CN104962557A - miRNA-based target gene stimulant, genetic expression cassette, expression vector and application - Google Patents
miRNA-based target gene stimulant, genetic expression cassette, expression vector and application Download PDFInfo
- Publication number
- CN104962557A CN104962557A CN201510369758.7A CN201510369758A CN104962557A CN 104962557 A CN104962557 A CN 104962557A CN 201510369758 A CN201510369758 A CN 201510369758A CN 104962557 A CN104962557 A CN 104962557A
- Authority
- CN
- China
- Prior art keywords
- mir167
- stand
- target gene
- expression
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an miRNA-based target gene stimulant, a genetic expression cassette, an expression vector and application, and belongs to the technical field of plant biotechnology. A binary vector for driving a target gene stimulant and a random target fragment stimulant to conduct low expression on miR167 through an endosperm specific promoter is constructed, the agrobacterium dipped rice embryonic callus tissue is adopted, transgenosis positive plants are obtained through screening and differentiation, phenotypes related to the grain yield of the transgenosis positive plant are authenticated, and it is shown that the expression amount of the miR167 in transgenic line endosperms is obviously decreased; in addition, the thousand seed weight, the grain length, the grain width and the grain thickness of brown rice in all transgenic lines in the mature period are obviously improved.
Description
Technical field
The present invention relates to a kind of miRNA target gene stand-in based on miR167, also relate to simultaneously comprise these miRNA target gene stand-in expression casette, expression vector and application, belong to plant biotechnology field.
Background technology
Food shortage is one of the most serious global problem in this century, in order to meet the grain demand constantly expanded because population increases rapidly, world food ultimate production needs increase by 70% (Tester and Langridge to the year two thousand fifty, 2010), yield of grain in China is to needs raising in 2033 35% (Zhang, 2011).Paddy rice is as one of most important food crop, and 21% of world population institute energy requirement, needed for the population of South East Asia, 76% of energy all from paddy rice (Fitzgerald et al., 2009).Therefore, improve the output of paddy rice and improve rice quality there is important strategic importance.
MiRNA is the microRNA of the non-coding protein of a kind of 19-24 the base be extensively present in eukaryote, post-transcriptional level is sheared by base pair complementarity principle or the expression of its target gene of Translational repression, in the process such as morphogenesis of the growing of regulating plant, stress response, hormone stable state, organ, there is important effect (Chen, 2009).Growing of rice grain needs to coordinate the Physiological and Biochemical Metabolism process of the inner each tissue of seed, and the formation of seed is closely bound up with the procreation of plant again, and therefore miRNAs may also participate in growing of seed.Zhu etc. (Zhu et al., 2008) for research object, identify 39 new, not conservative miRNA with the rice grain of after fertilization 1-5d and 6-10d, and most miRNA at the expression amount of after fertilization 6-10d higher than after fertilization 1-5d's.(the Xue et al. such as Xue, 2009) extensive parallel sequencing technology is utilized to have studied the effect of miRNA in rice grain growth course, identify 26 miRNA that are new and 12 candidates, and predict that the miRNA such as miR397 participate in growing of adjusting and controlling rice seed.(the Lanet al. such as Lan, 2012) identify in long-grained nonglutinous rice Kernel 21 conservative with 91 not conservative miRNA families, wherein have the expression amount of about 50% miRNA with the developmental process of seed in the variation tendency increased gradually, and second half developmental process with seed is in the variation tendency reduced gradually.(the Yi et al. such as Yi, 2013) in rice grain growth course, identify 434 known miRNA, wherein have 162 differential expressions, and the expression amount of most of miRNA is the variation tendency raised gradually at the seed after fertilization 5-7 days developmental processes with seed.In sum, miRNA may have important regulating effect in rice grain is grown.
In recent years, the conventional japonica rice kind Xinfeng No.2 that applicant differs greatly with Superiors grains and Inferior grain circularity is for research material, with extensive parallel sequencing technology Solexa, strong, the Inferior grain miRNA that different times is enriched in grouting is checked order, find that most of miRNA is the variation tendency increased gradually with Filling velocity that is strong, Inferior grain, and the most expression amount in these miRNA is significantly higher than Inferior grain in Superiors grains.Prove that these differential expressions miRNA can by regulation and control target gene by bioinformatic analysis, the endogenous hormones of paddy rice, cell fission, Starch synthesis and signal transduction etc. are regulated and controled, show miRNAs expression amount low may be that Inferior grain Grain filling is poor, reason (Penget al., 2011 that final grain is heavily low; Peng et al., 2014).
Summary of the invention
The object of this invention is to provide a kind of miRNA target gene stand-in based on miR167.
Secondly, the present invention also provides a kind of expression casette comprising above-mentioned miRNA target gene stand-in.
Again, the present invention also provides a kind of expression vector comprising above-mentioned miRNA target gene stand-in or expression casette.
Finally, the present invention also provides a kind of above-mentioned miRNA target gene stand-in, expression casette or expression vector in the application of cultivating (high yield) rice strain and improve in rice yield.
In order to realize above object, the technical solution adopted in the present invention is:
Based on the miRNA target gene stand-in of miR167, be specially miR167 target gene stand-in or miR167 random target fragment stand-in, the nucleotide sequence of miR167 target gene stand-in is as shown in SEQ ID NO.1, and the nucleotide sequence of miR167 random target fragment stand-in is as shown in SEQ ID NO.2.
SEQ ID NO.1：
5’-GGTACC
(KpnI)TCTACTAAGG
CAGATCATGCTCAA
(insertion) GGCAGCTTCAATTATTCGGTGGATCC
(BamHI)-3’。Italicized item is the skeleton structure of OsIPS1, and underscore part is the binding site of miR167.
SEQ ID NO.2：
5’-GGTACC
(KpnI) TAGATCATGCTCTA
(insertion) GGCAGCTTCAGTTGTTGTTGTTATGGTCTAATTTAAATATGGTCTAAAGAAGAAGAAT
(Spacer) CAGATCATGCTCTA
(insertion) GGCAGC TTCAGGATCC
(BamHI)-3’。Underscore part is the binding site of miR167.
Expression casette, comprises the nucleotide sequence (as shown in SEQ ID NO.1) of miR167 target gene stand-in or the nucleotide sequence (as shown in SEQ ID NO.2) of miR167 random target fragment stand-in.Expression casette can also comprise Gt13a promoter gene sequence and NOS terminator gene order, and Gt13a promoter gene sequence is as shown in SEQ ID NO.3, and NOS terminator gene order is as shown in SEQ ID NO.4.
SEQ ID NO.3：
5’-GAATTC
(EcoRI)TGAGTAATGTGTGAGCATTATGGGACCACGAAATAAAAAAAGAACATTTTTATGAGCAGTGTGTTCTCAATGAGCCTTGAATGTTATCACCCAGGATAAGAAACCCTTAAGCAATGAAACATGCAAGCGTTTAATGTGCAAAGTTGGCATTCTCCACGACATAATGCAAAAGAAGATATAATCTATGACATAGCAAGTCATGCATCATTTCATGCCTCTGTCAACCTATTCATTTCTAGTCATCTAGGTAAGTATCTTAAGCTAAAGTGTTAGAACTTCCCATACATAAGTCATAACTGATGACAATTGGGTGTAACACATGACAAACCAGAGAGTCAAGCAAGATAAAGCAAAAGGATGTGTACATAAAACTACAGAGCTATATGTCATGTTGCGAAAAGAGGAGAGCTTATAAGACAAGCCATGACTCAAAAAAAATTCACATGCCTACTGTGGCCCATATATCATGCAACAATCCAAAAACTCACAGGTCTCGGTGTTGATCGTGTCAACATGTGACCACCCTAAAAACTCTTCACTAAATATTAAAGTATTGCTAGAACAGAGCTTCAAGATATAAGTCATGATCACCAACAACCATGTTCAAAAAGAAATAGAAAGCTATGGCACAGCAACAAAAAGCAAAAGCATGCATGGATATAATCTTTAACATCATCCATGTCATATTGCAAAAGAAAGAAAGAGAGAACAATACAAATGATGTGTCAATTACACATCCATCATTATCCATCCACCTTCCGTGTACCACACTTCATATATCATGAGTCACTTCATGTCTGGACATTAACAAACTCTATCTTAACATTCAAATGCATGAGACTTTATCTCACTATAAATGCACAATGATTTAGCATTGTTTCTCACAAAACCATTCAAGTTCATTAGTACTACAACAAC
(Gt13a promoter)GAGCTC
(SacI)-3’。
SEQ ID NO.4：
5’-CTGCAG
(PstI)CGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTTGCGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAACATGTAATGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATTATACATTTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTATGTTACTAGATCGGG
(NOS terminator)AAGCTT
(HindIII)-3’。
Concrete, based on the nucleotide sequence of the expression casette of miR167 target gene stand-in as shown in SEQ ID NO.5, based on the nucleotide sequence of the expression casette of miR167 random target fragment stand-in as shown in SEQ ID NO.6.
SEQ ID NO.5：
5’-GAATTC
(EcoRI)TGAGTAATGTGTGAGCATTATGGGACCACGAAATAAAAAAAGAACATTTTTATGAGCAGTGTGTTCTCAATGAGCCTTGAATGTTATCACCCAGGATAAGAAACCCTTAAGCAATGAAACATGCAAGCGTTTAATGTGCAAAGTTGGCATTCTCCACGACATAATGCAAAAGAAGATATAATCTATGACATAGCAAGTCATGCATCATTTCATGCCTCTGTCAACCTATTCATTTCTAGTCATCTAGGTAAGTATCTTAAGCTAAAGTGTTAGAACTTCCCATACATAAGTCATAACTGATGACAATTGGGTGTAACACATGACAAACCAGAGAGTCAAGCAAGATAAAGCAAAAGGATGTGTACATAAAACTACAGAGCTATATGTCATGTTGCGAAAAGAGGAGAGCTTATAAGACAAGCCATGACTCAAAAAAAATTCACATGCCTACTGTGGCCCATATATCATGCAACAATCCAAAAACTCACAGGTCTCGGTGTTGATCGTGTCAACATGTGACCACCCTAAAAACTCTTCACTAAATATTAAAGTATTGCTAGAACAGAGCTTCAAGATATAAGTCATGATCACCAACAACCATGTTCAAAAAGAAATAGAAAGCTATGGCACAGCAACAAAAAGCAAAAGCATGCATGGATATAATCTTTAACATCATCCATGTCATATTGCAAAAGAAAGAAAGAGAGAACAATACAAATGATGTGTCAATTACACATCCATCATTATCCATCCACCTTCCGTGTACCACACTTCATATATCATGAGTCACTTCATGTCTGGACATTAACAAACTCTATCTTAACATTCAAATGCATGAGACTTTATCTCACTATAAATGCACAATGATTTAGCATTGTTTCTCACAAAACCATTCAAGTTCATTAGTACTACAACAAC
(Gt13a promoter)GAGCTC
(SacI)GGTACC
(KpnI)TCTACTAAGG
CAGATCATGCTCAA
(insertion) GGCAGCTTC AATTATTCGGT
(MIM167)GGATCC
(BamHI)TCTAGA
(XbaI)GTCGAC
(SalI)CTGCAG
(PstI)CGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTTGCGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAACATGTAATGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATTATACATTTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTATGTTACTAGATCGGG
(NOS terminator)AAGCTT
(HindIII)-3’。
SEQ ID NO.6：
5’-GAATTC
(EcoRI)TGAGTAATGTGTGAGCATTATGGGACCACGAAATAAAAAAAGAACATTTTTATGAGCAGTGTGTTCTCAATGAGCCTTGAATGTTATCACCCAGGATAAGAAACCCTTAAGCAATGAAACATGCAAGCGTTTAATGTGCAAAGTTGGCATTCTCCACGACATAATGCAAAAGAAGATATAATCTATGACATAGCAAGTCATGCATCATTTCATGCCTCTGTCAACCTATTCATTTCTAGTCATCTAGGTAAGTATCTTAAGCTAAAGTGTTAGAACTTCCCATACATAAGTCATAACTGATGACAATTGGGTGTAACACATGACAAACCAGAGAGTCAAGCAAGATAAAGCAAAAGGATGTGTACATAAAACTACAGAGCTATATGTCATGTTGCGAAAAGAGGAGAGCTTATAAGACAAGCCATGACTCAAAAAAAATTCACATGCCTACTGTGGCCCATATATCATGCAACAATCCAAAAACTCACAGGTCTCGGTGTTGATCGTGTCAACATGTGACCACCCTAAAAACTCTTCACTAAATATTAAAGTATTGCTAGAACAGAGCTTCAAGATATAAGTCATGATCACCAACAACCATGTTCAAAAAGAAATAGAAAGCTATGGCACAGCAACAAAAAGCAAAAGCATGCATGGATATAATCTTTAACATCATCCATGTCATATTGCAAAAGAAAGAAAGAGAGAACAATACAAATGATGTGTCAATTACACATCCATCATTATCCATCCACCTTCCGTGTACCACACTTCATATATCATGAGTCACTTCATGTCTGGACATTAACAAACTCTATCTTAACATTCAAATGCATGAGACTTTATCTCACTATAAATGCACAATGATTTAGCATTGTTTCTCACAAAACCATTCAAGTTCATTAGTACTACAACAAC
(Gt13a promoter)GAGCTC
(SacI)GGTACC
(KpnI) TAGATCATGCTCTA
(insertion) GGCAGCTTCAGTTGTTGTTGTTATGGTCTAATTTAAATATGGTCTAAAGAAGAAGAAT
(Spacer) CAGATCATGCTCTA
(inserti on) GGCAGCTTCAGGATCC
(BamHI)TCTAGA
(XbaI)GTCGAC
(SalI)CTGCAG
(PstI)CGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTTGCGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAACATGTAATGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATTATACATTTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTATGTTACTAGATCGGG
(NOS terminator)AAGCTT
(HindIII)-3’。
Expression vector, comprises the nucleotide sequence (as shown in SEQ ID NO.1) of miR167 target gene stand-in or the nucleotide sequence (as shown in SEQ ID NO.2) of miR167 random target fragment stand-in.Expression vector can also comprise Gt13a promoter gene sequence (as shown in SEQ ID NO.3) and NOS terminator gene order (as shown in SEQ ID NO.4).
Concrete, expression vector comprises the nucleotide sequence (as shown in SEQID NO.5) of the expression casette based on miR167 target gene stand-in or the nucleotide sequence (as shown in SEQ IDNO.6) based on the expression casette of miR167 random target fragment stand-in.Expression vector can also comprise the nucleotide sequence (NCBI Accession NO.AF234298) of carrier pCAMBIA1302.Such as, expression vector comprises the nucleotide sequence of binary expression vector pCAMBIA1302-Gt13a-NOS, and the nucleotide sequence of binary expression vector is as shown in SEQ ID NO.7.
More specifically, based on the nucleotide sequence of the expression vector of miR167 target gene stand-in as shown in SEQ ID NO.8, based on the nucleotide sequence of the expression vector of miR167 random target fragment stand-in as shown in SEQ ID NO.9.
MiRNA target gene stand-in are in the application of cultivating (high yield) rice strain and improve in rice yield.Wherein, miRNA target gene stand-in are miR167 target gene stand-in (as shown in SEQ ID NO.1) or miR167 random target fragment stand-in (as shown in SEQ ID NO.2).
Expression casette is in the application of cultivating (high yield) rice strain and improve in rice yield.Wherein, expression casette comprises the nucleotide sequence (as shown in SEQ ID NO.1) of miR167 target gene stand-in or the nucleotide sequence (as shown in SEQ ID NO.2) of miR167 random target fragment stand-in.Expression casette can also comprise Gt13a promoter gene sequence (as shown in SEQ ID NO.3) and NOS terminator gene order (as shown in SEQ ID NO.4).Concrete, based on the nucleotide sequence of the expression casette of miR167 target gene stand-in as shown in SEQ ID NO.5, based on the nucleotide sequence of the expression casette of miR167 random target fragment stand-in as shown in SEQ ID NO.6.
Expression vector is in the application of cultivating (high yield) rice strain and improve in rice yield.Wherein, expression vector comprises the nucleotide sequence (as shown in SEQ ID NO.1) of miR167 target gene stand-in or the nucleotide sequence (as shown in SEQ ID NO.2) of miR167 random target fragment stand-in.Expression vector can also comprise Gt13a promoter gene sequence (as shown in SEQ ID NO.3) and NOS terminator gene order (as shown in SEQ ID NO.4).Concrete, expression vector comprises the nucleotide sequence (as shown in SEQ ID NO.6) of the nucleotide sequence (as shown in SEQ ID NO.5) of the expression casette based on miR167 target gene stand-in or the expression casette based on miR167 random target fragment stand-in.Expression vector can also comprise the nucleotide sequence (NCBI Accession NO.AF234298) of expression vector pCAMBIA1302.Such as, expression vector comprises the nucleotide sequence (as shown in SEQ IDNO.7) of binary expression vector pCAMBIA1302-Gt13a-NOS.More specifically, based on the nucleotide sequence of the expression vector of miR167 target gene stand-in as shown in SEQ IDNO.8, based on the nucleotide sequence of the expression vector of miR167 random target fragment stand-in as shown in SEQ ID NO.9.
Above-mentioned expression vector, in the application of cultivating (high yield) rice strain and improve in rice yield, comprises the following steps: get expression vector transformation Agrobacterium, contaminates Rice Callus, identifies transgenic positive plant after Dual culture after screening, differentiation; The primer sequence that qualification adopts is as follows:
Gt13a VF:5 '-TATCCATCCACCTTCCGTGT-3 ' (as shown in SEQ ID NO.12),
Gt13a VR:5 '-GCAACAGGATTCAATCTTAA-3 ' (as shown in SEQ ID NO.13).
Beneficial effect of the present invention:
By the change tread of miR167 in analyzing rice grain milk process in the strong Inferior grain of paddy rice and differential expression, find in Grain Filling Process, the expression amount of surging seed miR167 is in the variation tendency increased gradually, the expression amount of Inferior grain miR167 is in first reducing the variation tendency increased afterwards, strong with paddy rice, the filling rate of Inferior grain is negative correlativing relation, and miR167 is by force, differential expression in Inferior grain, wherein miR167d, f-h, j after spending 10 days, in 15 days and 21 days, the gene expression abundance of Superiors grains is 2.96 of Inferior grain respectively, 9.38 and 4.23 times, show that miR167 regulates the grouting of rice grain to enrich in Grain Filling of Rice process, and then determine the size of rice grain.
For verifying the relation of miR167 and rice grain size further, the present invention builds endosperm specificity promoter Gt13a and drives target gene stand-in (Taget Mimic, and random target fragment stand-in (Short Tandem Target Mimic MIM), STTM) binary vector of low expression miR167, utilize During Agrobacterium paddy rice embryo callus, through screening, differentiation obtains transgenic positive plant, identified by the phenotype relevant to transfer-gen plant grain yield, result shows: in each transgenic line endosperm, the expression amount of miR167 is all significantly lowered, and the thousand seed weight of each transgenic line ripening stage brown rice, grain length, grain is wide and grain is thick is all improved significantly.
The present invention is directed to current census and constantly increase the ever-increasing present situation with grain demand, utilize miRNA in the effect regulating rice yield traits, inquire into the function of miRNA in rice varieties improvement, thus provide miR167 at cultivation high-yield rice, particularly by increasing thousand seed weight, and then the application in increase yield.Compared with prior art there is following characteristics: because low expression miR167 can enlarge markedly size and the thousand seed weight of rice grain, a kind of simple and effective technique means can be provided for cultivating high-yield rice new lines based on the miRNA target gene stand-in of miR167, expression casette, expression vector in the present invention, being conducive to large-scale promotion and using; The present invention utilizes molecular improvement technology to cultivate high-yield rice, not only can improve the output of paddy rice, and can not to environment, edible safety.
Accompanying drawing explanation
Fig. 1 is the schema of miR167 target gene stand-in (MIM167) in the embodiment of the present invention 1;
Fig. 2 is the schema of miR167 random target fragment stand-in (STTM167) in embodiment 2;
Fig. 3 is the expression analysis figure that in embodiment 9, MIM167 and STTM167 transgenic line spends miR167 in latter 10 days endosperm;
Fig. 4 is wild type control in embodiment 10, MIM167 and STTM167 transgenic line ripening stage brown rice outward appearance comparison diagram;
Fig. 5 is the variance analysis figure of wild type control, MIM167 and STTM167 transgenic line brown rice thousand seed weight;
Fig. 6 is the variance analysis figure of wild type control, MIM167 and STTM167 transgenic line brown rice grain length;
Fig. 7 is the wide variance analysis figure of wild type control, MIM167 and STTM167 transgenic line brown rice grain;
The variance analysis figure that Fig. 8 is wild type control, MIM167 and STTM167 transgenic line brown rice grain is thick.
Embodiment
Following embodiment is only described in further detail the present invention, but does not form any limitation of the invention.
Embodiment 1
The design of miR167 target gene stand-in (MIM167):
The ripe miRNA sequence of miR167 is downloaded from miRNA database miRBase (http://www.mirbase.org/index.shtml), Accession number is MIMAT0000641 (osa-miR167a-5p), IMAT0000642 (osa-miR167b-5p), MIMAT0000643 (osa-miR167c-5p), MIMAT0001039 (osa-miR167d-5p), MIMAT0001040 (osa-miR167e-5p), MIMAT0001041 (osa-miR167f), MIMAT0001042 (osa-miR167g), MIMAT0001043 (osa-miR167h-5p), MIMAT0001044 (osa-miR167i-5p) and MIMAT0001086 (osa-miR167j), according to (Nature genetics such as Franco-Zorrilla, 2007) the target gene stand-in (MIM) invented design MIM167, its nucleotide sequence is as shown in SEQ ID NO.1.Target gene stand-in and miR167 complementary, but stand-in insert 3 bases at miR167 from the position between 5 ' end the 10th bit base and the 11st bit base, thus form a projection when causing miR167 to mate with stand-in between the 10th bit base and the 11st bit base.The structure of MIM167 is with reference to (PLoS genetics such as Todesco, 2010) method with rice Os IPSI for template, design the oligonucleotide primer that two complementary pairings contain BamHI and KpnI sticky end, the nucleotide sequence of primer I is as shown in SEQ ID NO.10, and the nucleotide sequence of primer II is as shown in SEQ ID NO.11.The schema of miR167 target gene stand-in (MIM167) is shown in Fig. 1.
The preparation of miR167 target gene stand-in, comprises the following steps:
(1) according to the ripe miRNA sequence of miR167 in miRNA database miRBase, design the oligonucleotide primer (primer I and primer II) of two complementary pairings (containing BamHI and KpnI sticky end), the nucleotide sequence of primer I is as shown in SEQ ID NO.10, and the nucleotide sequence of primer II is as shown in SEQ ID NO.11;
SEQ ID NO.10：
5 '-CTCTACTAAGG
cAGATCATGCTcAA
(insertion) gGCAGCTTCAaTTATTCGGTG-3 ', italicized item is the skeleton structure of OsIPSI, and underscore part is the binding site of miR167, and thickened portion is KpnI and BamHI restriction enzyme site cohesive end sequence;
SEQ ID NO.11：
5 '-GATCCACCGAATAAT
tGAAGCTGCCtTG
(insertion) aGCATGATCTGcCTTAGTAGAGGTAC-3 ', italicized item is the skeleton structure of OsIPSI, and underscore part is the binding site of miR167, and thickened portion is KpnI and BamHI restriction enzyme site cohesive end sequence;
(2) primer I and primer II (being synthesized by Shanghai Sheng Gong biotechnology company limited) are diluted to 10 μMs of ol/L, equal-volume mixing is placed in PCR instrument, slowly room temperature is down to after 95 DEG C of 10min, as for stand-by on ice, product is the miR167 target gene stand-in (as shown in SEQ ID NO.1) containing KpnI and BamHI restriction enzyme site sticky end.
Embodiment 2
The design of miR167 random target fragment stand-in (STTM167):
The ripe miRNA sequence of miR167 is downloaded from miRNA database miRBase (http://www.mirbase.org/index.shtml), Accession number is MIMAT0000641 (osa-miR167a-5p), IMAT0000642 (osa-miR167b-5p), MIMAT0000643 (osa-miR167c-5p), MIMAT0001039 (osa-miR167d-5p), MIMAT0001040 (osa-miR167e-5p), MIMAT0001041 (osa-miR167f), MIMAT0001042 (osa-miR167g), MIMAT0001043 (osa-miR167h-5p), MIMAT0001044 (osa-miR167i-5p) and MIMAT0001086 (osa-miR167j), with reference to (The Plant cell such as Yan, 2012) the random target fragment stand-in (STTM) of inventing design STTM167, its nucleotide sequence is as shown in SEQ ID NO.2.Target gene stand-in and miR167 complementary, but stand-in insert 3 bases at miR167 from the position between 5 ' end the 10th bit base and the 11st bit base, thus form a projection when causing miR167 to mate with stand-in between the 10th bit base and the 11st bit base.Two target gene stand-in arrange in a series arrangement, add the intermediate sequence of 48nt in the middle of both.The schema of miR167 random target fragment stand-in (STTM167) is shown in Fig. 2.
The preparation of miR167 random target fragment stand-in, comprises the following steps:
(1) according to sequences Design one section of miR167 random target fragment stand-in of miR167, it is made up of the intermediate sequence of two target gene stand-in and a 48nt, target gene stand-in and miR167 complementary, but stand-in insert 3 bases at miR167 from the position between 5 ' end the 10th bit base and the 11st bit base, thus form a projection when causing miR167 to mate with stand-in between the 10th bit base and the 11st bit base.Two target gene stand-in arrange in a series arrangement, and add the intermediate sequence of 48nt in the middle of both, its structure and sequence are as shown in Fig. 2 and SEQ ID NO.2;
(2) at 5 ' end and 3 ' end interpolation KpnI and the BamHI restriction enzyme site respectively of random target fragment stand-in, be sent to Shanghai Sheng Gong biotechnology company limited and synthesize.
Embodiment 3
Based on the preparation of the expression vector of miR167 target gene stand-in, comprise the following steps:
(1) adopt KpnI and BamHI to carry out double digestion to pCAMBIA1302-Gt13a-Nos carrier, then utilize sky root DNA purifying to reclaim test kit and carry out purifying recovery;
(2) add in the pCAMBIA1302-Gt13a-Nos carrier after KpnI and BamHI double digestion by the miR167 target gene stand-in containing KpnI and BamHI restriction enzyme site sticky end in embodiment 1,4 DEG C of connections are spent the night;
(3) connect product conversion to DH5 ɑ competent cell, and on the kantlex flat board containing 50mg/L, be inverted for 37 DEG C and cultivate 16h;
(4), after bacterium colony PCR preliminary identification, be sent to Shanghai Sheng Gong biotechnology company limited and carry out sequence verification, sequence is as SEQ ID NO.8.
The construction process of pCAMBIA1302-Gt13a-Nos carrier is substantially identical with the construction process of pCAMBIA1301-Gt13a-Nos carrier in the patent of invention of publication No. CN103710341A, uniquely adopt pCAMBIA1302 initial carrier unlike building pCAMBIA1302-Gt13a-Nos carrier in the present invention, and that adopt in patent documentation is pCAMBIA1301.
Embodiment 4
Based on the preparation of the expression vector of miR167 random target fragment stand-in, comprise the following steps:
(1) adopt KpnI and BamHI to carry out double digestion to pCAMBIA1302-Gt13a-Nos carrier, then utilize sky root DNA purifying to reclaim test kit and carry out purifying recovery;
(2) adopt the miR167 random target fragment stand-in of KpnI and BamHI to synthetic in embodiment 2 to carry out double digestion, then utilize sky root DNA purifying to reclaim test kit and carry out purifying recovery;
(3) connection of digestion products: join in the pCAMBIA1302-Gt13a-Nos carrier after KpnI and BamHI double digestion by random for miR167 target fragment target gene stand-in KpnI and BamHI digestion products, 4 DEG C of connections are spent the night;
(4) connect product conversion to DH5 ɑ competent cell, and on the kantlex flat board containing 50mg/L, be inverted for 37 DEG C and cultivate 16h;
(5), after bacterium colony PCR preliminary identification, be sent to Shanghai Sheng Gong biotechnology company limited and carry out sequence verification, sequence is as SEQ ID NO.9.
Embodiment 5
Expression vector rice transformation kind Japan based on miRNA target gene stand-in is fine, comprises the following steps:
1, pCAMBIA1302-Gt13a-MIM167-NOS and pCAMBIA1302-Gt13a-STTM167-NOS transformation Agrobacterium EHA105 bacterial strain
(1) two kind of expression vector is got 1 μ g respectively and is added in the Agrobacterium competent cell that 200 μ l dissolve on ice, gently mixes, ice bath 30min, quick-frozen 5min in liquid nitrogen, 37 DEG C of water-bath 5min, then ice bath 2min rapidly;
(2) 800 μ l LB liquid nutrient mediums (not containing microbiotic) are added, 28 DEG C of jog 5h (4 ~ 6h);
(3) thalline is centrifugal, removing supernatant liquor, coats YM and selects dull and stereotyped upper (Kan 50mg/L, Rif 50mg/L, sees the following form 1), be inverted cultivation 2 days for 28 DEG C after residue thalline is resuspended.
Table 1 YM medium component
2, Rice Callus is contaminated, the screening of transgenic positive plant, differentiation and authentication method:
(1) Rice seeds 70% ethanol surface sterilization 3min (2 ~ 4min), aqua sterilisa cleans 2 times, acutely shakes;
(2) with effective chlorine density 1.5% clorox (adding 1 tween), sterilize 30min, cleans 5 times (5 ~ 6 times) after sterilization with aqua sterilisa;
(3) seed is placed on 2N6 substratum and (sees the following form 2), 28 DEG C of light culture 4 week Ban (4 ~ 5 Zhou Junke);
(4) faint yellow, the granular callus of picking, transfers to preculture on new 2N6 substratum and infects after (5 ~ 7 days) for 6 days;
(5) picking is containing the single bacterium colony of Agrobacterium of object plasmid, and it is muddy to thalline that 500 μ l YM liquid nutrient mediums (50mg/L Kan, 50mg/LRif) shake bacterium 36h (24 ~ 48h), namely with or be placed in 4 DEG C of preservations;
(6) is shaken the Agrobacterium inoculation of bacterium preservation first time in YM liquid nutrient medium (50mg/L Kan, 50mg/L Rif) in, shake bacterium in triangular flask to spend the night, be cultured to OD600 and reach 0.9 (0.8 ~ 1.0), add 30 μ l AS (100mM) afterwards room temperature be directly used in callus after placing 2h (2 ~ 3h) and infect;
Table 2 2N6 medium component
(7) callus after preculture is immersed in above-mentioned Agrobacterium bacterium liquid, 15min is placed under room temperature condition, and frequently shake, take out callus, aseptic paper sucks unnecessary bacterium liquid, dry up, with transferring to the solidified co-cultivation medium 2N6-AS (seeing the following form 3) being covered with one deck aseptic filter paper by callus, 23 DEG C of light culture 3 days;
Table 3 2N6-AS medium component
(8) callus after Dual culture is first cleaned with aqua sterilisa, be washed till supernatant liquor clarification, and then with 500mg/L Pyocianil solution soaking 10min, then remove supernatant liquor, callus is placed in suck dry moisture on sterilizing-drying filter paper, change filter paper, super clean bench continues air-dry 30 ~ 60min (45min), be transferred on 2N6-S substratum (seeing the following form 4) after callus drying, 28 DEG C of light culture, every 2 weeks subcultures once, step sizing 3 times;
Table 4 2N6-S screening and culturing based component
(9) kanamycin-resistant callus tissue is transferred on division culture medium N6-R in triangular flask (seeing the following form 5), 28 DEG C of light culture, one week rear illumination cultivation (16h illumination/8h is dark), goes to seedling on 1/2MS root media (seeing the following form 6) and takes root when differentiation seedling grows to 2.5 centimetres (2 ~ 3 centimetres);
Table 5 division culture medium N6-R composition
Table 6 1/2MS medium component
(10) after seedling to be regenerated grows root system, open sealed membrane and add a small amount of water (~ 1cm is dark), hardening 4 days (3 ~ 5 days) is loaded in native alms bowl later;
(11) Rice Seedling Leaves is extracted DNA, use MIM167 and STTM167 both sides primer to carry out PCR positive identification, primer sequence is:
Gt13a VF:5 '-TATCCATCCACCTTCCGTGT-3 ' (as shown in SEQ ID NO.12),
Gt13a VR:5 '-GCAACAGGATTCAATCTTAA-3 ' (as shown in SEQ ID NO.13).
Test example
The detection of transfer-gen plant miR167 expression amount:
The expression amount of miR167 adopts the method for stem-loop qRT-PCR to measure.Transfer-gen plant and non-transgenic wild rice spend the extraction RNA extraction test kit of latter 10 days endosperm total serum IgE to carry out, then HiFi-MMLVcDNA Kit reverse transcription is used to become cDNA, get the cDNA that 5 μ l dilute by 1:20 and do template, configure 20 μ l and contain 10 μ lUltraSYBR mixture reaction systems, with β-actin for reference gene, BioRad Iq5 instrument carries out real-time fluorescence quantitative PCR, response procedures: 95 DEG C of pre-incubation 10min, 95 DEG C of sex change 30s, 60 DEG C of annealing 30s, 72 DEG C extend 30s, 40 circulations.All PCR all arrange 3 repetitions, and relative expression quantity 2-△ △ Ct method calculates, and the results are shown in Figure 3.As can be seen from Figure 3, transfer-gen plant MIM167 with STTM167 spends expression amount obvious decline compared with non-transgenosis WT lines of miR167 in latter 15 days endosperm.
Transfer-gen plant seed phenotype analytical:
Choose the separate transgenic strain that in MIM167 and STTM167 transgenic line, miR167 expression amount reduces respectively, to grain weight, the grain length of the transgenic line brown rice that expression amount reduces, grain is wide and grain is thick carries out species test, mean value and standard error repeat experiment by 20 and obtain, and the results are shown in Figure 4-8.As can be seen from Fig. 4-8, the seed thousand seed weight of MIM167 and STTM167 low expression miR167 each transgenic line, grain length, grain is wide and grain is thick all obviously increases than non-transgenosis wild rice contrast, and each transgenic line brown rice thousand seed weight amplification is all more than 4.98%, wherein STTM167-17 brown rice thousand seed weight is maximum, reach 25.21g, increase 4.58g than the 20.63g of contrast, amplification reaches 22.18%.
Claims (8)
1. based on the miRNA target gene stand-in of miR167, it is characterized in that: miRNA target gene stand-in are miR167 target gene stand-in or miR167 random target fragment stand-in, the nucleotide sequence of miR167 target gene stand-in is as shown in SEQ IDNO.1, and the nucleotide sequence of miR167 random target fragment stand-in is as shown in SEQ ID NO.2.
2. expression casette, is characterized in that: it comprises miR167 target gene stand-in or miR167 random target fragment stand-in in claim 1.
3. expression casette according to claim 2, it is characterized in that: expression casette also comprises Gt13a promoter gene sequence and NOS terminator gene order, Gt13a promoter gene sequence is as shown in SEQ ID NO.3, and NOS terminator gene order is as shown in SEQ ID NO.4.
4. expression casette according to claim 3, it is characterized in that: expression casette is based on the expression casette of miR167 target gene stand-in or the expression casette based on miR167 random target fragment stand-in, based on the nucleotide sequence of the expression casette of miR167 target gene stand-in as shown in SEQ ID NO.5, based on the nucleotide sequence of the expression casette of miR167 random target fragment stand-in as shown in SEQ ID NO.6.
5. expression vector, is characterized in that: it comprises miR167 target gene stand-in or miR167 random target fragment stand-in in claim 1.
6. expression vector according to claim 5, is characterized in that: it comprises the nucleotide sequence based on the nucleotide sequence of the expression casette of miR167 target gene stand-in or the expression casette based on miR167 random target fragment stand-in in claim 4.
7. expression vector according to claim 6, it is characterized in that: expression vector is based on the expression vector of miR167 target gene stand-in or the expression vector based on miR167 random target fragment stand-in, based on the nucleotide sequence of the expression vector of miR167 target gene stand-in as shown in SEQ ID NO.8, based on the nucleotide sequence of the expression vector of miR167 random target fragment stand-in as shown in SEQ ID NO.9.
8. miRNA target gene stand-in, the expression casette according to any one of claim 2 ~ 4 or the expression vector according to any one of claim 5 ~ 7 as claimed in claim 1 are cultivating the application in rice strain.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510369758.7A CN104962557B (en) | 2015-06-26 | 2015-06-26 | MiRNA target genes analogies, expression casette, expression vector and application based on miR167 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510369758.7A CN104962557B (en) | 2015-06-26 | 2015-06-26 | MiRNA target genes analogies, expression casette, expression vector and application based on miR167 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104962557A true CN104962557A (en) | 2015-10-07 |
| CN104962557B CN104962557B (en) | 2018-05-01 |
Family
ID=54216647
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510369758.7A Active CN104962557B (en) | 2015-06-26 | 2015-06-26 | MiRNA target genes analogies, expression casette, expression vector and application based on miR167 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104962557B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109161558A (en) * | 2018-09-19 | 2019-01-08 | 深圳大学 | A kind of construction method of the efficient over-express vector of monocotyledon miRNA |
| CN110157707A (en) * | 2019-05-27 | 2019-08-23 | 中国农业科学院作物科学研究所 | The application of one rice miRNA and its precursor-gene in rice bacterial blight resistance |
| CN110157716A (en) * | 2019-06-06 | 2019-08-23 | 山东省水稻研究所 | A method of big grain, high-yield rice are cultivated by simulating tiny RNA binding site |
| CN112094845A (en) * | 2020-09-27 | 2020-12-18 | 四川农业大学 | Nucleic acid for improving agronomic traits and resistance of plants and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102181482A (en) * | 2011-01-25 | 2011-09-14 | 中山大学 | Method for rapidly regulating activity of endogenous miRNA in rice |
| CN103710341A (en) * | 2013-12-16 | 2014-04-09 | 河南农业大学 | MiR (micro ribonucleic acid) 1432 target gene tandem stimulant, gene expression cassette, expression vector, and preparation method and application of expression vector |
-
2015
- 2015-06-26 CN CN201510369758.7A patent/CN104962557B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102181482A (en) * | 2011-01-25 | 2011-09-14 | 中山大学 | Method for rapidly regulating activity of endogenous miRNA in rice |
| CN103710341A (en) * | 2013-12-16 | 2014-04-09 | 河南农业大学 | MiR (micro ribonucleic acid) 1432 target gene tandem stimulant, gene expression cassette, expression vector, and preparation method and application of expression vector |
Non-Patent Citations (2)
| Title |
|---|
| TING PENG ET AL.: "Differentially expressed microRNA cohorts in seed development may contribute to poor grain filling of inferior spikelets in rice", 《BMC PLANT BIOLOGY》 * |
| YOUNING WANG ET AL.: "MicroRNA167-directed regulation of the auxin response factors GmARF8a and GmARF8b is required for soybean nodulation and lateral root development", 《PLANT PHYSIOLOGY》 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109161558A (en) * | 2018-09-19 | 2019-01-08 | 深圳大学 | A kind of construction method of the efficient over-express vector of monocotyledon miRNA |
| CN109161558B (en) * | 2018-09-19 | 2022-05-06 | 深圳大学 | Construction method of monocotyledon miRNA high-efficiency overexpression vector |
| CN110157707A (en) * | 2019-05-27 | 2019-08-23 | 中国农业科学院作物科学研究所 | The application of one rice miRNA and its precursor-gene in rice bacterial blight resistance |
| CN110157716A (en) * | 2019-06-06 | 2019-08-23 | 山东省水稻研究所 | A method of big grain, high-yield rice are cultivated by simulating tiny RNA binding site |
| CN110157716B (en) * | 2019-06-06 | 2023-07-21 | 山东省水稻研究所 | Method for cultivating large-grain high-yield rice by simulating small RNA binding site |
| CN112094845A (en) * | 2020-09-27 | 2020-12-18 | 四川农业大学 | Nucleic acid for improving agronomic traits and resistance of plants and application thereof |
| CN112094845B (en) * | 2020-09-27 | 2022-03-15 | 四川农业大学 | Nucleic acid for improving agronomic traits and resistance of plants and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104962557B (en) | 2018-05-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP5982282B2 (en) | Barley and its use | |
| CN103710341B (en) | A kind of miR1432 target gene series connection stand-in, expression casette, expression vector, preparation method and application | |
| CN105820225B (en) | Rice grain shape modulin OsPIL15, gene, carrier and application | |
| CN104962557A (en) | miRNA-based target gene stimulant, genetic expression cassette, expression vector and application | |
| CN105755021A (en) | Rice cadmium-tolerant gene OsGSTU37 and application thereof | |
| CN110699361A (en) | Rice salt stress resistance related gene Os16 and encoding protein and application thereof | |
| CN106459921A (en) | Transformation of duckweed and uses thereof | |
| CN108660140B (en) | Application of SlSL4 gene in regulation and control of tomato fruit ripening | |
| CN106701778A (en) | Method for increasing grain number per ear and reducing plant height by use of rice SNB genes | |
| CN104017829A (en) | Method for increasing amylose content of plants | |
| CN105087640A (en) | Gene for regulating seed development of plants and application of gene | |
| JP2010193847A (en) | beta-GLUCAN-DEFICIENT GENE OF BARLEY, SYNTHETIC GENE AND USE THEREOF | |
| WO2016128998A1 (en) | Improved transgenic rice plants | |
| CN110331143B (en) | MiRNA for sweet potato leaf shape regulation and control, encoding nucleic acid molecule and application | |
| CN107988225B (en) | Corn grain development related gene miR169o and application thereof | |
| CN102876680A (en) | Soybean-source oleosin gene seed specificity promoter and application thereof | |
| CN105274135A (en) | RNAi vector widely used for multi-plant gene silencing and application | |
| CN105061570B (en) | Plant amylum synthesis associated protein IbSSI and its encoding gene and application | |
| CN109486819B (en) | Cassava U6 promoter gene and application thereof | |
| CN104774826B (en) | A kind of histone deacetylase and its encoding gene and application | |
| CN104861051B (en) | Plant development associated protein AtUBP15 and its encoding gene and application | |
| CN103146756A (en) | Method of adjusting content of plant amylose and amylopectin | |
| CN102295693A (en) | Rice WRKY transcription factor and coding gene and use thereof | |
| EP2255006B1 (en) | Process for producing tomato plants with long-life characteristics | |
| CN104164425B (en) | miRNA, precursor of miRNA, their coding gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |