CN104419707A - Specific promotor in rice embryo and application thereof - Google Patents
Specific promotor in rice embryo and application thereof Download PDFInfo
- Publication number
- CN104419707A CN104419707A CN201310401718.7A CN201310401718A CN104419707A CN 104419707 A CN104419707 A CN 104419707A CN 201310401718 A CN201310401718 A CN 201310401718A CN 104419707 A CN104419707 A CN 104419707A
- Authority
- CN
- China
- Prior art keywords
- rice
- gene
- embryo
- cell
- promotor
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Abstract
The invention relates to a specific promotor in rice embryo and an application thereof. The promotor is particularly suitable for driving exogenous genes to be specifically expressed in the rice embryo and not to be expressed in other tissues of rice. The promotor is high in expression specificity. The invention also provides a structure, an expression cassette and a carrier containing the promotor. The transgenic rice containing the promotor is capable of specifically improving the agronomic trait of the rice, effectively avoiding the exogenous genes from being introduced to influence the other tissues of the rice and specifically expressing the exogenous genes in the embryo so as to obtain various related products.
Description
Technical field
The invention belongs to biological technical field.Specifically, the present invention relates to the specificity promoter in a kind of EMBRYO IN RICE and application thereof.
Background technology
Paddy rice is one of most important food crop in the world, and the whole world has half population to take rice as staple food, and China's paddy Year's consumption and output account for 1/3rd of world's total amount.China is populous nation, and improve grain yield is great social concern always.The minimizing of arable area and the increase of population, exacerbate the requirement to yield and quality of rice, and high yield, high-quality become the Important Problems of rice research day by day.The genome of paddy rice is relatively little, is the model plant of gramineous crop functional genome research.
Embryo is formed in angiosperm sexual reproduction, has important biomolecule meaning in development of plants.The growth of embryo starts from zygote, through the differentiation and development stage of proembryo and embryo, finally reaches ripe.Merge the diploid zygote formed, both maintained the relative stability of species heredity, again for new inherited character may be there is in offspring, new variation provides the foundation, and provides Important Theoretic Foundation for research plant genetic and thremmatology.
Gene embodies its function by expressing, and the ordering growth maintaining organism is grown and Activities.The expression regulation of gene is one of the focus and central topic of molecular biology research always, is divided into the regulation and control of transcriptional level, the regulation and control (processing, maturation etc. of mRNA) of post-transcriptional level, the different aspects such as the regulation and control of translation skill.Promotor is that accurate promotor gene expresses " switch ", in the regulation process of transcriptional level, play important role, be gene in the regulation process of transcriptional level, affect gene expression dose the most directly and the strongest cis regulatory original paper.By engineered method, utilize tissue-specific promotor, the expression study that specific gene carries out is regulated and controled, or the transformation of breeding is targetedly carried out to crop, all there is very important using value.Therefore, the functional sequence of research organization's specificity promoter, for the research of the expression and regulation mechanism of gene, significant.But, some gene, the such as transfer of nonstructural gene meeting producer, thus be difficult to find corresponding promotor specific expressed in particular organization, again such as, there is some miRNA specificity existence in the tissue, but compared with structure gene, because miRNA is too short, matching area is too many, really find accordingly to possess tissue-specific miRNA promotor very few.
In sum, this area is badly in need of studying the tissue-specific promoter in paddy rice, to illustrate the morphological development of paddy rice, metabolism and the disease-resistant approach such as degeneration-resistant, and then changes the various proterties of paddy rice accurately and effectively, the strain of improvement paddy rice, regulates and controls it better and grows and output.
Summary of the invention
The object of the present invention is to provide embryo-specific promoter and the application thereof of a kind of paddy rice.
In first aspect, the invention provides a kind of promoter element, described promoter element is selected from lower group:
The polynucleotide of (a) nucleotide sequence as shown in SEQ ID NO:1;
Homology >=95% (preferably >=98%) of sequence shown in (b) nucleotide sequence and SEQ ID NO:1, and there are the polynucleotide of the promoter activity of special start-up performance in EMBRYO IN RICE;
C () 5 ' end and/or 3 ' of polynucleotide as shown in SEQ ID NO:1 holds brachymemma 1-60 (preferably 1-30, more preferably 1-6) Nucleotide, and have the polynucleotide of the promoter activity of special start-up performance in EMBRYO IN RICE.
In a preferred embodiment, in described EMBRYO IN RICE, special start-up performance represents in the tissue of described promotor beyond the embryo of paddy rice not have start-up performance.
Another preferred embodiment in, the sequence of described promoter element is as shown in SEQ ID NO:1.
In second aspect, the invention provides a kind of construction, the promoter element described in first aspect present invention that described construction contains foreign gene and is operatively connected with foreign gene.
In a preferred embodiment, described foreign gene does not exist under native state.
Another preferred embodiment in, described foreign gene comprises: resistant gene, riddled basins, antigenic protein gene, RNAi gene, microRNA gene, biotechnological formulation gene or plant quality genes involved.
Another preferred embodiment in, described resistant gene is selected from lower group: anti-herbicide gene, antiviral gene, cold tolerance gene, high temperature resistant gene, anti-drought gene, waterlogging-resistant gene or anti insect gene.
Another preferred embodiment in, described riddled basins is selected from lower group: gus (β-glucuronidase) gene, hyg (Totomycin) gene, neo (Liu Suanyan NEOMYCIN SULPHATE) gene or gfp (green fluorescent protein) gene.
Another preferred embodiment in, described antigenic protein gene is selected from lower group: bacterium class antigen protein (as cholera toxin B, tetanus toxin etc.), virus type antigen protein (as canine parvovirus), protozoa antigen protein (as amoeba cause of disease LecA) or autoantigen protein (the CTB – pins antigen protein as type i diabetes).
Another preferred embodiment in, described biotechnological formulation gene is selected from lower group: α 2b interferon gene or insulin-like growth factor i gene.
Another preferred embodiment in, described plant quality genes involved is selected from lower group: amino acid improvement genes involved, fat improvement genes involved, starch improvement genes involved or male sterile genes involved.
In the third aspect, the invention provides a kind of expression cassette, described expression cassette from 5 ' to 3 ' has following element successively: the promoter element described in first aspect present invention, gene ORF sequence and terminator.
In a preferred embodiment, described expression cassette also comprises one or more elements being selected from lower group: poly (A) element, enhanser, transhipment element or gene target element.
In fourth aspect, the invention provides a kind of carrier, described carrier contains the promoter element described in first aspect present invention or the expression cassette described in third aspect present invention.
In a preferred embodiment, described carrier is selected from: bacterial plasmid, phage, yeast plasmid or vegetable cell virus vector, shuttle vectors.
In the 5th, the invention provides a kind of host cell, described host cell contains the promoter element described in first aspect present invention that carrier described in fourth aspect present invention or its karyomit(e) is integrated with external source or its chromosomal integration expression cassette described in third aspect present invention.
In a preferred embodiment, the karyomit(e) of described host cell has the promoter element described in first aspect present invention that one or more (as 1-50, preferably 2-6) copy or the expression cassette described in third aspect present invention.
Another preferred embodiment in, described host cell is selected from lower group: prokaryotic cell prokaryocyte (as intestinal bacteria, streptomyces or Agrobacterium), eukaryotic cell (as yeast cell) or the higher eucaryotic cells (as vegetable cell) such as low.
Another preferred embodiment in, described host cell is vegetable cell, is more preferably the vegetable cell of farm crop, vegetables or flowers.
In the 6th, the invention provides the promoter element described in first aspect present invention, the construction described in second aspect present invention, the purposes of the expression cassette described in third aspect present invention, for the expression of specific regulatory control foreign gene in EMBRYO IN RICE.
In the 6th, the invention provides a kind of method of specific expressed foreign gene in EMBRYO IN RICE, said method comprising the steps of:
A () provides a construction, the promoter element described in first aspect present invention that described construction contains foreign gene and is operatively connected with this foreign gene;
B construction Introduced into Rice cell that step (a) obtains by (), obtains the rice cell transformed;
C rice cell regeneration rice plant that () will transform in step (b), thus make described foreign gene specific expressed in EMBRYO IN RICE.
In a preferred embodiment, described foreign gene is not expressed or is not substantially expressed in other tissue except embryo of paddy rice.
In eighth aspect, the invention provides a kind of method preparing transgenic paddy rice, said method comprising the steps of:
A () provides following rice cell, described rice cell contains carrier described in fourth aspect present invention or its chromosomal integration has the promotor described in first aspect present invention or its chromosomal integration to have expression cassette described in third aspect present invention;
B the rice cell of (a) is regenerated as rice plant by (), thus obtain transgenic paddy rice.
In the 9th, the invention provides a kind of Rice Callus or paddy rice somatic embryo, described Rice Callus or the following rice cell of paddy rice somatic embryo bag or be made up of following rice cell: described rice cell contains carrier described in fourth aspect present invention or its chromosomal integration has the promoter element described in first aspect present invention or its chromosomal integration to have expression cassette described in third aspect present invention.
Should be understood that within the scope of the present invention, above-mentioned each technical characteristic of the present invention and can combining mutually between specifically described each technical characteristic in below (eg embodiment), thus form new or preferred technical scheme.As space is limited, tiredly no longer one by one to state at this.
Accompanying drawing explanation
Fig. 1 shows the GUS coloration result of the transfer-gen plant that GUS expression vector (pBI101.1-P1-GUS, pBI101.1-P2-GUS and pBI101.1-P3-GUS) transforms.
Embodiment
Contriver is through extensive and deep research, a promotor specific expressed in EMBRYO IN RICE has been found unexpectedly from a large amount of paddy genes, thus make in plant genetic engineering external source goal gene can in particular organization high expression, to realize the timing to exogenous gene expression, fixed point, quantitative three-dimensional accuracy controlling, also there is enlightening significance to the molecular biology research of paddy rice.Complete the present invention on this basis.
Contriver has cloned 3 promoter sequences in rice genome, they is building up in the expression vector starting gus gene, and spends 11 (ZH11, see CN101928726B or CN101880671B) in transformed wild type paddy rice.Dyeed by GUS, successfully obtain embryo-specific promoter-P1 (SEQ ID NO:1) in paddy rice:
gcggctcttggcattcctccgacgtgggtggtggtgaagaagagcttggcgccgccgccgccgccgccgccgtagaagccgtcattgtcgaggacgccgacgcctggaagctttcgcgtgggggaggacatggggccgagggctggagaggagggcaacgtcgaaggagtcttcctcggcagtccgctcctcccacgcccgcgtcgaggaaggcggcgagccgcagcagagcggcgggcagccatgccgggattggtttttcttttcttttttttttctgtgcgacggtggattgacgagcagtctcgttcgtttttgtccctccgcagttgctcgtaaatgggctgaatgggccatccttgccacgctcgtgcgatgcagaacgaaagaagcagcagcgccgtgaaatgccaatcggacgatggatcgacgcccgacgtcctatgacgttagctgcccaacgtcagacgatctgcttccctaggtttttagctagggaacttttttttttcatctgatatgctttaagaactttaaacaaaaatcaaactctaccgatgaaagcgaccgcaaagtgcgaaggaggaagaagggcaagaaggggaggaacccaataaggtgcgatatcaccatctctgccatctatgaagagctcgaggagatagaggtacagagggtgaggtggagaaagcaggacccactgaccactatttttatcttcttgtttgattgacatgcggggcccacatatttttttttatatttttagttttcaattttgatgcttttatatattttttttgggggattgtactgtcacgtaggcatcatgtcaatgccatgtgggacgaatacctagtcataaggagtcacgtagacgcccatgagataaaaccggagataatacttccgagggaccttgtttacactattttttaagctaggaagggttgtatcatcatgtttttggttcaaggattaaaatcagactaggtgacaaaggggacctaaagtgaacttactgcgtatatttttccccttcattgaatctgctacttttgggggcccattgaccagcctggcatttcgctcacttgggtcgtgtgtttcttctctgccggacaacttggtcacaaacattcatcaaaatattgtggctattatatttctcctcttttgagatacaaccataaaaagaaactaaacaattaaaattatttatgactatcattaaactatcataaaaagaactccgaaattaacttaaaataggtttcaaattttatttttttttcctacagccgataaaccactaagcagacggtaaaaaaactagtacttctacttaaggagagaataataagtaggactaacaaccacaaactggtaaaccggtagctacttcagactctctgccttttttagcattttaagatcccatccagactgcatcgaatttacaatattctcttaaaatagctcaaaattccgtagaaattcgtctcgatgagatgtacgacatgtcctgttgctgccgtacgtactactagtactaatctaagcggctgagcagcgccggtcgaagaaggaagagtgtttcagctcggcgagcatttgctgctgggtgtgtgcagtacgcatgttggagagggagttgtactaccaaaccttgggacaggtcagcatcgtgtactccagctttgctctccccttgtactgatggatgggcaaattggcaggctatgagatgtggtactagctagtactactgtactagcagtggaatggttcaaggcaaagacattgcgttgcgtgtgtatatatacatctcccatgtttcttgaatcttgacgatgatggcgttggcctaaccggatttgcagtgcatcaggtaagggaaaaaggatggttagatagagagaaggggagttctgtgattggagaggagaggagacagggatgaggcagagcatgggatggggcta。
Term used herein " promotor of the present invention ", the promotor of specifically expressing " in the EMBRYO IN RICE ", " promotor P1 " or " P1 " are used interchangeably, and all represent the promoter element coming from paddy rice, its sequence is as shown in SEQ ID NO.:1.
Promotor of the present invention can efficiently, exclusively specific expressed in EMBRYO IN RICE, and not express in other tissue.Therefore, promotor of the present invention may be used for the proterties that specificity improves paddy rice, avoids foreign gene other tissue to paddy rice to have an impact.
Term used herein " promotor " or " promoter region (territory) " refer to a kind of nucleotide sequence of accurate and effective initial gene functional transcription, guiding gene nucleotide sequence is transcribed into mRNA, it is present in the upstream (5 ' end) of goal gene encoding sequence usually, usually, promotor or promoter region provide the recognition site of RNA polymerase and the necessary other factors of correct initiation transcription.
In this article, described promotor or promoter region (territory) comprise the variant of promotor, and promoter variants by inserting or delete regulation and control region, can carry out random or rite-directed mutagenesis etc. and obtain.
In view of instruction of the present invention and prior art, those of ordinary skill in the art should understand, although the sequence of the promotor P1 provided in embodiments of the invention is as shown in SEQ ID NO:1, but the present invention also should comprise and to have 50% or more with promoter sequence of the present invention (SEQ ID NO:1) (preferably more than 60%, more than 70%, more than 80%, more preferably more than 90%, more preferably more than 95%, most preferably more than 98%, as 99%) nucleic acid of homology, as long as described nucleic acid also has function specific expressed in EMBRYO IN RICE." homology " refers to according to the identical per-cent in position, the similar level (i.e. sequence similarity or identity) between two or more pieces nucleic acid.
Term used herein " specific expressed " refers to the expression of goal gene specific time and/or specific tissue in plant.Specifically, " in EMBRYO IN RICE specific expression " as herein described refers under promoter regulation of the present invention, goal gene high degree of specificity and expressing in EMBRYO IN RICE in specific manner.
" external source " used herein or " allos " refer to the relation between the two or more pieces nucleic acid of different sources or protein sequence.Such as, if the combination of promotor and goal gene sequence is not naturally occurring usually, then promotor is external source for this goal gene.Particular sequence is also " external source " for its cell inserted or organism.
" cis-regulating element " used herein refers to the conservative property base sequence played regulatory role transcription initiation and the transcriptional efficiency of gene.
Promotor of the present invention can operationally be connected with foreign gene, and this foreign gene can be external source (allos) relative to promotor.Foreign gene as herein described (or goal gene) is not particularly limited, and can be the gene that RNAi gene or coding have specific function albumen, and such as some has the albumen of key property or function in agricultural or plant or rice modification.
The representative example of described foreign gene includes, but is not limited to: resistant gene, riddled basins, antigenic protein gene and biotechnological formulation gene or plant quality genes involved.
Described resistant gene is selected from lower group: anti-herbicide gene, antiviral gene, cold tolerance gene, high temperature resistant gene, anti-drought gene, waterlogging-resistant gene or anti insect gene.Described riddled basins is selected from lower group: gus (β-glucuronidase) gene, hyg (Totomycin) gene, neo (Liu Suanyan NEOMYCIN SULPHATE) gene or gfp (green fluorescent protein) gene.Described antigenic protein gene and biotechnological formulation gene are selected from lower group: bacterium class antigen protein is (as cholera toxin B, tetanus toxin etc.), virus type antigen protein (as canine parvovirus), protozoa antigen protein (amoeba cause of disease LecA), autoantigen protein (the CTB – pins as type i diabetes) or biotechnological formulation (as α 2b Interferon, rabbit, rhIGF-1 etc.).Described plant quality genes involved is selected from lower group: amino acid improvement genes involved, fat improvement genes involved, starch improvement genes involved or male sterile genes involved.
Present invention also offers a kind of expression casette, described expression cassette is from 5 '-3 ' successively there is following elements: promotor of the present invention, gene ORF sequence and terminator.Preferably, described promoter sequence as shown in SEQ IDNO.:1 or with homology >=95% of sequence shown in SEQ ID NO.:1, preferably >=98%, more preferably >=99%.
Present invention also offers a kind of recombinant vectors, it comprises promotor of the present invention and/or expression casette.In a preferred embodiment, the promotor downstream of described recombinant vectors comprises multiple clone site or at least one restriction enzyme site.When needing to express goal gene, goal gene is connected into applicable multiple clone site or restriction enzyme site, thus be operably connected goal gene and promotor.Another preferred embodiment in, described recombinant vectors comprises on 5 ' to 3 ' direction: promotor, goal gene and terminator.If needed, described recombinant vectors can also comprise following element: 3 ' polymerized nucleoside acidifying signal; Untranslated nucleotide sequence; Transhipment and target nucleotide sequence; Resistance selective marker (Tetrahydrofolate dehydrogenase, neomycin resistance, hygromycin resistance and green fluorescent protein etc.); Enhanser; Or operator.
Method for the preparation of recombinant vectors is well known to those of ordinary skill in the art.Expression vector can be bacterial plasmid, phage, yeast plasmid, vegetable cell is viral, mammalian cell is viral or other carriers.In a word, as long as it can copy and stablize in host, any plasmid and carrier are all can be adopted.
Those of ordinary skill in the art can adopt the method known to build the expression vector containing promotor of the present invention and/or goal gene sequence.These methods comprise recombinant DNA technology in vi, DNA synthetic technology, In vivo recombination technology etc.
Promotor of the present invention, expression cassette or carrier, may be used for transforming suitable host cell, to make host expresses protein.Host cell can be prokaryotic cell prokaryocyte, as intestinal bacteria, and streptomyces, Agrobacterium: or the eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as vegetable cell.Persons skilled in the art all know how to select suitable carrier and host cell.Can carry out with routine techniques well known to those skilled in the art with recombinant DNA transformed host cell.When host is prokaryotic organism (as intestinal bacteria), CaCl can be used
2method process, also can carry out with electroporation.When host is eukaryote, following DNA transfection method can be selected: calcium phosphate precipitation, conventional mechanical methods (as microinjection, electroporation, liposome packaging etc.).Conversion of plant also can use the method such as Agrobacterium-mediated Transformation or via Particle Bombardment Transformation, such as leaf disk method, rataria conversion method, bud infusion method etc.Can ordinary method regeneration plant be used for the vegetable cell transformed, tissue or organ, thus obtain genetically modified plant.
In a preferred embodiment, the method preparing transgenic plant is: the carrier carrying promotor and the goal gene be operatively connected is proceeded to Agrobacterium, and the carrier segments containing promotor and goal gene is incorporated on the karyomit(e) of plant by Agrobacterium again.In example of the present invention, described recombinant vectors is the pBI101.1 binary vector with gus reporter gene, promotor of the present invention is building up to the upstream of gus gene in this carrier, transformed plant, promotor will activate the expression of GUS base prisoner, described startup is subject to the regulation and control of promoter region cis-acting elements, effectively can simulate gene and to be activated in vivo the situation of transcribing.
The a series of beta-glucoside of β-glucuronidase (GUS) energy catalytic pyrolysis, produces the material with chromophoric group or fluorescence, and the methods such as available spectrophotometer, photofluorometer or histological chemistry are carried out quantitatively and spatial positioning analysis GUS activity.In the art, gus gene has been widely used as the reporter gene of transgenic plant, bacterium and fungi, and particularly it can be used to the concrete biological cells and tissues position of Study of Exogenous genetic expression.
In a particular embodiment of the present invention, under the startup of promotor of the present invention, gus gene can be expressed specifically in EMBRYO IN RICE, and does not express in other tissue.Therefore this promotor may be used for the proterties that specificity in embryo improves paddy rice, and does not make foreign gene impact other tissue.
Promotor of the present invention, construction or expression cassette etc. are used in specifically expressing foreign gene in EMBRYO IN RICE, thus improve the economical character (output, quality as paddy rice) of paddy rice, or strengthen paddy rice to the resistivity of adverse environment (as freezing, high temperature, arid, virus, germ, insect pest or artificial weeding agent).The present invention is also used in EMBRYO IN RICE and produces protein product (as antigen protein and biotechnological formulation) specifically, or for the specific function of Study of Exogenous gene in embryo.
Below in conjunction with specific embodiment, set forth the present invention further.Should be understood that these embodiments are only not used in for illustration of the present invention to limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usual conveniently condition is as people such as Sambrook, molecular cloning: lab guide (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or according to the condition that manufacturer advises.Unless otherwise indicated, otherwise per-cent and number calculate by weight.
Unless otherwise defined, all specialties used in literary composition and scientific words and one skilled in the art the same meaning be familiar with.In addition, any method similar or impartial to described content and material all can be applicable in the present invention.The use that better implementation method described in literary composition and material only present a demonstration.
Embodiment
The clone of embryo-specific promoter in embodiment 1. paddy rice
The oryza sativa genomic dna of extracting is template in conventional manner, utilizes following primer pair (SEQ ID NO.:2 and 3), amplifies promotor P1 by conventional PCR method:
Forward primer: GGCTGCAGCGGCTGCTGTTCTTATGGC (SEQ ID NO:2)
Reverse primer: GGGATCCTGCACTGCAAATCCGGTTAG (SEQ ID NO:3).
Contriver, also by identical method, utilizes following different reverse primer to amplify two other promotor: P2 and P3:
Reverse primer: GGGATCCGCACTGCAAATCCGGTTAG (SEQ ID NO:4)
Reverse primer: GGGATCCACTGCAAATCCGGTTAG (SEQ ID NO:5).
Embodiment 2. builds GUS expression vector
Promoter sequence embodiment 1 obtained is connected with commercial vector pMD19-T carrier (Takara company) respectively, and carries out sequence verification.Then HindIII and BamHI double digestion pMD19-T carrier is used, reclaim the promoter fragment of about 2kb, by this fragment and binary vector pBI101.1 (the Clontech company containing gus reporter gene, the U.S.) carry out double digestion with restriction enzyme HindIII and BamHI respectively, digestion products is connected with T4-DNA ligase enzyme after being reclaimed by gel, and is transformed in e.colistraindh5α and is preserved.
Final carrier called after pBI101.1-P1-GUS, pBI101.1-P2-GUS and pBI101.1-P3-GUS of obtaining.By heat-shock transformed method, recombinant vectors pBI101.1-P1-GUS, pBI101.1-P2-GUS and pBI101.1-P3-GUS are transformed in Agrobacterium GV3101 bacterial strain respectively, and verify with pcr amplification.
The acquisition of embodiment 3. transfer-gen plant
Carrier pBI101.1-P1-GUS, pBI101.1-P2-GUS and pBI101.1-P3-GUS of building being converted into commercially available Agrobacterium GV3101 bacterial strain respectively, then being transformed spending 11 in wild rice by flower leaching method.
Embodiment 4.GUS histochemical stain
Carry out GUS dyeing to the transfer-gen plant built, as shown in Figure 1, wherein, A shows the root of transfer-gen plant to result; B shows stem and the vegetative point (SAM) of transfer-gen plant; C shows the leaf of transfer-gen plant; D shows the little floral structure of transfer-gen plant; E, F show the rataria of transfer-gen plant immature seed; G shows the square section of transfer-gen plant immature seed; H shows the endosperm of transfer-gen plant immature seed; I shows the square section of transfer-gen plant immature seed rataria.
Can obviously find from the result of the present embodiment, dyeed by GUS, pBI101.1-P2-GUS and pBI101.1-P3-GUS does not have obvious GUS color reaction, and pBI101.1-P1-GUS1 can observe colour developing position, and colour developing position concentrates in rataria, the especially scultellum face of embryo.Illustrate that P1 sequence is the correct promotor starting gus gene and express in embryo-specific ground.
Thus, the present invention obtains promotor specific expressed in embryo and scultellum.
The all documents mentioned in the present invention are quoted as a reference all in this application, are just quoted separately as a reference as each section of document.In addition should be understood that those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims limited range equally.
Claims (9)
1. a promoter element, described promoter element is selected from lower group:
The polynucleotide of (a) nucleotide sequence as shown in SEQ ID NO:1;
Homology >=95% (preferably >=98%) of sequence shown in (b) nucleotide sequence and SEQ ID NO:1, and there are the polynucleotide of the promoter activity of special start-up performance in EMBRYO IN RICE;
C () 5 ' end and/or 3 ' of polynucleotide as shown in SEQ ID NO:1 holds brachymemma 1-60 (preferably 1-30, more preferably 1-6) Nucleotide, and have the polynucleotide of the promoter activity of special start-up performance in EMBRYO IN RICE.
2. a construction, the promoter element according to claim 1 that described construction contains foreign gene and is operatively connected with foreign gene.
3. an expression cassette, described expression cassette from 5 ' to 3 ' has following element successively: promoter element according to claim 1, gene ORF sequence and terminator.
4. a carrier, described carrier contains promoter element according to claim 1 or expression cassette according to claim 3.
5. a host cell, described host cell contains the expression cassette that the promoter element according to claim 1 that carrier according to claim 4 or its karyomit(e) is integrated with external source or its chromosomal integration are had the right described in requirement 3.
6. promoter element according to claim 1, construction according to claim 2, the purposes of expression cassette according to claim 3, for the expression of specific regulatory control foreign gene in EMBRYO IN RICE.
7. the method for specific expressed foreign gene in EMBRYO IN RICE, said method comprising the steps of:
A () provides a construction, the promoter element according to claim 1 that described construction contains foreign gene and is operatively connected with this foreign gene;
B construction Introduced into Rice cell that step (a) obtains by (), obtains the rice cell transformed;
C rice cell regeneration rice plant that () will transform in step (b), thus make described foreign gene specific expressed in EMBRYO IN RICE.
8. prepare a method for transgenic paddy rice, said method comprising the steps of:
A () provides following rice cell, described rice cell contains have the right promotor described in requirement 1 or its chromosomal integration of carrier described in claim 4 or its chromosomal integration has the right expression cassette described in requirement 3;
B the rice cell of (a) is regenerated as rice plant by (), thus obtain transgenic paddy rice.
9. Rice Callus or a paddy rice somatic embryo, described Rice Callus or the following rice cell of paddy rice somatic embryo bag or be made up of following rice cell: described rice cell contains carrier according to claim 4 or its chromosomal integration has the right the expression cassette that promoter element described in requirement 1 or its chromosomal integration have the right described in requirement 3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310401718.7A CN104419707B (en) | 2013-09-05 | 2013-09-05 | Specificity promoter and its application in EMBRYO IN RICE |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310401718.7A CN104419707B (en) | 2013-09-05 | 2013-09-05 | Specificity promoter and its application in EMBRYO IN RICE |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104419707A true CN104419707A (en) | 2015-03-18 |
| CN104419707B CN104419707B (en) | 2017-09-29 |
Family
ID=52969831
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310401718.7A Expired - Fee Related CN104419707B (en) | 2013-09-05 | 2013-09-05 | Specificity promoter and its application in EMBRYO IN RICE |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104419707B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101831428A (en) * | 2010-04-07 | 2010-09-15 | 华中农业大学 | Separation clone and expression mode identification of promotor region of rice endosperm special expression gene |
| CN101875936A (en) * | 2010-07-08 | 2010-11-03 | 山东省农业科学院高新技术研究中心 | Promoter specifically-expressed in rice embryo and application thereof |
-
2013
- 2013-09-05 CN CN201310401718.7A patent/CN104419707B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101831428A (en) * | 2010-04-07 | 2010-09-15 | 华中农业大学 | Separation clone and expression mode identification of promotor region of rice endosperm special expression gene |
| CN101875936A (en) * | 2010-07-08 | 2010-11-03 | 山东省农业科学院高新技术研究中心 | Promoter specifically-expressed in rice embryo and application thereof |
Non-Patent Citations (4)
| Title |
|---|
| WWW.NCBI.NLM.NIH.GOV/GENBANK: "Genbank Accession：AP002953.2", 《WWW.NCBI.NLM.NIH.GOV/GENBANK》 * |
| WWW.NCBI.NLM.NIH.GOV/GENBANK: "Genbank Accession：AP014957.1", 《WWW.NCBI.NLM.NIH.GOV/GENBANK》 * |
| 房孝良 等: "水稻种胚特异性启动子OsESP1的克隆及其表达特性", 《作物学报》 * |
| 魏晶: "水稻组织特异启动子的克隆及功能分析", 《中国优秀硕士学位论文全文数据库农业科技辑》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104419707B (en) | 2017-09-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105820225B (en) | Rice grain shape modulin OsPIL15, gene, carrier and application | |
| CN105307480A (en) | Plant regulatory elements and uses thereof | |
| JP2022089861A (en) | Plant regulatory elements and methods of use thereof | |
| CN103275983B (en) | Gene promoter for stress induction expression and application of gene promoter | |
| CN103290014B (en) | Adversity inducible expression gene promoter and application thereof | |
| CN104962557A (en) | miRNA-based target gene stimulant, genetic expression cassette, expression vector and application | |
| CN105838718B (en) | A kind of stems and leaves of rice strongly expressed promoter SAFES7 and its application | |
| CN103667296A (en) | Constitutive expression promoter and application thereof | |
| CN105779492A (en) | Application of rice miR396c | |
| CN105524933A (en) | OsJMJ714 functions of influence on rice grain size and tolerance to salt stress and application of OsJMJ714 | |
| CN105087589B (en) | A kind of promoter element OsEmb2 and the methods and applications that transgenic paddy rice is cultivated using it | |
| CN106191073A (en) | HOX3 gene purposes in improvement cotton fiber elongation character | |
| CN107058324A (en) | Rice root specific expression promoter POsRO4 and corresponding rice cultivating method | |
| CN104419707B (en) | Specificity promoter and its application in EMBRYO IN RICE | |
| JP2022081655A (en) | Plant regulatory elements and uses thereof | |
| CN105985958B (en) | Leguminous plant leaf tissue specificity promoter and its application | |
| CN104152454B (en) | Derive from drought-induced promoter GmMYB363P and the application thereof of soybean | |
| CN102121006B (en) | Plant pathogenic bacterium induction type ethylene response factor gene promoter sequence and application thereof | |
| CN104673792B (en) | Legume beanpod linked groups' specificity promoter and its application | |
| CN103290008B (en) | A kind of Plant overground part specific promoter and application thereof | |
| CN104673793B (en) | Legume root system tissue-specific promoter and its application | |
| CN105602956B (en) | A kind of paddy pollen strongly expressed promoter OsPoll4 and its application | |
| EP2363465A1 (en) | Transgenic plant of which seed has enlarged size | |
| CN1687423A (en) | Method for direct breeding transgene paddy rice with out resistance selection tag | |
| CN103757025B (en) | The promotor of an adverse circumstance abduction delivering and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20170929 Termination date: 20200905 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |