CN104531764A - Method for cultivating salt-tolerant rice by using pollen-tube pathway transformation technology - Google Patents
Method for cultivating salt-tolerant rice by using pollen-tube pathway transformation technology Download PDFInfo
- Publication number
- CN104531764A CN104531764A CN201410743591.1A CN201410743591A CN104531764A CN 104531764 A CN104531764 A CN 104531764A CN 201410743591 A CN201410743591 A CN 201410743591A CN 104531764 A CN104531764 A CN 104531764A
- Authority
- CN
- China
- Prior art keywords
- salt
- seed
- rice
- dna
- carry out
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The present invention discloses a method for cultivating salt-tolerant rice by using a pollen-tube pathway transformation technology. The method comprises: (1) extracting bulrush leaf DNA; (2) transforming the exogenous DNA into acceptor rice; (3) carrying out pot screening at a germination period; (4) carrying out artificial salt pond screening and big field breeding; and (5) planting the stable strain in the salt marsh field. According to the present invention, the pollen-tube pathway technology is utilized to transfer the total DNA of the halophyte into the ordinary rice, such that the transferring of the super-distant genetic material is achieved, the tissue culture process is eliminated, a variety of unpredictable adverse effects possibly produced during the plant tissue culture process are avoided, multiple genes can be simultaneously imported, and the molecular breeding of the salt-tolerant plants can be achieved.
Description
Technical field
The present invention relates to a kind of method of cultivating salt tolerant rice, belong to field of plant variety breeding technology, is more particularly a kind of method using pollen tube channel transformation technology to cultivate salt tolerant rice.
Background technology
The salinification of soil is the serious problems affecting Agriculture and ecology environment.19.5 hundred million mu, the total cultivated area of China, the wherein salinification of 20% various degrees and secondary salinization, beach amounts to more than 1.4 hundred million mu.In addition 5.2 hundred million mu of inland salinized soils, wherein 1.5 hundred million mu, saltings is also had.People once attempted by rational irrigation and drainage, fresh water washing, used the modes such as chemical improvement agent with carrying out transformation salinity, but normal because of costly, took effect less and were difficult to promote.Excavate so sight is turned to and cultivate salt tolerant crop aspect.Both at home and abroad in cultivation salt tolerant rice new variety, mainly concentrate on two aspects:
One is screen local farmers' rice varieties, tame into the salt-enduring cultivars with economic worth, but because rice varieties has special diversified ecological condition, the feature of adaptability relative narrower, the salt tolerant resource therefore screened could not be utilized effectively mostly in practice, does not more enter varieties in saline-alkali areas and carries out production application, at present, China coast beach and saltings mainly middle-and-low-yielding fields, the salt tolerant rice being applicable to China's plantation is little, and paddy rice per mu yield only has about 200 kilograms.
Two is the development along with Protocols in Molecular Biology, and by biotechnology and cross-breeding, transform and improve the salt tolerance of paddy rice, cultivating New salt-tolerant cultivar becomes focus day by day.More existing importing individual genes improve the report of plant salt endurance at present, as passed through genetic engineering means, vegetable cell is made to produce and accumulate some low-molecular-weight organic compound, if trimethyl-glycine, proline, glycitols etc. are to maintain moisture in osmotic potential balance and body, the salt tolerance of plant can be improved to a certain extent, but be mostly also in the laboratory study stage at present.Outstanding example is the paddy rice that Chen Shouyi etc. proceeds to betaine aldehyde dehydrogenase (BADH) gene, obtain most growth in the salt pond of transformed plant at 0.5%NaCl normal, but setting percentage is only 10% through salt stress screening.Also do not obtain salt tolerant rice crop truly at present, the Mechanisms of Salt Resistance of its reason mainly plant is very complicated, it is a kind of quantitative character, by controlled by multiple genes, therefore shift individual gene and often can only obtain part salt tolerance, obtain the salt tolerant crop with economic worth may need to shift multiple gene simultaneously, and still have very large difficulty in identification with being separated resistant gene of salt and operating in multiple gene simultaneously at present.
Since the fifties in last century, UNESCO proposed the direction of salt-tolerant plant development research, Saline soil agriculture rises gradually as a kind of emerging agricultural Model.In April, 2013, International Rice Research Institute claims, a kind of novel salt tolerant rice has been cultivated by wild seed rice hybridization, can plant in the soil, strand of marine denudation, but be still at present the stage of varieties and characteristics being improved and evaluating, plant experimentally to field and at least also need 4 to 5 years (see Salt-tolerant rice bred atPhilippines institute Apr 16,2013).Japan Chemical institute trial heavy ion cultivates salt tolerant rice, but is yet in the laboratory study stage at present.Separately there is report, the director Chalermpol Kirdmanee2001 of Thailand's country's genetic engineering and biotechnology center vegetable cell technology experiment room has found the Thailand perfume rice of 4 strain ability 2%NaCl in the lab, but never about the follow-up relevant report (see Transcriptional regulations of thegenes of starch metabolism and physiological changes in response tosalt stress rice (Oryza sativa L.) seedlings) of latest developments, within 2005, Shanghai Sheng Ke institute of Chinese Academy of Sciences plant physiological ecology announced: the research of Rice Salt functional gene obtains important breakthrough progress in Shanghai.This institute and US Experts cooperation, the successful clone Quantitative Trait Genes relevant to Rice Salt, but distance practical application needs time.
Summary of the invention
The object of this invention is to provide a kind of method using pollen tube channel transformation technology to cultivate salt tolerant rice, pollen-tube pathway method is used to be shifted by the STb gene of halophytes in the method, realize the transfer of super distant genetic material, multiple gene can be imported simultaneously, reach the object of salt-tolerant plant molecular breeding.
The present invention is a kind of method using pollen tube channel transformation technology to cultivate salt tolerant rice, comprises the following steps:
(1) halophytes Reed Leaf DNA is extracted as donor;
(2) fetch water rice 9311, sea 74, salt 559,7 sea 76,7 as acceptor, select the spike of rice of blooming at full-bloom stage, remove the grain husk flower do not opened and the grain husk flower opened, every fringe only leaves about 20, the grain husk flower just opened the same day; Cut off small ear inner glume after 1.5 ~ 2.0 hours, and the style of 1/3 ~ 1/2 is cut off together with column cap; Instil containing exogenous DNA solution 2 ~ 3 μ L on the style tangent plane just cutting off column cap with microsyringe immediately; Inject time: carry out for after Rice Flowering 1 ~ 3 hour, DNA solution concentration is 250 ~ 300 μ g/ml, and import volume is 10-20 μ l, puts hybridization bag to prevent water evaporates, gathers in the crops D after 25 ~ 30 days
0for seed;
(3) D gathered in the crops
0all sow for seed, through observing, each introgressive line is substantially without making a variation or making a variation not obvious, and the full seed receiving each strain is D respectively
1for seed;
(4) by D
1be divided into two groups for seed, first group, being carry out seed germination and nursery in the plastic tub of 5 ‰ containing salt concentration, is carried out selection of salt tolerance to seed, select and remain healthy and strong seedling replanting to common salt-free land for growing field crops, carry out conventional cultivation, observe variation situation, the normal individual plant sowing of growth of selecting and remain; Second group of seed is then planted and to be germinateed in common paddy field and nursery and whole process grow, and variant of selecting and remain, carries out individual plant sowing; Salt sieve and non-salt are sieved each individual plant sowing of selecting and remain and are called D
2for seed;
(5) by the D of results
2seed is carry out selection of salt tolerance under the condition of 4 ‰ ~ 5 ‰ again in salt pond salinity, not import the acceptor of foreign DNA in contrast, carries out the salt tolerance of paddy growth and the Screening and Identification of yield and quality proterties, the normal individual plant of screening growth, results D
3for seed;
(6) by the D of results
3for seed be carry out selection of salt tolerance under the condition of 4 ‰ ~ 5 ‰ in salt pond salinity, not import the acceptor of foreign DNA in contrast, carry out the salt tolerance of paddy growth and the Screening and Identification of yield and quality proterties, the normal individual plant of screening growth, results D
4for seed;
(7) in salt pond salinity be 5 ‰ condition under carry out many generation screenings, until D
6basicly stable for plant;
(8) simultaneously, cultivate to hybridize with two 8S/ sea No. 4, Hunan C815S and obtain F
1for plant;
(9) by the D of results
6for the seed of strain and the F of acquisition
1in salt is divided into the Yancheng, Jiangsu Province beach of 2 ‰ and 4 ‰, 6 ‰ different gradients saline land, carry out field respectively for single-strain seed to plant experimentally, select salt tolerance high, grow, new variety that output is high or new lines, not import the acceptor of foreign DNA in contrast;
(10) next year, new lines or new variety are carried out in salt is divided into the Yancheng, Jiangsu Province beach of 3 ‰-4 ‰ saline land show in 50 mu " salt tolerant rice yielding Demonstration districts ", not import the acceptor of foreign DNA in contrast, carry out the salt tolerance of paddy growth and the Screening and Identification of yield and quality proterties.
In the present invention, the salt tolerant rice new variety obtained by the method or the new DNA fragmentation of new lines, its encoding sequence is for shown in sequence table 1.
In sum; the method that the present invention uses pollen-tube pathway method to be shifted by the STb gene of halophytes; simple to operate; have without genotype restriction and the feature being easy to realize extensive gene transformation; the transfer of gene can be realized between any flowering plant and different plant species, and eliminate tissue culture procedures, avoid issuable various unpredictable disadvantageous effect in plant tissue culture course; multiple gene can be imported simultaneously, reach the object of salt-tolerant plant molecular breeding.
Beneficial effect of the present invention is:
(1) donor material is new.Planting halophytes germ plasm resource from excavate, collect more than ten and select reed, is the Core Germplasms material cultivating initiative salt tolerant rice; Using halophytes reed STb gene as donor material, be different from clone and separate single salt-resistant related gene transformation receptor plant;
(2) introduction method is new.Although there was people, by pollen tube channel, foreign gene is imported plant in the past, all differed widely with of the present invention with regard to the research purpose intrinsic with regard to it and operational details.The present invention establishes the sequencing introduction method about paddy rice.Carrying out salt tolerant rice breeding by Pollen tube pathway technique reed STb gene is first Application;
(3) new, the successful of screening method.This salt screen method first to plant alite sieve; Seedling is screened to the time of infertility in artificial salt pond; Land for growing field crops seed selection; The success of salt flat field planting, progressively can enter in salt beach Production of Large Fields and apply; General transgenic plant may have certain salt tolerance in laboratory, and just not obvious once enter its salt-tolerance character of large Tanaka;
(4) breeding cycle is short.Obtain stable strain by conventional breeding and generally need 8-10, and only use 3-4 just to stabilize by the rice strain that the method is cultivated;
(5) the salt tolerant rice new lines good salt tolerance utilizing the present invention to be bred as, output are high
Salt tolerant rice new lines 21 in May, 2012 by a collection of stable performance cultivated combines or strain, carry out different gradient salinity 2 ‰, 4 ‰, 6 ‰ (basic, normal, high) at Yancheng, Jiangsu Province Coastal beach and carry out Field trial, have outstanding performance in Hunan 030, sea, extra large Hunan 016, extra large Hunan 121, the conventional breeding that breeding time is more general shortens half.2013, extra large Hunan 030, extra large Hunan 016,121 3, extra large Hunan salt tolerant rice new lines are shown in 50 mu, Yancheng beach " salt tolerant rice yielding Demonstration district ", under 3 ‰-4 ‰ salinities, the whole death of check variety is had no harvest and these three salt tolerant rices performance excellences, wherein extra large Hunan 030 is best, plant height 100 cm, neat and consistent, per mu yield reaches 817 jin.
Accompanying drawing explanation
Fig. 1 is that the present invention cultivates salt tolerant rice and Field trial schematic diagram;
The Yancheng, Jiangsu Province Coastal beach plantation figure that Fig. 2 is extra large Hunan 030, extra large Hunan 016,121 3, extra large Hunan salt tolerant rice new lines are 3 ‰ in salinity, wherein 030 represents that extra large Hunan 030,016 represents that extra large Hunan 016,121 represents extra large Hunan 121, and contrast strain is entirely dead;
The Yancheng, Jiangsu Province Coastal beach plantation figure that Fig. 3 is extra large Hunan 030, extra large Hunan 016,121 3, extra large Hunan salt tolerant rice new lines are 6 ‰-9 ‰ in salinity, wherein 030 represents that extra large Hunan 030,016 represents that extra large Hunan 016,121 represents that extra large Hunan 121, CK is that paddy rice 9311 contrasts strain;
Fig. 4 is extra large Hunan 030, extra large Hunan 016,121 3, extra large Hunan salt tolerant rice new lines exploded view in the Yancheng, Jiangsu Province Coastal beach 50 mu " salt tolerant rice yielding Demonstration district " of 3 ‰-4 ‰;
Fig. 5 is the growing way figure in Hunan 030, paddy rice sea;
Fig. 6 is transgenic rice plant pcr amplification detected result.
Embodiment
Below in conjunction with the drawings and specific embodiments, the present invention is further detailed explanation:
Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.
One, the cultivation of salt tolerant rice
1. material
Donor: halophytes reed
Acceptor: paddy rice 9311, Yanhui 559,7 seas 74, sea 76,7
2. concrete operation step is as described below:
(1) CTAB method is utilized to extract Reed Leaf DNA
Take 10-15g Reed Leaf, add liquid nitrogen grinding powder. add 2-ME (mercaptoethanol)/CTAB extraction buffer (the 2%2-ME V/V being preheated to 65 DEG C, 2%CTABW/V, 100mmol/LTrisClpH8.0, 20mmol/L EDTApH8.0, 1.4mol/L NaCl), mixing, add 1%PVP (polyvinylpyrrolidone W/V), 65 DEG C of constant temperature 60min. add equal-volume chloroform: octanol (24: 1, V/V) extracting, in 4 DEG C, the centrifugal 5min of 8500r/min, get supernatant, add the CTAB/NaCl solution (10%CTAB that 1/10 volume is preheated to 65 DEG C, W/V, 0.7mol/L NaCl), mixing, add isopyknic chloroform again: octanol (24: 1, V/V) extracting, in 4 DEG C, the centrifugal 5min of 8500r/min, get supernatant, add CTAB precipitated liquid (the 1%CTAB W/V of 1.2 times of volumes, 50mmol/LTrisCl (pH8.0), 10mmol/L EDTA (pH8.0)), mixing, after 37 DEG C of water-baths are spent the night, take out in 4 DEG C, the centrifugal 10min of 8500r/min, precipitation is had to be formed at the bottom of visible centrifuge tube, add high salt TE damping fluid (10mmol/L TrisClpH8.0,0.1mmol/L ED-TApH8.0,1mol/LNaCl), the Virahol adding 0.6 times of volume after dissolving makes it precipitation, in 4 DEG C, the centrifugal 15min of 8500r/min, precipitation uses 80% washing with alcohol, adds appropriate TE buffer solution after drying.
In October, (2) 2007, water intaking rice 9311, sea 74, salt 559,7 sea 76,7, as acceptor, selected the spike of rice of blooming at full-bloom stage in Hainan, and remove the grain husk flower do not opened and the grain husk flower opened, every fringe only leaves about 20, the grain husk flower just opened the same day; Cut off small ear inner glume after 1.5 ~ 2.0 hours, and the style of 1/3 ~ 1/2 is cut off together with column cap; Instil containing exogenous DNA solution 2 ~ 3 μ L on the style tangent plane just cutting off column cap with microsyringe immediately; Inject time is carry out after Rice Flowering, and DNA solution concentration is 250 ~ 300 μ g/ml, and import volume is 10-20 μ l, puts hybridization bag to prevent water evaporates, within 25 ~ 30 days, gathers in the crops 180 afterwards, imports the setting percentage about 10% of fringe, be called D
0for seed.
In May, (3) 2008 to October in Changsha, the D of results
0all sow for seed, percentage of germination is about 70% through observing, and the variation of each importing plant is little, obtains D
1for about 1500 grams altogether, seed.
(4) by D
1two groups are divided into for seed, first group is being carry out seed germination and nursery in the plastic tub of 5 ‰ containing salt concentration, then be transplanted in the artificial salt pond of 5 ‰, carry out Salt-Tolerance Identification screening, the healthy and strong seedling replanting of 17 strains of selecting and remain is to common salt-free land for growing field crops, carry out conventional cultivation, observe variation situation, the normal individual plant sowing of growth of selecting and remain; Second group of seed is then planted in common paddy field, 8 variants of selecting and remain, individual plant sowing.Salt sieve and non-salt are sieved each individual plant sowing of selecting and remain and are called D
2for seed.Educating to add to be commissioned to train, carrying out salt choosing every year in Winter-Spring in Hainan, Xia Qiu carries out salt-free plantation in general rice field in Hunan.
(5) D gathered in the crops
2for seed be carry out selection of salt tolerance under the condition of 4 ‰ ~ 5 ‰ in salt pond salinity, not import the acceptor of foreign DNA in contrast, results D
2for plant 25 strains, most without being significantly separated and variation, setting percentage relative comparison group is good, the normal individual plant of screening growth, results D
3for seed;
(6) by the D of results
3for seed be carry out selection of salt tolerance under the condition of 4 ‰ ~ 5 ‰ in salt pond salinity, not import the acceptor of foreign DNA in contrast, carry out the salt tolerance of paddy growth and the Screening and Identification of yield and quality proterties, the normal individual plant of screening growth, results D
4for seed.
(7) in salt pond salinity be 5 ‰ condition under carry out many generation screenings, until D
6basicly stable for plant.
(8) simultaneously, cultivate to hybridize with two 8S/ sea No. 4, Hunan C815S and obtain F
1for plant, this plant grows fine, and particle shape is good.The D gathered in the crops
6be 20 for strain, the F of acquisition
1it is 1 for strain.
Year May in November, (9) 2011 to 2012 is at Bao Ting, the salt tolerant rice new lines 21 of a collection of stable performance cultivated is combined or strain, carrying out different gradient salinity 2 ‰, 4 ‰, 6 ‰ (basic, normal, high) at Yancheng, Jiangsu Province Coastal beach and carry out Field trial, has outstanding performance in extra large Hunan 030, extra large Hunan 016, extra large Hunan 121.The conventional breeding that breeding time is more general shortens half.
(10) 2013 years, extra large Hunan 030, extra large Hunan 016,121 3, extra large Hunan salt tolerant rice new lines are shown by we in Yancheng, Jiangsu Province Coastal beach 50 mu " salt tolerant rice yielding Demonstration district ", under 3 ‰-4 ‰ salinities, the whole death of check variety is had no harvest and these three salt tolerant rices performance excellences, wherein extra large Hunan 030 is best, plant height 100 cm, neat and consistent, paid 817 jin of per mu yield.
(11) salt tolerant rice sea Hunan 030 product tie up to the aspect such as output, salt tolerance and all have outstanding performance, and within 2014, at Yancheng, Jiangsu Province, carry out " 50 mu of production experiment demonstrations ", per mu yield 806 jin.
Two, Salt Resistance of Rice qualification
In May, 2012, the salt tolerant rice new lines 21 cultivated combination or strain are carried out different gradient salinity 2 ‰, 4 ‰, 6 ‰ (basic, normal, high) at Yancheng, Jiangsu Province Coastal beach and carries out Field trial.Wherein, have outstanding performance in extra large Hunan 030, extra large Hunan 016, extra large Hunan 121, the conventional breeding that breeding time is more general shortens half.
As shown in Figure 4,2013, extra large Hunan 030, extra large Hunan 016,121 3, extra large Hunan salt tolerant rice new lines are shown in Yancheng, Jiangsu Province Coastal beach 50 mu " salt tolerant rice yielding Demonstration district ", under 3 ‰-4 ‰ salinities, the whole death of check variety is had no harvest and these three salt tolerant rices performance excellences, wherein extra large Hunan 030 is best, plant height 100 cm, neat and consistent, per mu yield reaches 806 jin.
As shown in Figure 5, growing fine of paddy rice Hunan 030, sea, full grains.
As shown in Figure 2,3, extra large Hunan 030, extra large Hunan 016,121 3, extra large Hunan salt tolerant rice new lines are respectively the Yancheng, Jiangsu Province Coastal beach plantation exploded view of 3 ‰ and 6 ‰-9 ‰ in salinity.As can be seen from Figure, extra large Hunan 030, extra large Hunan 016,121 3, extra large Hunan salt tolerant rice grow fine, and contrast strain is dead total crop failure all.
Be below species test result:
Yancheng, Jiangsu Province salt tolerant rice species test result (3 ‰ salinity) in 2013
Yancheng salt tolerant rice species test result (0.6%-0.9% salinity) in 2013
Note: wherein extra large Hunan 121 is due to late sowing, does not gather related data.
Three, RAPD analyzes
The STb gene extracting several salt tolerant rice and contrast paddy rice is template, adds primer S89, and CTGACGTCAC (other primer and result have nothing to do, and are omitted), after answering damping fluid, dNTP and Taq enzyme, carries out pcr amplification reaction.Contain in 20 μ l systems: 2 × Mix 10 μ l; Primer (20uM) 2 μ l; Template 2 μ l; Dd H2O6 μ l; Total:20 μ l.Amplification reaction condition: 94 DEG C of denaturation 3min, 94 DEG C of 30s, 37 DEG C of annealing 30s, 72 DEG C of 2min30s, after 40 circulations, 72 DEG C extend 10min again.
Analyze through the RAPD of PCR reaction, find in sugared gel electrophoresis, as shown in Figure 6, wherein S89, S90, S91, S92, S93, S94, S95, S96 are random primer titles; Compare at the amplified production of No. 030 paddy rice and acceptor Yanhui 559, occurred a specific band 030, result display transgenic paddy rice pcr amplification goes out the gene object band that size is about 477bp.Through sequencing analysis, after removing carrier sequence (the two sections of overstrikings in front and back be carrier), sequenced fragments length is 477bp, and this encoding sequence is in sequence table shown in 1.
Further, use Blastn to compare in ncbi database, have no any similar sequence, namely sequence 1 is a new sequence, shows that foreign DNA enters rice conversion pnca gene group.
Four, salt tolerant rice technical essential is cultivated as follows:
1. well-known, the relevant organ such as Floral organ structure, flower, style, ovary of different plant, the size of tissue are not quite similar, even difference great disparity, therefore the selection of introduction method and the setting of schedule of operation very important.This kind of little Hua crop of paddy rice is advisable with the method instiled.Importing time most important.After being held in pollination, to zygote division, make foreign DNA reach blastular during this period of time as far as possible.Therefore, within 1-3 hour after Rice Flowering, be the best importing time.
2. the concentration of target DNA
Drip the concentration of target DNA to be advisable with 250-300 μ g/ml, concentration too high (as 1mg/ml), because of too thickness, affect the speed of DNA infiltration ovary, or measures excessive because of DNA, affects the growth of ovary.The DNA transformed will reach certain purity, and leaching process should remove phenols detrimental impurity as far as possible, in order to avoid antithetical phrase house property is given birth to toxic action and affects changing effect.Dissolving DNA damping fluid used can be TE damping fluid (10mmol/L Tris-HCl+1mmol/L EDTA, pH value is 8.0), or SSC solution (150mmol/L NaCl+15mmol/L Trisodium Citrate+0.05mmol/L Na
2eDTA, pH value is 7.0), wherein can add a certain amount of NOT-function delivery DNA (salmon sperm DNA etc. as calf thymus DNA or thermally denature), contribute to the degraded reducing target DNA, NOT-function delivery DNA concentration is generally advisable with 100-200 μ g/ml.
3. the flower of conservation treatment makes to obtain good developmental condition
Treated ovary is owing to having had injury or entering due to DNA, and its growth course is relatively slower, needs bagging, extracts unnecessary little Hua and the growth suppressing not deal with fruit in time.That can take other according to different situations protects flower and fruit measure.
By reference to the accompanying drawings embodiments of the present invention are explained in detail above, but the present invention is not limited to above-mentioned embodiment, in the ken that one skilled in the relevant art possesses, various change can also be made under the prerequisite not departing from present inventive concept.
Sequence 1
Salt tolerant rice sea Hunan 030RAPD analyzes specific fragment DNA sequence dna table
CTGACGTCACAAAAGCAAAACCGTTAGAAGATGAGAGGGAATAAGAATTATGTAGGTTTGCTTCCCCTTTTGTAAATGCTTCTCCCCACTCTCAACTGTCTTCCCCTGATTGTAAGCAGAACAATCAATTGATTGTTCTGGCAACTCCTACAGTGCATCCTTTCCTTTTCCTCTAAATGCCCTAAGGGAATAGTATACAATATAAATATACTGGTTTTGCATTAGGCAAACCAGATTGGGTTACTCTCTTGATTGAAAGATGTGAGTTAGTTATACACGTCTCTCGTTCTCACCTTTCAAGTTATTAACTTTGATTTAGTGTAAAAGGAAACATTTTGTATTTCCATGTGTAAACTCTACAGTAAAAGCCTTTAAAGTAAAAGTAACTTTAAATTTAACTTTGTGTCTTCCTGATTCTCTTGTATTTTGAATGCTTATGATTTTCCTAATCAGTTGTCAATTATTCGGT
GACGTCAG
Claims (7)
1. use pollen tube channel transformation technology to cultivate a method for salt tolerant rice, comprise the following steps:
(1) halophytes blade DNA is extracted as donor;
(2) fetch water rice 9311, Yanhui 559,7 seas 74, sea 76,7 as acceptor, select the spike of rice of blooming at full-bloom stage, remove the grain husk flower do not opened and the grain husk flower opened, every fringe only leaves about 20, the grain husk flower just opened the same day; Cut off small ear inner glume after 1.5 ~ 2.0 hours, and the style of 1/3 ~ 1/2 is cut off together with column cap; Instil containing reed DNA solution 2 ~ 3 μ l on the style tangent plane just cutting off column cap with microsyringe immediately; Inject time is carry out for after Rice Flowering 1 ~ 3 hour, and reed DNA solution concentration is 100 ~ 500 μ g/ml, and import volume is 10-20 μ l, puts hybridization bag to prevent water evaporates, gathers in the crops D after 25 ~ 30 days
0for seed;
(3) D gathered in the crops
0all sow for seed, through observing, each introgressive line is substantially without making a variation or making a variation not obvious, and the full seed receiving each strain is D respectively
1for seed;
(4) by D
1be divided into two groups for seed, first group, being carry out seed germination and nursery in the plastic tub of 5 ‰ containing salt concentration, is carried out selection of salt tolerance to seed, select and remain healthy and strong seedling replanting to common salt-free land for growing field crops, carry out conventional cultivation, observe variation situation, the normal individual plant sowing of growth of selecting and remain; Second group of seed is then planted and to be germinateed in common paddy field and nursery and whole process grow, and variant of selecting and remain, carries out individual plant sowing; Salt sieve and non-salt are sieved each individual plant sowing of selecting and remain and are called D
2for seed;
(5) by the D of results
2seed is carry out selection of salt tolerance under the condition of 4 ‰ ~ 5 ‰ again in salt pond salinity, not import the acceptor of foreign DNA in contrast, carries out the salt tolerance of paddy growth and the Screening and Identification of yield and quality proterties, the normal individual plant of screening growth, results D
3for seed;
(6) by the D of results
3for seed be carry out selection of salt tolerance under the condition of 4 ‰ ~ 5 ‰ in salt pond salinity, not import the acceptor of foreign DNA in contrast, carry out the salt tolerance of paddy growth and the Screening and Identification of yield and quality proterties, the normal individual plant of screening growth, results D
4for seed;
(7) in salt pond salinity be 5 ‰ condition under carry out many generation screenings, until D
6basicly stable for plant;
(8) simultaneously, cultivate to hybridize with two 8S/ sea No. 4, Hunan C815S and obtain F
1for plant;
(9) by the D of results
6for the seed of strain and the F of acquisition
1in salt is divided into the Yancheng, Jiangsu Province beach of 2 ‰ and 4 ‰, 6 ‰ different gradients saline land, carry out field respectively for single-strain seed to plant experimentally, not import the acceptor of foreign DNA in contrast, select salt tolerance high, grow, new variety that output is high or new lines;
(10) next year, new lines or new variety are carried out in salt is divided into the Yancheng, Jiangsu Province beach of 3 ‰-4 ‰ saline land show in 50 mu " salt tolerant rice yielding Demonstration districts ", not import the acceptor of foreign DNA in contrast, carry out the salt tolerance of paddy growth and the Screening and Identification of yield and quality proterties.
2., according to a kind of method using pollen tube channel transformation technology to cultivate salt tolerant rice described in claim 1, it is characterized in that: extract halophytes blade DNA by CTAB method.
3., according to a kind of method using pollen tube channel transformation technology to cultivate salt tolerant rice described in claim 1 or 2, it is characterized in that: described halophytes is reed.
4. use pollen tube channel transformation technology to cultivate the method for salt tolerant rice according to a kind of described in claim 3, it is characterized in that: described inject time is after Rice Flowering 1 ~ 3 hour.
5., according to a kind of method using pollen tube channel transformation technology to cultivate salt tolerant rice described in claim 4, it is characterized in that: described reed DNA solution concentration is 250 ~ 300 μ g/ml.
6. according to a kind of method using pollen tube channel transformation technology to cultivate salt tolerant rice described in claim 5, it is characterized in that: the NOT-function delivery DNA adding 100 ~ 200 μ g/ml in reed DNA solution.
7. the salt tolerant rice new variety obtained according to the method described in above-mentioned 1 to 6 or the new DNA fragmentation of new lines, is characterized in that: described encoding sequence is for shown in sequence table 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410743591.1A CN104531764A (en) | 2014-12-08 | 2014-12-08 | Method for cultivating salt-tolerant rice by using pollen-tube pathway transformation technology |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410743591.1A CN104531764A (en) | 2014-12-08 | 2014-12-08 | Method for cultivating salt-tolerant rice by using pollen-tube pathway transformation technology |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104531764A true CN104531764A (en) | 2015-04-22 |
Family
ID=52847386
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410743591.1A Pending CN104531764A (en) | 2014-12-08 | 2014-12-08 | Method for cultivating salt-tolerant rice by using pollen-tube pathway transformation technology |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104531764A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108633730A (en) * | 2018-06-26 | 2018-10-12 | 长江大学 | Utilize the acquisition methods of arrow bamboo DNA combination pollen tube channel rice new germ plasms |
| CN110226513A (en) * | 2019-07-04 | 2019-09-13 | 重庆汇鑫云强实业集团有限公司 | A kind of function rice biotechnology breeding method promoting early rice Se content |
| CN111972284A (en) * | 2020-09-04 | 2020-11-24 | 彭晓燕 | Method for cultivating high-mountain dry rice |
| CN112553244A (en) * | 2020-12-10 | 2021-03-26 | 华南农业大学 | Rice gene directional editing method based on pollen tube channel introduction |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1230593A (en) * | 1998-12-01 | 1999-10-06 | 海南大学 | Breeding method of halophytes |
| CN102349441A (en) * | 2011-08-05 | 2012-02-15 | 江苏沿海地区农业科学研究所 | Method for breeding coastline salt-resistant paddy |
| CN103262788A (en) * | 2013-05-31 | 2013-08-28 | 江苏沿海地区农业科学研究所 | Rapid breeding method for salt-tolerance rice variety |
| CN103290022A (en) * | 2012-02-29 | 2013-09-11 | 廖富东 | Method for improving breed by introducing panax quinquefolius DNA into rice |
-
2014
- 2014-12-08 CN CN201410743591.1A patent/CN104531764A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1230593A (en) * | 1998-12-01 | 1999-10-06 | 海南大学 | Breeding method of halophytes |
| CN102349441A (en) * | 2011-08-05 | 2012-02-15 | 江苏沿海地区农业科学研究所 | Method for breeding coastline salt-resistant paddy |
| CN103290022A (en) * | 2012-02-29 | 2013-09-11 | 廖富东 | Method for improving breed by introducing panax quinquefolius DNA into rice |
| CN103262788A (en) * | 2013-05-31 | 2013-08-28 | 江苏沿海地区农业科学研究所 | Rapid breeding method for salt-tolerance rice variety |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108633730A (en) * | 2018-06-26 | 2018-10-12 | 长江大学 | Utilize the acquisition methods of arrow bamboo DNA combination pollen tube channel rice new germ plasms |
| CN110226513A (en) * | 2019-07-04 | 2019-09-13 | 重庆汇鑫云强实业集团有限公司 | A kind of function rice biotechnology breeding method promoting early rice Se content |
| CN111972284A (en) * | 2020-09-04 | 2020-11-24 | 彭晓燕 | Method for cultivating high-mountain dry rice |
| CN112553244A (en) * | 2020-12-10 | 2021-03-26 | 华南农业大学 | Rice gene directional editing method based on pollen tube channel introduction |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Liu et al. | The historical and current research progress on jujube–a superfruit for the future | |
| Farooq et al. | 6 strategies for producing more rice with less water | |
| CN101617631B (en) | Culture method of high diplont rate sporule regeneration plant of broccoli | |
| CN101919351A (en) | Production method of hybrid rice | |
| CN104542256A (en) | Breeding method for importing false smut resistance of indica rice into japonica rice | |
| CN106688878A (en) | Method for cultivating perennial rice by utilizing vegetative propagation characteristics of oryza longistaminata | |
| CN104255443B (en) | A kind of polymerization is containing the seed selection method for rice of anti-three kinds of disease genes | |
| CN104429932A (en) | Novel indica-japonica hybrid gene introgression sheath blight resistance breeding method | |
| CN104531764A (en) | Method for cultivating salt-tolerant rice by using pollen-tube pathway transformation technology | |
| CN108496790A (en) | A method of cultivating rice anti-rice blast two-line sterile line | |
| CN102771382A (en) | Cultivating method for japonica rice variety strong in lodging resistance and suitable for mechanical transplanting of rice | |
| CN110663541B (en) | Method for directly obtaining distant hybrid of wild sesame seeds of Congo fruits and cultivated species and cultivation method | |
| CN104521744A (en) | New bacterial-blight-resisting japonica rice breeding method | |
| CN103461098A (en) | Breeding method for rape | |
| CN103898155B (en) | Particle gun is utilized to obtain method and the special culture media thereof of transgenic wheat | |
| CN109348952A (en) | A method of improving dry land willow salt resistant character | |
| CN104293681B (en) | Phoma endophytic fungus and application thereof | |
| CN104381132B (en) | Rooting method of Juglans hindsii*J.regia vlach tissue culture seedling in bottle | |
| CN106912373A (en) | A kind of high-quality high-resistance starch japonica rice molecular breeding method | |
| Yurteri et al. | Plant breeding based evaluation of Turkish tea [Camellia Sinensis L.(O.) Kuntze] genetic resources | |
| CN102301891A (en) | Technology for cultivating Polygonum multiflorum by pruning roots | |
| CN1284442C (en) | Method for cultivating three-prism candied fruit novel variety by nuclear gene substitution | |
| CN111937742A (en) | Method for creating intergeneric distant hybrid of hibiscus and chamomile | |
| CN105453953B (en) | A kind of crop in cruciferae cultivation mulch mini greenhouse and its application | |
| Samineni | Physiology, genetics and QTL mapping of salt tolerance in chickpea (Cicer arietinum L.) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20150422 |
|
| WD01 | Invention patent application deemed withdrawn after publication |