CN104962557B - MiRNA target genes analogies, expression casette, expression vector and application based on miR167 - Google Patents
MiRNA target genes analogies, expression casette, expression vector and application based on miR167 Download PDFInfo
- Publication number
- CN104962557B CN104962557B CN201510369758.7A CN201510369758A CN104962557B CN 104962557 B CN104962557 B CN 104962557B CN 201510369758 A CN201510369758 A CN 201510369758A CN 104962557 B CN104962557 B CN 104962557B
- Authority
- CN
- China
- Prior art keywords
- analogies
- mir167
- grain
- expression
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of miRNA target genes analogies, expression casette, expression vector and application based on miR167, belong to plant biotechnology field.The present invention constructs endosperm specificity promoter Gt13a driving target gene analogies and the binary vector of random target fragment analogies low expression miR167, utilize During Agrobacterium rice embryo callus, transgenic positive plant is obtained by screening, breaking up, by identifying the relevant phenotype of transfer-gen plant grain yield, show that the expression quantity of miR167 in each transgenic line endosperm is significantly lowered, and the mass of 1000 kernel of each transgenic line maturity period brown rice, grain length, grain are wide and grain is thick is improved significantly.
Description
Technical field
The present invention relates to a kind of miRNA target gene analogies based on miR167, also relate to include the miRNA target bases
Because of the expression casette, expression vector and application of analogies, belong to plant biotechnology field.
Background technology
Food shortage is one of global problem of this century most serious, continuous since population increases rapidly in order to meet
Widened grain demand, world food total output to the year two thousand fifty need increase by 70% (Tester and Langridge, 2010),
Yield of grain in China needed raising 35% (Zhang, 2011) by 2033.Rice as one of most important cereal crops,
21% of energy needed for world population, 76% of energy needed for the population of Southeast Asia be all from rice (Fitzgerald et al.,
2009).Therefore, improving the yield of rice and improving rice quality has important strategic importance.
MiRNA is a kind of small molecule of the non-coding protein for the 19-24 base being widely present in eucaryote
RNA, is sheared by base pair complementarity principle or the expression of Translational repression its target gene on post-transcriptional level, is adjusting plant
Growth and development, stress response, hormone stable state, have the function that important (Chen, 2009) during the morphogenesis of organ etc..
The growth and development of rice grain needs to coordinate the Physiological and Biochemical Metabolism process respectively organized inside seed, and the formation of seed again with plant
The procreation of thing is closely bound up, therefore miRNAs may also assist in the growth and development of seed.Zhu etc. (Zhu et al., 2008) with
The rice grain of after fertilization 1-5d and 6-10d are research object, identify 39 miRNA that are new, not guarding, and most
Expression quantity of the miRNA in after fertilization 6-10d is higher than after fertilization 1-5d's.Xue etc. (Xue et al., 2009) is using extensive flat
Row sequencing technologies have studied effects of the miRNA in rice grain growth course, identify 26 it is new and 12 candidates
MiRNA, and predict that the miRNA such as miR397 participate in the growth and development of adjusting and controlling rice seed.Lan etc. (Lan et al., 2012) exists
21 conservative and 91 not conservative miRNA families are identified in long-grained nonglutinous rice Kernel, wherein having 50% or so miRNA's
Expression quantity is in gradual increased variation tendency with the developmental process of seed, and the other half is in be gradually reduced with the developmental process of seed
Variation tendency.Yi etc. (Yi et al., 2013) identifies 434 known miRNA in rice grain growth course, its
In have 162 differential expressions, and the expression quantity of major part miRNA 5-7 days is in the developmental process of seed in seed after fertilization
The variation tendency gradually risen.In conclusion miRNA may have important adjustment effect in rice grain development.
In recent years, applicant is using the conventional japonica rice kind Xinfeng No.2 that Superiors grains and Inferior grain circularity differ greatly to grind
Study carefully material, strong, the Inferior grain miRNA for enriching different times to being in the milk with large-scale parallel sequencing technology Solexa are surveyed
Sequence, finds most of miRNA with strong, Inferior grain Filling velocity in gradually increased variation tendency, and big in these miRNA
Partial expression quantity is significantly higher than Inferior grain in Superiors grains.These differential expressions miRNA is proved by bioinformatic analysis
The endogenous hormones of rice, cell division, Starch synthesis and signal transduction etc. may be regulated and controled, table by regulating and controlling target gene
Low bright miRNAs expression quantity is probably that Inferior grain Grain filling is poor, a low reason of final grain weight (Peng et al.,
2011；Peng et al.,2014).
The content of the invention
The object of the present invention is to provide a kind of miRNA target gene analogies based on miR167.
Secondly, the present invention also provides a kind of expression casette for including above-mentioned miRNA target genes analogies.
Again, the present invention also provides a kind of expression vector comprising above-mentioned miRNA target genes analogies or expression casette.
Finally, the present invention also provides a kind of above-mentioned miRNA target genes analogies, expression casette or expression vector to cultivate
Application in (high yield) rice strain and raising rice yield.
In order to realize the above object the technical solution adopted in the present invention is：
MiRNA target gene analogies based on miR167, are specially miR167 target genes analogies or the random targets of miR167
Fragment analogies, the nucleotide sequence of miR167 target gene analogies is as shown in SEQ ID NO.1, the random target fragment moulds of miR167
Intend the nucleotide sequence of thing as shown in SEQ ID NO.2.
SEQ ID NO.1：
5’-GGTACC(KpnI)TCTACTAAGGCAGATCATGCTCAA(insertion) GGCAGCTTCAATTATTCGGTGGATCC(BamHI)-3’.Italicized item is the skeleton structure of OsIPS1, and underscore part is
The binding site of miR167.
SEQ ID NO.2：
5’-GGTACC(KpnI) TAGATCATGCTCTA(insertion) GGCAGCTTCAGTTGTTGTTGTTATGGTCTAATTTAAATATGGTCTAAAGAAGAAGAAT(Spacer) CAGATCATGCTCTA(insertion) GGCAGCTTCAGGATCC(BamHI)-3’.Underscore part is the binding site of miR167.
Expression casette, the nucleotide sequence (as shown in SEQ ID NO.1) comprising miR167 target gene analogies or
The nucleotide sequence of the random target fragment analogies of miR167 (as shown in SEQ ID NO.2).Expression casette can also include
Gt13a promoter genes sequence and NOS terminator gene order, Gt13a promoter genes sequence as shown in SEQ ID NO.3,
NOS terminator gene order is as shown in SEQ ID NO.4.
SEQ ID NO.3：
5’-GAATTC(EcoRI)TGAGTAATGTGTGAGCATTATGGGACCACGAAATAAAAAAAGAACATTTTTATGA
GCAGTGTGTTCTCAATGAGCCTTGAATGTTATCACCCAGGATAAGAAACCCTTAAGCAATGAAACATGCAAGCGTTT
AATGTGCAAAGTTGGCATTCTCCACGACATAATGCAAAAGAAGATATAATCTATGACATAGCAAGTCATGCATCATT
TCATGCCTCTGTCAACCTATTCATTTCTAGTCATCTAGGTAAGTATCTTAAGCTAAAGTGTTAGAACTTCCCATACA
TAAGTCATAACTGATGACAATTGGGTGTAACACATGACAAACCAGAGAGTCAAGCAAGATAAAGCAAAAGGATGTGT
ACATAAAACTACAGAGCTATATGTCATGTTGCGAAAAGAGGAGAGCTTATAAGACAAGCCATGACTCAAAAAAAATT
CACATGCCTACTGTGGCCCATATATCATGCAACAATCCAAAAACTCACAGGTCTCGGTGTTGATCGTGTCAACATGT
GACCACCCTAAAAACTCTTCACTAAATATTAAAGTATTGCTAGAACAGAGCTTCAAGATATAAGTCATGATCACCAA
CAACCATGTTCAAAAAGAAATAGAAAGCTATGGCACAGCAACAAAAAGCAAAAGCATGCATGGATATAATCTTTAAC
ATCATCCATGTCATATTGCAAAAGAAAGAAAGAGAGAACAATACAAATGATGTGTCAATTACACATCCATCATTATC
CATCCACCTTCCGTGTACCACACTTCATATATCATGAGTCACTTCATGTCTGGACATTAACAAACTCTATCTTAACA
TTCAAATGCATGAGACTTTATCTCACTATAAATGCACAATGATTTAGCATTGTTTCTCACAAAACCATTCAAGTTCA
TTAGTACTACAACAAC(Gt13a promoter)GAGCTC(SacI)-3’。
SEQ ID NO.4：
5’-CTGCAG(PstI)CGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTTGC
GATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAACATGTAATGCATGACGTTATTTATGA
GATGGGTTTTTATGATTAGAGTCCCGCAATTATACATTTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAG
GATAAATTATCGCGCGCGGTGTCATCTATGTTACTAGATCGGG(NOS terminator)AAGCTT(HindIII)-3’。
Specifically, the nucleotide sequence of the expression casette based on miR167 target gene analogies such as SEQ ID NO.5 institutes
Show, the nucleotide sequence of the expression casette based on the random target fragment analogies of miR167 is as shown in SEQ ID NO.6.
SEQ ID NO.5：
5’-GAATTC(EcoRI)TGAGTAATGTGTGAGCATTATGGGACCACGAAATAAAAAAAGAACATTTTTATGA
GCAGTGTGTTCTCAATGAGCCTTGAATGTTATCACCCAGGATAAGAAACCCTTAAGCAATGAAACATGCAAGCGTTT
AATGTGCAAAGTTGGCATTCTCCACGACATAATGCAAAAGAAGATATAATCTATGACATAGCAAGTCATGCATCATT
TCATGCCTCTGTCAACCTATTCATTTCTAGTCATCTAGGTAAGTATCTTAAGCTAAAGTGTTAGAACTTCCCATACA
TAAGTCATAACTGATGACAATTGGGTGTAACACATGACAAACCAGAGAGTCAAGCAAGATAAAGCAAAAGGATGTGT
ACATAAAACTACAGAGCTATATGTCATGTTGCGAAAAGAGGAGAGCTTATAAGACAAGCCATGACTCAAAAAAAATT
CACATGCCTACTGTGGCCCATATATCATGCAACAATCCAAAAACTCACAGGTCTCGGTGTTGATCGTGTCAACATGT
GACCACCCTAAAAACTCTTCACTAAATATTAAAGTATTGCTAGAACAGAGCTTCAAGATATAAGTCATGATCACCAA
CAACCATGTTCAAAAAGAAATAGAAAGCTATGGCACAGCAACAAAAAGCAAAAGCATGCATGGATATAATCTTTAAC
ATCATCCATGTCATATTGCAAAAGAAAGAAAGAGAGAACAATACAAATGATGTGTCAATTACACATCCATCATTATC
CATCCACCTTCCGTGTACCACACTTCATATATCATGAGTCACTTCATGTCTGGACATTAACAAACTCTATCTTAACA
TTCAAATGCATGAGACTTTATCTCACTATAAATGCACAATGATTTAGCATTGTTTCTCACAAAACCATTCAAGTTCA
TTAGTACTACAACAAC(Gt13a promoter)GAGCTC(SacI)GGTACC(KpnI)TCTACTAAGGCAGATCATGCTCAA(insertion) GGCAGCTTCAATTATTCGGT(MIM167)GGATCC(BamHI)TCTAGA(XbaI)GTCGAC(SalI)CTGCAG(PstI)
CGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTTGCGATGATTATCATATAATTTCT
GTTGAATTACGTTAAGCATGTAATAATTAACATGTAATGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAG
TCCCGCAATTATACATTTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGCGCGGTG
TCATCTATGTTACTAGATCGGG(NOS terminator)AAGCTT(HindIII)-3’。
SEQ ID NO.6：
5’-GAATTC(EcoRI)TGAGTAATGTGTGAGCATTATGGGACCACGAAATAAAAAAAGAACATTTTTATGA
GCAGTGTGTTCTCAATGAGCCTTGAATGTTATCACCCAGGATAAGAAACCCTTAAGCAATGAAACATGCAAGCGTTT
AATGTGCAAAGTTGGCATTCTCCACGACATAATGCAAAAGAAGATATAATCTATGACATAGCAAGTCATGCATCATT
TCATGCCTCTGTCAACCTATTCATTTCTAGTCATCTAGGTAAGTATCTTAAGCTAAAGTGTTAGAACTTCCCATACA
TAAGTCATAACTGATGACAATTGGGTGTAACACATGACAAACCAGAGAGTCAAGCAAGATAAAGCAAAAGGATGTGT
ACATAAAACTACAGAGCTATATGTCATGTTGCGAAAAGAGGAGAGCTTATAAGACAAGCCATGACTCAAAAAAAATT
CACATGCCTACTGTGGCCCATATATCATGCAACAATCCAAAAACTCACAGGTCTCGGTGTTGATCGTGTCAACATGT
GACCACCCTAAAAACTCTTCACTAAATATTAAAGTATTGCTAGAACAGAGCTTCAAGATATAAGTCATGATCACCAA
CAACCATGTTCAAAAAGAAATAGAAAGCTATGGCACAGCAACAAAAAGCAAAAGCATGCATGGATATAATCTTTAAC
ATCATCCATGTCATATTGCAAAAGAAAGAAAGAGAGAACAATACAAATGATGTGTCAATTACACATCCATCATTATC
CATCCACCTTCCGTGTACCACACTTCATATATCATGAGTCACTTCATGTCTGGACATTAACAAACTCTATCTTAACA
TTCAAATGCATGAGACTTTATCTCACTATAAATGCACAATGATTTAGCATTGTTTCTCACAAAACCATTCAAGTTCA
TTAGTACTACAACAAC(Gt13a promoter)GAGCTC(SacI)GGTACC(KpnI) TAGATCATGCTCTA(insertion) GGCAGCTTCAGTTGTTGTTGTTATGGTCTAATTTAAATATGGTCTAAAGAAGAAGAAT(Spacer) CAGATCATGCTCTA(insertion) GGCAGCTTCAGGATCC(BamHI)TCTAGA(XbaI)GTCGAC(SalI)CTGCAG(PstI)
CGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTTGCGATGATTATCATATAATTTCT
GTTGAATTACGTTAAGCATGTAATAATTAACATGTAATGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAG
TCCCGCAATTATACATTTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGCGCGGTG
TCATCTATGTTACTAGATCGGG(NOS terminator)AAGCTT(HindIII)-3’。
Expression vector, the nucleotide sequence (as shown in SEQ ID NO.1) comprising miR167 target gene analogies or
The nucleotide sequence of the random target fragment analogies of miR167 (as shown in SEQ ID NO.2).Expression vector can also include Gt13a
Promoter gene sequence (as shown in SEQ ID NO.3) and NOS terminator gene order (as shown in SEQ ID NO.4).
Specifically, expression vector includes the nucleotide sequence of the expression casette based on miR167 target gene analogies (such as
Shown in SEQ ID NO.5) or expression casette based on the random target fragment analogies of miR167 nucleotide sequence (such as SEQ ID
Shown in NO.6).Expression vector can also include nucleotide sequence (the NCBI Accession of carrier pCAMBIA1302
NO.AF234298).For example, expression vector includes the nucleotide sequence of binary expression vector pCAMBIA1302-Gt13a-NOS,
The nucleotide sequence of binary expression vector is as shown in SEQ ID NO.7.
More specifically, the nucleotide sequence of the expression vector based on miR167 target gene analogies such as SEQ ID NO.8 institutes
Show, the nucleotide sequence of the expression vector based on the random target fragment analogies of miR167 is as shown in SEQ ID NO.9.
Application of the miRNA target genes analogies in cultivating (high yield) rice strain and improving rice yield.Wherein,
MiRNA target genes analogies are miR167 target genes analogies (as shown in SEQ ID NO.1) or the random target fragment moulds of miR167
Intend thing (as shown in SEQ ID NO.2).
Application of the expression casette in cultivating (high yield) rice strain and improving rice yield.Wherein, expression casette
Nucleotide sequence (as shown in SEQ ID NO.1) or the random target fragment analogies of miR167 comprising miR167 target gene analogies
Nucleotide sequence (as shown in SEQ ID NO.2).Expression casette can also include Gt13a promoter gene sequences (such as SEQ
Shown in ID NO.3) and NOS terminator gene order (as shown in SEQ ID NO.4).Specifically, it is based on miR167 target gene moulds
Intend the nucleotide sequence of the expression casette of thing as shown in SEQ ID NO.5, the base based on the random target fragment analogies of miR167
Because the nucleotide sequence of expression cassette is as shown in SEQ ID NO.6.
Application of the expression vector in cultivating (high yield) rice strain and improving rice yield.Wherein, expression vector includes
The nucleotide sequence (as shown in SEQ ID NO.1) of miR167 target gene analogies or the core of the random target fragment analogies of miR167
Nucleotide sequence (as shown in SEQ ID NO.2).Expression vector can also include Gt13a promoter genes sequence (such as SEQ ID
Shown in NO.3) and NOS terminator gene order (as shown in SEQ ID NO.4).Specifically, expression vector, which includes, is based on miR167
The nucleotide sequence (as shown in SEQ ID NO.5) of the expression casette of target gene analogies or based on the random target fragments of miR167
The nucleotide sequence of the expression casette of analogies (as shown in SEQ ID NO.6).Expression vector can also include expression vector
The nucleotide sequence (NCBI Accession NO.AF234298) of pCAMBIA1302.For example, expression vector is expressed comprising double base
The nucleotide sequence of carrier pCAMBIA1302-Gt13a-NOS (as shown in SEQ ID NO.7).More specifically, based on miR167
The nucleotide sequence of the expression vector of target gene analogies is as shown in SEQ ID NO.8, based on the random target fragment simulations of miR167
The nucleotide sequence of the expression vector of thing is as shown in SEQ ID NO.9.
Application of the above-mentioned expression vector in cultivating (high yield) rice strain and improving rice yield, comprises the following steps：
Take expression vector to convert Agrobacterium, disseminate Rice Callus, identify that transgenic positive is planted after screening, breaking up after co-cultivation
Strain；Identify that the primer sequence used is as follows：
Gt13a VF：5 '-TATCCATCCACCTTCCGTGT-3 ' (as shown in SEQ ID NO.12),
Gt13a VR：5 '-GCAACAGGATTCAATCTTAA-3 ' (as shown in SEQ ID NO.13).
Beneficial effects of the present invention：
By miR167 in analyzing rice kernel grouting process in the strong Inferior grain of rice change dynamic and differential expression,
It was found that in Grain Filling Process, the expression quantity of surging seed miR167 is in gradual increased variation tendency, Inferior grain miR167
Expression quantity in increased variation tendency after first reducing, and rice is strong, the negatively correlated relation of filling rate of Inferior grain, and
MiR167 differential expressions in strong, Inferior grain, wherein miR167d, f-h, j Superiors grains in after spending 10 days, 15 days and 21 days
Gene expression abundance be the 2.96 of Inferior grain, 9.38 and 4.23 times respectively, show that miR167 is adjusted during Grain Filling of Rice
The grouting of rice grain is enriched, and then determines the size of rice grain.
For further verification miR167 and the relation of rice grain size, present invention structure endosperm specificity promoter
Gt13a driving target gene analogies (Taget Mimic, MIM) and random target fragment analogies (Short Tandem Target
Mimic, STTM) low expression miR167 binary vector, using During Agrobacterium rice embryo callus, by screening, point
Change obtains transgenic positive plant, by identifying the relevant phenotype of transfer-gen plant grain yield, the results showed that：Each turn
The expression quantity of miR167 is significantly lowered in gene strain endosperm, and the mass of 1000 kernel of each transgenic line maturity period brown rice, grain length,
Grain is wide and grain thickness is improved significantly.
The present invention constantly increases for current census and the ever-increasing present situation of grain demand, and water is being adjusted using miRNA
The effect of rice yield traits, inquires into functions of the miRNA in rice varieties improvement, so that providing miR167 is cultivating high yield water
Rice, especially by increase mass of 1000 kernel, and then increases the application in yield.Have the characteristics that compared with prior art：Due to
Low expression miR167 can significantly increase size and the mass of 1000 kernel of rice grain, the miRNA target bases based on miR167 in the present invention
Because analogies, expression casette, expression vector can provide a kind of simple and effective technology hand to cultivate high-yield rice new lines
Section, is conducive to large-scale promotion use；The present invention cultivates high-yield rice using molecular improvement technology, can not only improve rice
Yield, and environment will not be polluted, edible safety.
Brief description of the drawings
Fig. 1 is the design drawing of miR167 target genes analogies (MIM167) in the embodiment of the present invention 1；
Fig. 2 is the design drawing of the random target fragment analogies (STTM167) of miR167 in embodiment 2；
Fig. 3 is the expression quantity point that MIM167 and STTM167 transgenic lines spend miR167 in rear 10 days endosperm in embodiment 9
Analysis figure；
Fig. 4 is that wild type control, MIM167 and STTM167 transgenic line maturity period brown rice appearances compare in embodiment 10
Figure；
Fig. 5 is wild type control, the variance analysis figure of MIM167 and STTM167 transgenic line brown rice mass of 1000 kernel；
Fig. 6 is wild type control, the variance analysis figure of MIM167 and STTM167 transgenic line brown rice grain lengths；
The variance analysis figure that Fig. 7 is wild type control, MIM167 and STTM167 transgenic line brown rices are wide；
Fig. 8 is wild type control, the variance analysis figure of MIM167 and STTM167 transgenic lines brown rice thickness.
Embodiment
Following embodiments are only described in further detail the present invention, but do not form any limitation of the invention.
Embodiment 1
The design of miR167 target genes analogies (MIM167)：
From miRNA database miRBase (http://www.mirbase.org/index.shtml) in download miR167
Ripe miRNA sequence, Accession number are MIMAT0000641 (osa-miR167a-5p), IMAT0000642
(osa-miR167b-5p)、MIMAT0000643(osa-miR167c-5p)、MIMAT0001039(osa-miR167d-5p)、
MIMAT0001040(osa-miR167e-5p)、MIMAT0001041(osa-miR167f)、MIMAT0001042(osa-
MiR167g), MIMAT0001043 (osa-miR167h-5p), MIMAT0001044 (osa-miR167i-5p) and
MIMAT0001086 (osa-miR167j), according to the target of Franco-Zorrilla etc. (Nature genetics, 2007) inventions
Gene analogies (MIM) design MIM167, its nucleotide sequence is as shown in SEQ ID NO.1.Target gene analogies and miR167
Sequence is complementary, but analogies are inserted into 3 bases in miR167 from the position between 5 ' the 10th bit bases of end and the 11st bit base, from
And miR167 is caused to form a projection between the 10th bit base and the 11st bit base when being matched with analogies.The structure of MIM167
The method with reference to Todesco etc. (PLoS genetics, 2010) is built using rice Os IPSI as template, designs two complementary pairings
Oligonucleotide primer containing BamHI and KpnI cohesive ends, the nucleotide sequence of primer I as shown in SEQ ID NO.10,
The nucleotide sequence of primer II is as shown in SEQ ID NO.11.The design drawing of miR167 target genes analogies (MIM167) is shown in Fig. 1.
The preparation of miR167 target gene analogies, comprises the following steps：
(1) (contained according to the ripe miRNA sequence of miR167 in miRNA databases miRBase, two complementary pairings of design
Have BamHI and KpnI cohesive ends) oligonucleotide primer (primer I and primer II), the nucleotide sequence such as SEQ of primer I
Shown in ID NO.10, the nucleotide sequence of primer II is as shown in SEQ ID NO.11；
SEQ ID NO.10：
5’-CTCTACTAAGGCAGATCATGCTCAA(insertion) GGCAGCTTCAATTATTCGGTG-3 ', italicized item
For the skeleton structure of OsIPSI, underscore part is the binding site of miR167, and thickened portion is KpnI and BamHI restriction enzyme sites
Cohesive end sequence；
SEQ ID NO.11：
5’-GATCCACCGAATAATTGAAGCTGCCTTG(insertion) AGCATGATCTGCCTTAGTAGAGGTAC-3 ',
Italicized item is the skeleton structure of OsIPSI, and underscore part is the binding site of miR167, and thickened portion is KpnI and BamHI
Restriction enzyme site cohesive end sequence；
(2) primer I and primer II (Sheng Gong bioengineering Co., Ltd synthesizes by Shanghai) are diluted to 10 μM of ol/L, in equal volume
Mixing is placed in PCR instrument, and room temperature is slowly dropped to after 95 DEG C of 10min, as stand-by on ice, product be containing KpnI and
The miR167 target genes analogies of BamHI restriction enzyme site cohesive ends (as shown in SEQ ID NO.1).
Embodiment 2
The design of the random target fragment analogies (STTM167) of miR167：
From miRNA database miRBase (http://www.mirbase.org/index.shtml) in download miR167
Ripe miRNA sequence, Accession number are MIMAT0000641 (osa-miR167a-5p), IMAT0000642
(osa-miR167b-5p)、MIMAT0000643(osa-miR167c-5p)、MIMAT0001039(osa-miR167d-5p)、
MIMAT0001040(osa-miR167e-5p)、MIMAT0001041(osa-miR167f)、MIMAT0001042(osa-
MiR167g), MIMAT0001043 (osa-miR167h-5p), MIMAT0001044 (osa-miR167i-5p) and
MIMAT0001086 (osa-miR167j), with reference to the random target fragment simulation of Yan etc. (The Plant cell, 2012) invention
Thing (STTM) designs STTM167, its nucleotide sequence is as shown in SEQ ID NO.2.Target gene analogies and miR167 sequences are mutual
Mend, but analogies are inserted into 3 bases in miR167 from the position between 5 ' the 10th bit bases of end and the 11st bit base, so as to cause
A projection is formed when miR167 is matched with analogies between the 10th bit base and the 11st bit base.Two target gene analogies
Arrange in a series arrangement, the intermediate sequence of 48nt is added among both.The design of the random target fragment analogies (STTM167) of miR167
Figure is shown in Fig. 2.
The preparation of the random target fragment analogies of miR167, comprises the following steps：
(1) according to the random target fragment analogies of one section of miR167 of sequence design of miR167, it is simulated by two target genes
The intermediate sequence of thing and 48nt composition, target gene analogies are complementary with miR167 sequences, but analogies in miR167 from 5 '
Hold position between the 10th bit base and the 11st bit base to be inserted into 3 bases, thus when causing the miR167 to be matched with analogies
A projection is formed between 10th bit base and the 11st bit base.Two target gene analogies arrange in a series arrangement, Liang Zhezhong
Between plus 48nt intermediate sequence, its structure and sequence are as shown in Fig. 2 and SEQ ID NO.2；
(2) KpnI and BamHI restriction enzyme sites are added respectively at 5 ' ends of random target fragment analogies and 3 ' ends, it is sent to
Hai Shenggong bioengineering Co., Ltd is synthesized.
Embodiment 3
The preparation of expression vector based on miR167 target gene analogies, comprises the following steps：
(1) double digestion is carried out to pCAMBIA1302-Gt13a-Nos carriers using KpnI and BamHI, then utilizes Tiangeng
DNA purifying QIAquick Gel Extraction Kit carries out purifying recycling；
(2) the miR167 target genes analogies containing KpnI and BamHI restriction enzyme site cohesive ends in embodiment 1 are added
In pCAMBIA1302-Gt13a-Nos carriers after KpnI and BamHI double digestions, 4 DEG C of connections are overnight；
(3) connection product is converted to DH5 ɑ competent cells, and on the kanamycins tablet containing 50mg/L, and 37 DEG C are fallen
Put culture 16h；
(4) after bacterium colony PCR preliminary identifications, it is sent to Shanghai Sheng Gong bioengineering Co., Ltd and carries out sequence verification, sequence is such as
SEQ ID NO.8。
In the construction method of pCAMBIA1302-Gt13a-Nos carriers and the patent of invention of publication No. CN103710341A
The construction method of pCAMBIA1301-Gt13a-Nos carriers is essentially identical, unique the difference is that being built in the present invention
PCAMBIA1302-Gt13a-Nos carriers use pCAMBIA1302 initial carriers, and in patent document using
pCAMBIA1301。
Embodiment 4
The preparation of expression vector based on the random target fragment analogies of miR167, comprises the following steps：
(1) double digestion is carried out to pCAMBIA1302-Gt13a-Nos carriers using KpnI and BamHI, then utilizes Tiangeng
DNA purifying QIAquick Gel Extraction Kit carries out purifying recycling；
(2) double enzymes are carried out to the random target fragment analogies of miR167 artificial synthesized in embodiment 2 using KpnI and BamHI
Cut, then carry out purifying recycling using Tiangeng DNA purifying QIAquick Gel Extraction Kit；
(3) connection of digestion products：Random target fragment target gene analogies KpnI and the BamHI digestion products of miR167 are added
Enter into the pCAMBIA1302-Gt13a-Nos carriers after KpnI and BamHI double digestions, 4 DEG C of connections are overnight；
(4) connection product is converted to DH5 ɑ competent cells, and on the kanamycins tablet containing 50mg/L, and 37 DEG C are fallen
Put culture 16h；
(5) after bacterium colony PCR preliminary identifications, it is sent to Shanghai Sheng Gong bioengineering Co., Ltd and carries out sequence verification, sequence is such as
SEQ ID NO.9。
Embodiment 5
Expression vector rice transformation kind Nipponbare based on miRNA target gene analogies, comprises the following steps：
1st, pCAMBIA1302-Gt13a-MIM167-NOS and pCAMBIA1302-Gt13a-STTM167-NOS conversions agriculture bar
Bacterium EHA105 bacterial strains
(1) two kind of expression vector takes 1 μ g to be added in the Agrobacterium competent cell that 200 μ l dissolve on ice respectively, light mixed, ice
30min is bathed, quick-frozen 5min, 37 DEG C of water-bath 5min, then rapid ice bath 2min in liquid nitrogen；
(2) 800 μ l LB fluid nutrient mediums (being free of antibiotic), 28 DEG C of jog 5h (4~6h) are added；
(3) thalline centrifuges, and removes supernatant, be coated on after remaining thalline resuspension on YM selection tablets (Kan 50mg/L,
1) Rif 50mg/L, see the table below, 28 DEG C are inverted culture 2 days.
1 YM medium components of table
2nd, Rice Callus, the screening of transgenic positive plant, differentiation and identification method are disseminated：
(1) 70% ethanol surface sterilization 3min (2~4min) of Rice seeds, aqua sterilisa cleaning 2 times, acutely
Shake；
(2) 30min is sterilized with 1.5% sodium hypochlorite of effective chlorine density (adding 1 drop tween), 5 is cleaned with aqua sterilisa after disinfection
Secondary (5~6 times)；
(3) seed is placed on 2N6 culture mediums and (see the table below 2), 28 DEG C of 4 week Ban of light culture (4~5 Zhou Junke)；
(4) picking is faint yellow, granular callus, is transferred to preculture (5~7 days 6 days on new 2N6 culture mediums
) after infect；
(5) the Agrobacterium single bacterium colony of picking plasmid containing purpose, 500 μ l YM fluid nutrient mediums (50mg/L Kan, 50mg/L
Rif it is muddy to thalline) to shake bacterium 36h (24~48h), that is, uses or be placed in 4 DEG C of preservations；
(6) Agrobacterium inoculation of bacterium preservation will be shaken for the first time in YM fluid nutrient mediums (50mg/L Kan, 50mg/L Rif)
In, bacterium is shaken in triangular flask and is stayed overnight, cultivates to OD600 and reaches 0.9 (0.8~1.0), adds 30 μ l AS (100mM) room temperatures afterwards
Callus is directly used in after placement 2h (2~3h) to infect；
2 2N6 medium components of table
(7) callus after preculture is immersed in above-mentioned Agrobacterium bacterium solution, places 15min under room temperature, and shake frequently
It is dynamic, callus is taken out, unnecessary bacterium solution is sucked on aseptic paper, is dried up, one layer of nothing is covered with callus is transferred to
The solidified co-cultivation medium 2N6-AS (see the table below 3) of bacterium filter paper, 23 DEG C of light cultures 3 days；
3 2N6-AS medium components of table
(8) callus after co-culturing first is cleaned with aqua sterilisa, is washed till supernatant clarification, then blue or green with 500mg/L carboxylics benzyl again
Mycin solution soaks 10min, then removes supernatant, and callus is placed in suck dry moisture on sterilizing-drying filter paper, replaces filter paper, is surpassed
Continue to air-dry 30~60min (45min) on net platform, be transferred to after callus drying on 2N6-S culture mediums (see the table below 4), 28 DEG C dark
Culture, every 2 weeks subculture once, step sizing 3 times；
4 2N6-S screening and culturing based components of table
(9) kanamycin-resistant callus tissue is transferred in triangular flask on differential medium N6-R (see the table below 5), 28 DEG C of light cultures are after a week
Illumination cultivation (16h illumination/8h is dark), 1/2MS is gone to when seedling length to 2.5 centimetres (2~3 centimetres) are broken up by seedling
Take root on root media (see the table below 6)；
5 differential medium N6-R components of table
6 1/2MS medium components of table
(10) after seedling to be regenerated grows root system, open sealed membrane and add a small amount of water (~1cm is deep), (3~5 days in 4 days for hardening
Can) be loaded into later in native alms bowl；
(11) Rice Seedling Leaves are extracted into DNA, PCR positive identifications are carried out using MIM167 and STTM167 both sides primer,
Primer sequence is：
Gt13a VF：5 '-TATCCATCCACCTTCCGTGT-3 ' (as shown in SEQ ID NO.12),
Gt13a VR：5 '-GCAACAGGATTCAATCTTAA-3 ' (as shown in SEQ ID NO.13).
Test example
The detection of transfer-gen plant miR167 expression quantity：
The expression quantity of miR167 is measured using the method for stem-loop qRT-PCR.Transfer-gen plant and non-turn base
Because wild rice spends the extraction of rear 10 days endosperm total serum IgEs to be carried out with RNA extracts kits, then using HiFi-MMLV cDNA
Kit reverse transcriptions take 5 μ l by 1 into cDNA:20 diluted cDNA do template, and 20 μ l of configuration contain 10 μ l UltraSYBR
Mixture reaction systems, using β-actin as reference gene, carry out real-time fluorescence quantitative PCR, instead on BioRad Iq5 instruments
Answer program：95 DEG C of pre-incubation 10min, 95 DEG C of denaturation 30s, 60 DEG C of annealing 30s, 72 DEG C of extension 30s, 40 circulate.All PCR are equal
3 repetitions are set, and relative expression quantity is calculated with 2- △ △ Ct methods, and the result is shown in Fig. 3.From figure 3, it can be seen that transfer-gen plant
MIM167 and STTM167 spends the expression quantity of miR167 in rear 15 days endosperm to be decreased obviously compared with non-transgenosis WT lines.
Transfer-gen plant seed phenotypic analysis：
The separate transgenic strain that miR167 expression quantity reduces in MIM167 and STTM167 transgenic lines is chosen respectively,
And grain thick carry out species test wide to grain weight, grain length, the grain of the transgenic line brown rice of expression quantity reduction, average value and standard error pass through
20 repetition experiments obtain, and the result is shown in Fig. 4-8.From Fig. 4-8 as can be seen that each turn of MIM167 and STTM167 low expressions miR167
The seed mass of 1000 kernel of gene strain, grain length, grain are wide and thick compareed than non-transgenosis wild rice of grain substantially increases, and each turn
For gene strain brown rice mass of 1000 kernel amplification more than 4.98%, wherein STTM167-17 brown rice mass of 1000 kernel is maximum, reaches 25.21g,
20.63g than control increases 4.58g, and amplification is up to 22.18%.
Claims (6)
1.miRNA target genes analogies improve that the mass of 1000 kernel of brown rice, grain length, grain are wide and grain it is thick in application, it is characterised in that：
The miRNA target genes analogies are miR167 target gene analogies, the nucleotide sequence such as SEQ of miR167 target gene analogies
Shown in ID NO.1.
2.miRNA target genes analogies improve that the mass of 1000 kernel of brown rice, grain length, grain are wide and grain it is thick in application, it is characterised in that：
The miRNA target genes analogies are the random target fragment analogies of miR167, the nucleotide of the random target fragment analogies of miR167
Sequence is as shown in SEQ ID NO.2.
3. expression casette improve that the mass of 1000 kernel of brown rice, grain length, grain are wide and grain it is thick in application, it is characterised in that：The base
Because expression cassette includes miRNA target gene analogies, miRNA target genes analogies are miR167 target gene analogies, miR167 targets
The nucleotide sequence of gene analogies is as shown in SEQ ID NO.1.
4. expression casette improve that the mass of 1000 kernel of brown rice, grain length, grain are wide and grain it is thick in application, it is characterised in that：The base
Because expression cassette includes miRNA target gene analogies, miRNA target genes analogies are the random target fragment analogies of miR167,
The nucleotide sequence of the random target fragment analogies of miR167 is as shown in SEQ ID NO.2.
5. expression vector improve that the mass of 1000 kernel of brown rice, grain length, grain are wide and grain it is thick in application, it is characterised in that：The expression
Carrier includes miRNA target gene analogies, and miRNA target genes analogies are miR167 target gene analogies, miR167 target genes
The nucleotide sequence of analogies is as shown in SEQ ID NO.1.
6. expression vector improve that the mass of 1000 kernel of brown rice, grain length, grain are wide and grain it is thick in application, it is characterised in that：The expression
Carrier includes miRNA target gene analogies, and miRNA target genes analogies are the random target fragment analogies of miR167, miR167 with
The nucleotide sequence of machine target fragment analogies is as shown in SEQ ID NO.2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510369758.7A CN104962557B (en) | 2015-06-26 | 2015-06-26 | MiRNA target genes analogies, expression casette, expression vector and application based on miR167 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510369758.7A CN104962557B (en) | 2015-06-26 | 2015-06-26 | MiRNA target genes analogies, expression casette, expression vector and application based on miR167 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104962557A CN104962557A (en) | 2015-10-07 |
| CN104962557B true CN104962557B (en) | 2018-05-01 |
Family
ID=54216647
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510369758.7A Active CN104962557B (en) | 2015-06-26 | 2015-06-26 | MiRNA target genes analogies, expression casette, expression vector and application based on miR167 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104962557B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109161558B (en) * | 2018-09-19 | 2022-05-06 | 深圳大学 | Construction method of monocotyledon miRNA high-efficiency overexpression vector |
| CN110157707B (en) * | 2019-05-27 | 2020-09-11 | 中国农业科学院作物科学研究所 | Application of rice miRNA and precursor gene thereof in resisting bacterial blight of rice |
| CN110157716B (en) * | 2019-06-06 | 2023-07-21 | 山东省水稻研究所 | Method for cultivating large-grain high-yield rice by simulating small RNA binding site |
| CN112094845B (en) * | 2020-09-27 | 2022-03-15 | 四川农业大学 | Nucleic acid for improving agronomic traits and resistance of plants and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102181482A (en) * | 2011-01-25 | 2011-09-14 | 中山大学 | Method for rapidly regulating activity of endogenous miRNA in rice |
| CN103710341A (en) * | 2013-12-16 | 2014-04-09 | 河南农业大学 | MiR (micro ribonucleic acid) 1432 target gene tandem stimulant, gene expression cassette, expression vector, and preparation method and application of expression vector |
-
2015
- 2015-06-26 CN CN201510369758.7A patent/CN104962557B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102181482A (en) * | 2011-01-25 | 2011-09-14 | 中山大学 | Method for rapidly regulating activity of endogenous miRNA in rice |
| CN103710341A (en) * | 2013-12-16 | 2014-04-09 | 河南农业大学 | MiR (micro ribonucleic acid) 1432 target gene tandem stimulant, gene expression cassette, expression vector, and preparation method and application of expression vector |
Non-Patent Citations (2)
| Title |
|---|
| Differentially expressed microRNA cohorts in seed development may contribute to poor grain filling of inferior spikelets in rice;Ting Peng et al.;《BMC Plant Biology》;20140723;第14卷;第2页左栏倒数第1段,图8 * |
| MicroRNA167-directed regulation of the auxin response factors GmARF8a and GmARF8b is required for soybean nodulation and lateral root development;Youning Wang et al.;《Plant Physiology》;20150504;第168卷;第104页，补充部分图6，表S3 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104962557A (en) | 2015-10-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20210289730A1 (en) | Barley and uses thereof | |
| CN1886507B (en) | Rice and products thereof having starch with an increased proportion of amylose | |
| CN105132425B (en) | For enhancing the regulatory nucleic acid molecules that constitutive gene is expressed in plant | |
| CN104962557B (en) | MiRNA target genes analogies, expression casette, expression vector and application based on miR167 | |
| CN103298940A (en) | High amylose wheat | |
| CN110699361B (en) | Rice salt stress resistance related gene Os16 and encoding protein and application thereof | |
| CN103710341B (en) | A kind of miR1432 target gene series connection stand-in, expression casette, expression vector, preparation method and application | |
| CN108660140B (en) | Application of SlSL4 gene in regulation and control of tomato fruit ripening | |
| CN106459921A (en) | Transformation of duckweed and uses thereof | |
| JP5557205B2 (en) | Barley β-glucan deletion gene, synthetic gene and use thereof | |
| CN105087640A (en) | Gene for regulating seed development of plants and application of gene | |
| CN103732747A (en) | Method for identification and isolation of terminator sequences causing enhanced transcription | |
| WO2016128998A1 (en) | Improved transgenic rice plants | |
| CN110511958A (en) | A kind of RNAi carrier of while silencing diamondback moth arginine kinase gene PxAK and integrin β_1 subunit gene Px β | |
| CN105061570B (en) | Plant amylum synthesis associated protein IbSSI and its encoding gene and application | |
| KR20230153992A (en) | Cereal grains with concentrated aleurone | |
| CN110438151A (en) | A kind of RNAi carrier and its application of the silencing diamondback moth arginine kinase gene PxAK of mediated plant | |
| CN108795942A (en) | A kind of rice external cause stress-inducing expression promoter Ps ubs3 and its application | |
| CN110734911B (en) | Application of miR159b in regulation and control of rice bacterial leaf blight resistance | |
| CN112899274B (en) | Application of miR1432 in regulation and control of rice bacterial leaf blight resistance | |
| CN117447573A (en) | Transcription factor WRKY6 for regulating capsanthin synthase gene and application thereof | |
| CN117946996A (en) | Granule type related rice protein OsCSLC2, biological material and application thereof | |
| CN114958866A (en) | Gene for regulating and controlling soybean branch number and application thereof | |
| Florez | Improving plant propagation through the manipulation of the genetic and physical environment | |
| CN117700507A (en) | Wheat high-yield early-maturing scab-resistant related protein, encoding gene TaFAH and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |