and the dissolved oxygen concentration was controlled at 8 to 10mg/L for 18 hours for one cycle. The organic load in the system is 6kg COD/(m) ³ ·d)。

After 1 day, the removal rate of organic matters can reach 30 percent; on day 8, the removal rate of organic matter was gradually increased to 75%; at the 15 th day, the removal rate of organic matters is stabilized at 80%, and at the moment, the mycelium pellets are used as carriers to adsorb functional microorganisms to jointly treat the salt-containing organic wastewater, so that the total biomass reaches 5.5g/L.

Application example 6

The mycelial pellets prepared in example 7 were added to industrial park wastewater (salinity of 0.5wt.%, COD concentration of 800 mg/L) and dosedThe adding amount is 2g/L, a cylindrical reactor (the height-diameter ratio is 3) is operated in a sequencing batch mode, the water exchange ratio is 50 percent, the pH value is maintained at 6.0-8.0, the temperature is maintained at 25-30 ℃, and the dissolved oxygen concentration is controlled at 8-10 mg/L in one period of 6 h. The organic load in the system is 1.6kg COD/(m) ³ ·d)。

After 1 day, the removal rate of organic matters can reach 38 percent; on day 6, the removal rate of organic matter was gradually increased to 70%; at the 15 th day, the removal rate of organic matters is stabilized at 85%, at the moment, the mycelium pellets are used as carriers to adsorb functional microorganisms to jointly treat the salt-containing organic wastewater, and the total biomass reaches 3.5g/L.

In conclusion, the Cladosporium tenuissima NXY8 provided by the invention can be used for the treatment process of salt-containing wastewater, not only can effectively remove organic matters in the salt-containing wastewater, but also can adsorb functional microorganisms, and the construction of a secondary sedimentation tank is reduced.

Although the present invention has been described in detail with reference to the above embodiments, it is only a part of the embodiments of the present invention, not all of the embodiments, and other embodiments can be obtained without inventive step according to the embodiments, and the embodiments are within the scope of the present invention.

Claims (10)

1. A Cladosporium tenuissimum NXY8 strain capable of forming balls is characterized in that the preservation number of the Cladosporium tenuissimum NXY8 is CGMCC No.40141.

2. A mycelial pellet capable of reducing or assisting in reducing COD in wastewater, wherein the mycelial pellet is obtained by culturing Cladosporium tenuissimum NXY8 according to claim 1.

3. The method for producing a mycelial sphere according to claim 2, wherein a spore suspension containing the N XY8 Cladosporium ultimum of claim 1 is inoculated into a culture medium and cultured to obtain the mycelial sphere;

the components of the culture medium comprise: glucose 5-80 g/L and NH ₄ Cl 0.5～8g/L、KH ₂ PO ₄ 0.3～6g/L、MgSO ₄ ·7H ₂ O0.25-4 g/L and NaCl 0-100g/L。

4. The method according to claim 3, wherein the culture conditions include: the temperature is 15-35 ℃, the time is 40-240 h, and the rotating speed is 100-400 rpm.

5. The method according to claim 3 or 4, wherein the ratio of the spore suspension to the culture medium is 1:99; the spore suspension has a spore concentration of 10 ⁴ ～10 ⁹ spores/mL.

6. The method for preparing according to claim 3 or 4, wherein the method for preparing the spore suspension comprises:

inoculating the Cladosporium exigua NXY8 to a PDA culture medium, performing slant culture, and washing spores in sterile physiological saline to obtain the spore suspension.

7. The method of claim 6, wherein the conditions of the slant culture comprise: the temperature is 15-35 ℃, and the time is 2-10 days.

8. Use of a mycelial sphere according to claim 1, or claim 2, or prepared by a method according to any one of claims 3 to 7, in reducing or assisting in reducing COD in wastewater.

9. Use according to claim 8, wherein the waste water comprises salt-containing organic waste water.

10. Use according to claim 8 or 9, wherein the waste water comprises one or more of municipal sewage, tuber mustard waste water, fishery pickling waste water, oil and gas field waste water, chemical industry waste water, light industry waste water and formulated simulation waste water.

Images