CN104419707B - Specificity promoter and its application in EMBRYO IN RICE - Google Patents
Specificity promoter and its application in EMBRYO IN RICE Download PDFInfo
- Publication number
- CN104419707B CN104419707B CN201310401718.7A CN201310401718A CN104419707B CN 104419707 B CN104419707 B CN 104419707B CN 201310401718 A CN201310401718 A CN 201310401718A CN 104419707 B CN104419707 B CN 104419707B
- Authority
- CN
- China
- Prior art keywords
- promoter
- rice
- gene
- embryo
- foreign gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Abstract
The present invention relates to the specificity promoter in a kind of EMBRYO IN RICE and its application.The promoter is particularly suitable for driving foreign gene specific expressed in EMBRYO IN RICE, and is not expressed in other tissues of paddy rice.The expression specificity and selectivity of the promoter are very high.Present invention also offers the construction with the promoter, expression cassette and carrier etc..Transgenic paddy rice containing promoter of the present invention can specifically improve the economical character of paddy rice, influence of the foreign gene importing to the other tissues of paddy rice is prevented effectively from, moreover it is possible to the specific expressed foreign gene in embryo, so as to obtain various associated products.
Description
Technical field
The invention belongs to biological technical field.Specifically, the present invention relates to the specificity promoter in a kind of EMBRYO IN RICE
And its application.
Background technology
Paddy rice is one of most important cereal crops in the world, and there is half population in the whole world using rice as staple food, China rice
Paddy Year's consumption and yield account for 1/3rd of world's total amount.China is populous nation, and it is always great to improve grain yield
Social concern.The reduction of arable area and the increase of population, exacerbate the requirement to yield and quality of rice, high yield, high-quality
It is increasingly becoming the Important Problems of rice research.The genome of paddy rice is relatively small, is gramineous crop functional genome research
Model plant.
Embryo is formed in angiosperm sexual reproduction, has important biomolecule meaning in development of plants.Embryo
Development starts from zygote, by the differentiation and development stage of proembryo and embryo, finally reaches maturation.The diploid zygote formed is merged, both
The relative stability of species heredity is maintained, is provided the foundation again to be likely to occur new inhereditary feature, new variation in offspring, is
Plant genetic and the offer Important Theoretic Foundation of thremmatology are provided.
Gene embodies its function by expressing, and maintains the ordering growth development and Activities of organism.The table of gene
It is always one of focus and central topic of molecular biology research up to regulation and control, is divided into the regulation and control of transcriptional level, post-transcriptional level
Regulation and control (the processing of mRNA, maturation etc.), the different aspects such as regulation and control of translation skill.Promoter is accurate promotor gene expression
" switch ", plays important role in the regulation process of transcriptional level, be gene in the regulation process of transcriptional level, shadow
Ring the most direct and most strong cis regulatory original paper of gene expression dose.By the method for genetic engineering, organizing specific is utilized
Property promoter, to specific gene carry out expression study regulate and control, or to crop carry out targetedly breeding transformation, all
With highly important application value.Therefore, the functional sequence of tissue-specific promoter is studied, for the expression regulation of gene
The research of mechanism, it is significant.But, the transfer of some genes, such as nonstructural gene meeting producer, so that it is difficult to
Specific expressed corresponding promoter in particular organization is found, for another example it is specific in the tissue with the presence of some miRNA,
But compared with structural gene, because miRNA is too short, matching area it is too many, that really finds accordingly possesses tissue specificity
MiRNA promoters are very few.
In summary, this area is badly in need of studying the tissue-specific promoter in paddy rice, to illustrate paddy rice
Morphological development, metabolism and the disease-resistant approach such as degeneration-resistant, and then accurately and effectively change the various characters of paddy rice, improve the product of paddy rice
System, preferably regulates and controls it and grows and yield.
The content of the invention
It is an object of the invention to provide a kind of embryo-specific promoter of paddy rice and its application.
In a first aspect, the present invention provides a kind of promoter element, the promoter element is selected from the group：
(a) nucleotide sequence such as SEQ ID NO:Polynucleotides shown in 1；
(b) nucleotide sequence and SEQ ID NO:Homology >=95% (preferably >=98%) of sequence shown in 1, and with water
The polynucleotides of the promoter activity of special startup function in rice embryo；
(c) such as SEQ ID NO:5 ' the ends and/or 3 ' ends of polynucleotides shown in 1 truncate 1-60 (preferably 1-30, more preferably
Ground 1-6) nucleotides, and with the polynucleotides of the promoter activity of special startup function in EMBRYO IN RICE.
In a preferred embodiment, special startup function represents embryo of the promoter in paddy rice in described EMBRYO IN RICE
Do not have startup function in tissue in addition.
In another preferred embodiment, the sequence of the promoter element such as SEQ ID NO:Shown in 1.
In second aspect, the present invention provides a kind of construction, and the construction contains foreign gene and and foreign gene
The promoter element described in first aspect present invention being operatively connected.
In a preferred embodiment, described foreign gene is under native state and is not present.
In another preferred embodiment, the foreign gene includes：Resistant gene, riddled basins, antigen egg
White gene, RNAi genes, microRNA genes, biological agent gene or plant quality related gene.
In another preferred embodiment, described resistant gene is selected from the group：Anti-herbicide gene, antiviral base
Cause, cold tolerance gene, high temperature resistant gene, anti-drought gene, waterlogging-resistant gene or anti insect gene.
In another preferred embodiment, described riddled basins are selected from the group：Gus (beta-glucuronidase)
Gene, hyg (hygromycin) gene, neo (neomycin) genes or gfp (green fluorescent protein) gene.
In another preferred embodiment, described antigenic protein gene is selected from the group：Bacterium class antigen protein is (as suddenly
Random toxin B, tetanus toxin etc.), virus type antigen protein (such as canine parvovirus), protozoa antigen protein (such as Ah meter
Bar cause of disease LecA) or autoantigen protein (CTB-pins antigen proteins of such as type i diabetes).
In another preferred embodiment, described biological agent gene is selected from the group：α 2b interferon genes or pancreas
Island element like growth factor gene.
In another preferred embodiment, described plant quality related gene is selected from the group：Amino acid improvement is related
Gene, fat improvement related gene, starch improvement related gene or male sterility related gene.
In the third aspect, the present invention provides a kind of expression cassette, and the expression cassette from 5 ' to 3 ' has following elements successively：This
Promoter element, gene ORF sequences and terminator described in invention first aspect.
In a preferred embodiment, described expression cassette also includes the one or more elements being selected from the group：poly(A)
Element, enhancer, transhipment element or gene target element.
In fourth aspect, the present invention provides a kind of carrier, and the carrier contains the promoter described in first aspect present invention
Expression cassette described in element or third aspect present invention.
In a preferred embodiment, the carrier is selected from：Bacterial plasmid, bacteriophage, yeast plasmid or plant cell disease
Poisonous carrier, shuttle vector.
At the 5th aspect, the present invention provides a kind of host cell, and the host cell contains described in fourth aspect present invention
Carrier or its chromosome on be integrated with promoter element or its chromosomal integration described in the first aspect present invention of external source
There is the expression cassette described in third aspect present invention.
In a preferred embodiment, the chromosome of the host cell have it is one or more (such as 1-50, preferably
2-6) copy first aspect present invention described in promoter element or the expression cassette described in third aspect present invention.
In another preferred embodiment, described host cell is selected from the group：Prokaryotic (such as Escherichia coli, chain
Mould belongs to or Agrobacterium), low eukaryotic (such as yeast cells) or higher eucaryotic cells (such as plant cell).
In another preferred embodiment, described host cell be plant cell, be more preferably crops, vegetables,
Or the plant cell of flowers.
At the 6th aspect, the present invention provides the promoter element described in first aspect present invention, second aspect of the present invention institute
The construction stated, the purposes of the expression cassette described in third aspect present invention, for specific regulatory control foreign gene in EMBRYO IN RICE
Expression.
At the 6th aspect, the present invention provides a kind of method of foreign gene specific expressed in EMBRYO IN RICE, methods described
Comprise the following steps：
(a) construction is provided, the construction contains foreign gene and the sheet being operatively connected with the foreign gene
Promoter element described in invention first aspect；
(b) the construction Introduced into Rice cell for obtaining step (a), obtains the rice cell of conversion；
(c) rice cell of conversion in step (b) is regenerated into rice plant, so that the foreign gene is in EMBRYO IN RICE
In it is specific expressed.
In a preferred embodiment, the foreign gene is not expressed or substantially in other tissues of the paddy rice in addition to embryo
Do not express.
In eighth aspect, the present invention provides a kind of method of prepare transgenosis paddy rice, the described method comprises the following steps：
(a) following rice cells are provided, the rice cell contains the carrier or its dyeing described in fourth aspect present invention
The promoter or its chromosomal integration that body is integrated with described in first aspect present invention have the expression described in third aspect present invention
Box；
(b) rice cell of (a) is regenerated as rice plant, so as to obtain transgenic paddy rice.
At the 9th aspect, the present invention provides a kind of Rice Callus or paddy rice somatic embryo, the rice callus group
Knit or the following rice cells of paddy rice somatic embryo bag or be made up of following rice cells：The rice cell contains the present invention the
Carrier or its chromosomal integration described in four aspects have promoter element or its chromosome described in first aspect present invention whole
Conjunction has the expression cassette described in third aspect present invention.
It should be understood that within the scope of the present invention, above-mentioned each technical characteristic of the invention and have in below (eg embodiment)
It can be combined with each other between each technical characteristic of body description, so as to constitute new or preferred technical scheme.As space is limited, exist
This no longer tires out one by one states.
Brief description of the drawings
Fig. 1 shows GUS expression vectors (pBI101.1-P1-GUS, pBI101.1-P2-GUS and pBI101.1-P3-
GUS) the GUS coloration results of the transfer-gen plant of conversion.
Embodiment
Inventor is by in-depth study extensively, it has surprisingly been found that one in water from substantial amounts of paddy gene
Specific expressed promoter in rice embryo, so as to enable external source target gene efficient in particular organization in plant genetic engineering
Expression, to realize timing to exogenous gene expression, fixed point, quantitative three-dimensional accuracy controlling, grinds to the molecular biology of paddy rice
Studying carefully also has enlightening significance.The present invention is completed on this basis.
Inventor has cloned 3 promoter sequences in rice genome, and they are building up to the expression for starting gus gene
In carrier, and convert 11 (ZH11, referring to CN101928726B or CN101880671B) are spent in wild rice.Contaminated by GUS
Color, successfully obtains (the SEQ ID NO of embryo-specific promoter-P1 in paddy rice:1)：
gcggctcttggcattcctccgacgtgggtggtggtgaagaagagcttggcgccgccgccgccgccgccgccgtagaa
gccgtcattgtcgaggacgccgacgcctggaagctttcgcgtgggggaggacatggggccgagggctggagaggagg
gcaacgtcgaaggagtcttcctcggcagtccgctcctcccacgcccgcgtcgaggaaggcggcgagccgcagcagag
cggcgggcagccatgccgggattggtttttcttttcttttttttttctgtgcgacggtggattgacgagcagtctcg
ttcgtttttgtccctccgcagttgctcgtaaatgggctgaatgggccatccttgccacgctcgtgcgatgcagaacg
aaagaagcagcagcgccgtgaaatgccaatcggacgatggatcgacgcccgacgtcctatgacgttagctgcccaac
gtcagacgatctgcttccctaggtttttagctagggaacttttttttttcatctgatatgctttaagaactttaaac
aaaaatcaaactctaccgatgaaagcgaccgcaaagtgcgaaggaggaagaagggcaagaaggggaggaacccaata
aggtgcgatatcaccatctctgccatctatgaagagctcgaggagatagaggtacagagggtgaggtggagaaagca
ggacccactgaccactatttttatcttcttgtttgattgacatgcggggcccacatatttttttttatatttttagt
tttcaattttgatgcttttatatattttttttgggggattgtactgtcacgtaggcatcatgtcaatgccatgtggg
acgaatacctagtcataaggagtcacgtagacgcccatgagataaaaccggagataatacttccgagggaccttgtt
tacactattttttaagctaggaagggttgtatcatcatgtttttggttcaaggattaaaatcagactaggtgacaaa
ggggacctaaagtgaacttactgcgtatatttttccccttcattgaatctgctacttttgggggcccattgaccagc
ctggcatttcgctcacttgggtcgtgtgtttcttctctgccggacaacttggtcacaaacattcatcaaaatattgt
ggctattatatttctcctcttttgagatacaaccataaaaagaaactaaacaattaaaattatttatgactatcatt
aaactatcataaaaagaactccgaaattaacttaaaataggtttcaaattttatttttttttcctacagccgataaa
ccactaagcagacggtaaaaaaactagtacttctacttaaggagagaataataagtaggactaacaaccacaaactg
gtaaaccggtagctacttcagactctctgccttttttagcattttaagatcccatccagactgcatcgaatttacaa
tattctcttaaaatagctcaaaattccgtagaaattcgtctcgatgagatgtacgacatgtcctgttgctgccgtac
gtactactagtactaatctaagcggctgagcagcgccggtcgaagaaggaagagtgtttcagctcggcgagcatttg
ctgctgggtgtgtgcagtacgcatgttggagagggagttgtactaccaaaccttgggacaggtcagcatcgtgtact
ccagctttgctctccccttgtactgatggatgggcaaattggcaggctatgagatgtggtactagctagtactactg
tactagcagtggaatggttcaaggcaaagacattgcgttgcgtgtgtatatatacatctcccatgtttcttgaatct
tgacgatgatggcgttggcctaaccggatttgcagtgcatcaggtaagggaaaaaggatggttagatagagagaagg
ggagttctgtgattggagaggagaggagacagggatgaggcagagcatgggatggggcta。
Term " promoter of the present invention " used herein, " promoter of specifically expressing in EMBRYO IN RICE ", " promoter P1 " or
" P1 " is used interchangeably, and represents to come from the promoter element of paddy rice, its sequence such as SEQ ID NO.:Shown in 1.
The present invention promoter can efficiently, it is exclusively specific expressed in EMBRYO IN RICE, and in other tissues not table
Reach.Therefore, promoter of the invention, which can be used for specificity, improves the character of paddy rice, it is to avoid other groups to paddy rice of foreign gene
Knit generation influence.
Term " promoter " used herein or " promoter region (domain) " refer to a kind of accurate and effective initial gene transcription work(
The nucleotide sequence of energy, guiding gene nucleotide sequence is transcribed into mRNA, and it is typically found in the upstream (5 ' of target gene coded sequence
End), usually, promoter or promoter region provide RNA polymerase and the correctly knowledge of other factors necessary to starting transcription
Other site.
Herein, the promoter or promoter region (domain) include the variant of promoter, and promoter variants can pass through
Regulatory region is deleted in insertion, carries out random or rite-directed mutagenesis etc. to obtain.
In view of the teachings of the present invention and prior art, although it will be recognized by one of ordinary skill in the art that the implementation of the present invention
The promoter P1 provided in example sequence such as SEQ ID NO:Shown in 1, but the present invention should also include the promoter sequence with the present invention
Arrange (SEQ ID NO:1) have 50% or more (preferably more than 60%, more than 70%, more than 80%, more preferably more than 90%, more preferably
More than 95%, most preferably more than 98%, such as nucleic acid of 99%) homology, as long as the nucleic acid also has the specific table in EMBRYO IN RICE
The function of reaching." homology " refers to according to position identical percentage, similar level between two or more pieces nucleic acid (i.e. sequence
Similitude or homogeneity).
Term " specific expressed " used herein refers to target gene specific time and/or specific group in plant
The expression knitted.Specifically, " specific expression in EMBRYO IN RICE " as described herein refers under the promoter regulation of the present invention,
Target gene high degree of specificity and the expression in EMBRYO IN RICE in specific manner.
" external source " used herein or " heterologous " refer to the two or more pieces nucleic acid or protein sequence of separate sources
Between relation.For example, if the combination of promoter and objective gene sequence is not usually naturally occurring, promoter for
It is external source for the target gene.Particular sequence for its cell inserted or is also " external source " for organism.
" cis-regulating element " used herein refers to the guarantor played regulatory role to the transcription initiation and transcriptional efficiency of gene
Keeping property base sequence.
The promoter of the present invention operationally can be connected with foreign gene, and the foreign gene can be relative to promoter
External source (heterologous).Foreign gene (or target gene) as described herein is not particularly limited, and can be RNAi genes or coding
Gene with specific function albumen, such as it is some to have key property or the egg of function in agricultural or plant or rice modification
In vain.
The representative example of the foreign gene includes but is not limited to：Resistant gene, riddled basins, antigen protein
Gene and biological agent gene or plant quality related gene.
Described resistant gene is selected from the group：It is anti-herbicide gene, antiviral gene, cold tolerance gene, high temperature resistant gene, anti-
Non-irrigated gene, waterlogging-resistant gene or anti insect gene.Described riddled basins are selected from the group：Gus (beta-glucuronidase) base
Cause, hyg (hygromycin) gene, neo (neomycin) genes or gfp (green fluorescent protein) gene.Described antigenic protein gene
And biological agent gene is selected from the group：Bacterium class antigen protein (such as cholera toxin B, tetanus toxin etc.), virus type antigen egg
(such as canine parvovirus), protozoa antigen protein (amoeba cause of disease LecA), autoantigen protein (such as type i diabetes in vain
CTB-pins) or biological agent (such as α 2b interferon, IGF etc.).Described plant quality related gene
It is selected from the group：Amino acid improvement related gene, fat improvement related gene, starch improvement related gene or male sterility dependency basis
Cause.
Present invention also offers a kind of expression casette, the expression cassette has following elements successively from 5 ' -3 '：The present invention
Promoter, gene ORF sequences and terminator.Preferably, the promoter sequence such as SEQ ID NO.:1 shown or and SEQ
ID NO.:Homology >=95% of sequence shown in 1, preferably >=98%, more preferably >=99%.
Present invention also offers a kind of recombinant vector, its promoter comprising the present invention and/or expression casette.Preferred
Embodiment in, the promoter downstream of the recombinant vector includes multiple cloning sites or at least one restriction enzyme site.Need table
During up to target gene, target gene is connected into suitable multiple cloning sites or restriction enzyme site, so that the purpose that is operably connected
Gene and promoter.In another preferred embodiment, the recombinant vector includes on 5 ' to 3 ' directions：Promoter, mesh
Gene and terminator.If desired, the recombinant vector can also include elements below：3 ' polymerized nucleosides are acidified signal；It is non-
Translate nucleotide sequence；Transhipment and targeting nucleotide sequence；Resistance selective marker (dihyrofolate reductase, neomycin resistance, hygromycin
Resistance and green fluorescent protein etc.)；Enhancer；Or operator.
Method for Prepare restructuring carrier is well known to those of ordinary skill in the art.Expression vector can be bacterium
Plasmid, bacteriophage, yeast plasmid, plant cell virus, mammalian cell virus or other carriers.In a word, as long as it can
Replicated in host and stably, any plasmid and carrier are all can be with adopted.
Those of ordinary skill in the art can be built using well known method contains promoter of the present invention and/or target gene
The expression vector of sequence.These methods include recombinant DNA technology in vi, DNA synthetic technologys, In vivo recombination technology etc..
Promoter, expression cassette or the carrier of the present invention, can be used for converting appropriate host cell, so that host expresses egg
White matter.Host cell can be prokaryotic, such as Escherichia coli, streptomyces, Agrobacterium：Or low eukaryotic, such as ferment
Mother cell；Or higher eucaryotic cells, such as plant cell.Persons skilled in the art are aware that how to select appropriate carrier
And host cell.It can be carried out with recombinant DNA conversion host cell with routine techniques well known to those skilled in the art.When host is
During prokaryotes (such as Escherichia coli), CaCl can be used2Method processing, it is also possible to which electroporation is carried out.When host is eucaryote,
It can select following DNA transfection methods：Calcium phosphate precipitation, conventional mechanical methods (such as microinjection, electroporation, liposome
Packaging etc.).The methods such as Agrobacterium-mediated Transformation or via Particle Bombardment Transformation, such as leaf disk method, rataria conversion method, flower can also be used in conversion plant
Bud infusion method etc..Plant can be regenerated with conventional method for the plant cell, tissue or organ of conversion, base is turned so as to obtain
The plant of cause.
In a preferred embodiment, the method for prepare transgenosis plant is：To carry the promoter that is operatively connected and
The carrier of target gene is transferred to Agrobacterium, and the carrier segments containing promoter and target gene are incorporated into the dye of plant by Agrobacterium again
On colour solid.In the example of the present invention, described recombinant vector is the pBI101.1 binary vectors with gus reporter gene, will
The promoter of the present invention is building up to the upstream of gus gene in the carrier, and transformed plant, promoter will activate the expression of GUS base prisoners,
Described start is activated the regulation and control of sub-district cis-acting elements, can effectively simulate gene and be activated in vivo the shape of transcription
Condition.
Beta-glucuronidase (GUS) the energy a series of beta-glucosidase of catalytic pyrolysis, producing has chromophore or fluorescence
Material, GUS activity can be carried out with methods such as spectrophotometer, fluorescence photometer or histochemistries quantitative with space orientation analysis.
In the art, gus gene has been widely used as the reporter gene of genetically modified plants, bacterium and fungi, and particularly it can quilt
Specific cell and tissue site for Study of Exogenous gene expression.
In a particular embodiment of the present invention, under the startup of promoter of the present invention, gus gene can be specifically in paddy rice
Express, and do not expressed in other tissues in embryo.Therefore the promoter, which can be used for the specificity in embryo, improves the character of paddy rice,
Without causing foreign gene to impact other tissues.
Promoter, construction or expression cassette of the present invention etc. can be used for the specifically expressing foreign gene in EMBRYO IN RICE, so that
Improve paddy rice economical character (yield, the quality of such as paddy rice), or enhancing paddy rice to adverse environment (as freezing, high temperature, arid,
Virus, germ, insect pest or artificial weeding agent) resistivity.Present invention may also apply to egg is specifically produced in EMBRYO IN RICE
White product (such as antigen protein and biological agent), or the specific function for Study of Exogenous gene in embryo.
With reference to specific embodiment, the present invention is expanded on further.It should be understood that these embodiments are merely to illustrate the present invention
Rather than limitation the scope of the present invention.The experimental method of unreceipted actual conditions in the following example, generally according to conventional strip
Part such as Sambrook et al., molecular cloning：Lab guide (New York：Cold Spring Harbor Laboratory
Press, 1989) described in condition, or according to the condition proposed by manufacturer.Unless otherwise indicated, otherwise percentage and
Number is calculated by weight.
Unless otherwise defined, all specialties used in text known to scientific words and one skilled in the art with anticipating
Justice is identical.In addition, any method similar or impartial to described content and material all can be applied in the present invention.Described in text
Preferable implementation only present a demonstration and be used with material.
Embodiment
The clone of embryo-specific promoter in the paddy rice of embodiment 1.
The oryza sativa genomic dna extracted in conventional manner is template, utilizes following primer pair (SEQ ID NO.:2 and 3),
Promoter P1 is amplified by conventional PCR method：
Forward primer:GGCTGCAGCGGCTGCTGTTCTTATGGC(SEQ ID NO:2)
Reverse primer:GGGATCCTGCACTGCAAATCCGGTTAG(SEQ ID NO:3).
By identical method, two other promoter also is amplified using following different reverse primer by inventor：P2
And P3：
Reverse primer:GGGATCCGCACTGCAAATCCGGTTAG(SEQ ID NO:4)
Reverse primer:GGGATCCACTGCAAATCCGGTTAG(SEQ ID NO:5).
Embodiment 2. builds GUS expression vectors
The promoter sequence that embodiment 1 is obtained is connected with commercial vector pMD19-T carriers (Takara companies) respectively, and
Carry out sequence verification.Then HindIII and BamHI double digestion pMD19-T carriers are used, about 2kb promoter fragment are reclaimed, by this
Fragment and binary vector pBI101.1 (Clontech companies, the U.S.) containing gus reporter gene use restriction enzyme respectively
HindIII and BamHI carries out double digestion, and digestion products are attached after being reclaimed by gel with T4-DNA ligases, and are converted
Preserved into e.colistraindh5α.
The final carrier obtained is named as pBI101.1-P1-GUS, pBI101.1-P2-GUS and pBI101.1-P3-GUS.
Recombinant vector pBI101.1-P1-GUS, pBI101.1-P2-GUS and pBI101.1-P3-GUS are turned respectively with heat-shock transformed method
Change into Agrobacterium GV3101 bacterial strains, and checking is expanded with PCR.
The acquisition of the transfer-gen plant of embodiment 3.
Carrier pBI101.1-P1-GUS, pBI101.1-P2-GUS and pBI101.1-P3-GUS for building are turned respectively
Change to commercially available Agrobacterium GV3101 bacterial strains, then by flower leaching method to spending 11 to convert in wild rice.
Embodiment 4.GUS histochemical stains
GUS dyeing is carried out to the transfer-gen plant of structure, as a result as shown in figure 1, wherein, A shows transfer-gen plant
Root；B shows the stem and growing point (SAM) of transfer-gen plant；C shows the leaf of transfer-gen plant；D shows transfer-gen plant
Small floral structure；E, F show the rataria of transfer-gen plant immature seed；G shows transfer-gen plant immature seed
Cross section；H shows the endosperm of transfer-gen plant immature seed；I shows the horizontal stroke of transfer-gen plant immature seed rataria
Tangent plane.
It is apparent that, is dyed by GUS from the result of the present embodiment, pBI101.1-P2-GUS and pBI101.1-
P3-GUS does not have obvious GUS chromogenic reactions, and pBI101.1-P1-GUS1 is able to observe that colour developing position, and colour developing position collection
In in rataria, the especially scultellum face of embryo.It is the correct startup for starting gus gene expression in embryo-specific ground to illustrate P1 sequences
Son.
Thus, the present invention has obtained specific expressed promoter in embryo and scultellum.
All documents referred in the present invention are all incorporated as reference in this application, independent just as each document
It is incorporated as with reference to such.In addition, it is to be understood that after the above-mentioned instruction content of the present invention has been read, those skilled in the art can
To be made various changes or modifications to the present invention, these equivalent form of values equally fall within the model that the application appended claims are limited
Enclose.
Claims (7)
1. a kind of promoter, the nucleotide sequence such as SEQ ID NO of the promoter:Shown in 1.
2. a kind of construction, the construction contains foreign gene and the claim 1 being operatively connected with foreign gene institute
The promoter stated.
3. a kind of expression cassette, the expression cassette from 5 ' to 3 ' has following elements successively：Promoter, base described in claim 1
Because of ORF sequences and terminator.
4. a kind of carrier, the carrier contains the expression cassette described in promoter or claim 3 described in claim 1.
5. the use of the construction described in promoter or claim 2 described in claim 1 or the expression cassette described in claim 3
On the way, the expression for specific regulatory control foreign gene in EMBRYO IN RICE.
6. a kind of method of foreign gene specific expressed in EMBRYO IN RICE, the described method comprises the following steps：
(a) construction is provided, the construction contains foreign gene and the right being operatively connected with the foreign gene will
Seek the promoter described in 1；
(b) the construction Introduced into Rice cell for obtaining step (a), obtains the rice cell of conversion；
(c) rice cell of conversion in step (b) is regenerated into rice plant, so that the foreign gene is special in EMBRYO IN RICE
Opposite sex expression.
7. a kind of method of prepare transgenosis paddy rice, the described method comprises the following steps：
(a) following rice cells are provided, the rice cell contains carrier described in claim 4 or its chromosomal integration is had the right
Profit requires that promoter described in 1 or its chromosomal integration are had the right expression cassette described in requirement 3；
(b) rice cell of (a) is regenerated as rice plant, so as to obtain transgenic paddy rice.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310401718.7A CN104419707B (en) | 2013-09-05 | 2013-09-05 | Specificity promoter and its application in EMBRYO IN RICE |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310401718.7A CN104419707B (en) | 2013-09-05 | 2013-09-05 | Specificity promoter and its application in EMBRYO IN RICE |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104419707A CN104419707A (en) | 2015-03-18 |
| CN104419707B true CN104419707B (en) | 2017-09-29 |
Family
ID=52969831
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310401718.7A Expired - Fee Related CN104419707B (en) | 2013-09-05 | 2013-09-05 | Specificity promoter and its application in EMBRYO IN RICE |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104419707B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101831428A (en) * | 2010-04-07 | 2010-09-15 | 华中农业大学 | Separation clone and expression mode identification of promotor region of rice endosperm special expression gene |
| CN101875936A (en) * | 2010-07-08 | 2010-11-03 | 山东省农业科学院高新技术研究中心 | Promoter specifically-expressed in rice embryo and application thereof |
-
2013
- 2013-09-05 CN CN201310401718.7A patent/CN104419707B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101831428A (en) * | 2010-04-07 | 2010-09-15 | 华中农业大学 | Separation clone and expression mode identification of promotor region of rice endosperm special expression gene |
| CN101875936A (en) * | 2010-07-08 | 2010-11-03 | 山东省农业科学院高新技术研究中心 | Promoter specifically-expressed in rice embryo and application thereof |
Non-Patent Citations (4)
| Title |
|---|
| Genbank Accession：AP002953.2;www.ncbi.nlm.nih.gov/genbank;《www.ncbi.nlm.nih.gov/genbank》;20080216;全文 * |
| Genbank Accession：AP014957.1;www.ncbi.nlm.nih.gov/genbank;《www.ncbi.nlm.nih.gov/genbank》;20151010;全文 * |
| 水稻种胚特异性启动子OsESP1的克隆及其表达特性;房孝良 等;《作物学报》;20110728;第37卷(第10期);1904-1909 * |
| 水稻组织特异启动子的克隆及功能分析;魏晶;《中国优秀硕士学位论文全文数据库农业科技辑》;20120515;D047-39 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104419707A (en) | 2015-03-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP6889301B2 (en) | Plant control elements and their use | |
| JP2022089861A (en) | Plant regulatory elements and methods of use thereof | |
| CN103275983B (en) | Gene promoter for stress induction expression and application of gene promoter | |
| CN104962557B (en) | MiRNA target genes analogies, expression casette, expression vector and application based on miR167 | |
| CN107805632A (en) | OsMKK6 albumen and encoding gene are in the regulation and control developmental application of vegetable seeds | |
| CN105838718B (en) | A kind of stems and leaves of rice strongly expressed promoter SAFES7 and its application | |
| CN105524933B (en) | OsJMJ714 influences the function and its application of rice grain size and salt stress patience | |
| CN104419707B (en) | Specificity promoter and its application in EMBRYO IN RICE | |
| CN104651359B (en) | The bidirectional promoter separated from corn and its application | |
| CN103667296A (en) | Constitutive expression promoter and application thereof | |
| CN105087589B (en) | A kind of promoter element OsEmb2 and the methods and applications that transgenic paddy rice is cultivated using it | |
| CN106191073A (en) | HOX3 gene purposes in improvement cotton fiber elongation character | |
| JP2022081655A (en) | Plant regulatory elements and uses thereof | |
| CN107058324A (en) | Rice root specific expression promoter POsRO4 and corresponding rice cultivating method | |
| CN105061570B (en) | Plant amylum synthesis associated protein IbSSI and its encoding gene and application | |
| CN105985958B (en) | Leguminous plant leaf tissue specificity promoter and its application | |
| CN104152454B (en) | Derive from drought-induced promoter GmMYB363P and the application thereof of soybean | |
| CN103882021B (en) | One Plants drought-induced expression promoter PosDro1 and application thereof | |
| CN104341514B (en) | The application of rice transcription factor Os03g05590.1 gene C DS sequences | |
| CN106434692A (en) | Applications of rice OsPCF7 gene in culturing high-tillering rice varieties | |
| CN102121006B (en) | Plant pathogenic bacterium induction type ethylene response factor gene promoter sequence and application thereof | |
| CN105602956B (en) | A kind of paddy pollen strongly expressed promoter OsPoll4 and its application | |
| CN104673792B (en) | Legume beanpod linked groups' specificity promoter and its application | |
| CN104673793B (en) | Legume root system tissue-specific promoter and its application | |
| CN1687423A (en) | Method for direct breeding transgene paddy rice with out resistance selection tag |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20170929 Termination date: 20200905 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |