CN104673793B - Legume root system tissue-specific promoter and its application - Google Patents

Abstract

The present invention relates to the specificity promoter in a kind of legume root system tissue and its application.The promoter is particularly suitable for driving foreign gene specific expressed in legume root system tissue, and expression quantity is extremely low in other tissues of legume or does not express.The expression specificity and selectivity of the promoter are very high.Present invention also offers the construction with the promoter, expression cassette and carrier etc..Transgenic leguminous plants containing promoter of the present invention can specifically improve the economical character of legume, foreign gene is effectively avoided to import the influence to the other tissues of legume, can also in root system tissue specific expressed foreign gene, so as to obtain various associated products.

Description

Legume root system tissue-specific promoter and its application

Technical field

The invention belongs to biological technical field.Specifically, the specificity in being organized the present invention relates to a kind of legume Promoter and its application.

Background technology

Legume has important economic implications.Wherein, soybean is the main source of vegetable protein and edible oil, and The most oil crops of yield in the world.Soybean is food that is most being rich in nutrition in legume and being easy to digestion, is albumen The most abundant most cheap source of matter.Today in the world many places be humans and animals Major Foods.For China, beans Section plant, especially soybean, even more a kind of important industrial crops and cereal crops.

Conventional breeding methods play an important role in terms of quality-improving and breeding of new variety, but there is also the breeding time limit It is long, be difficult to break the linkage of characters, a variety of drawbacks such as polygenes restructuring probability is low, distant hybridization is difficult.Plant gene engineering technology The bad character of energy orderly improvement plant, plant is obtained the specific trait that conventional method is difficult to obtain, and can greatly shorten and educate The kind time limit, increases economic efficiency.Such a technology is preceding without any modification and structure in the importing of donor STb gene, so as to avoid base Because structure element may negatively affect caused by ecology and environment.Transgenic breeding technology can design improvement by the pre-selection of people Crop, new germ plasm is created, enrich germ plasm resource, improved the quality of crop, resistance, patience, increase yield etc., can greatly improve Breeding efficiency, accelerate breeding process, to solving the problems such as grain and vegetable safety, ecological degeneration, scarcity of resources and inefficiencies With great society, ecology and economic implications.

Transgenic technology is at China's staple crops breeding (rice, wheat, corn and soybean, sorghum, sunflower, rape) Application born fruit.Particularly on soybean breeder, the target gene of merit is led using Technique of Introduction of Exogenous DNA Enter the cultivated soybean, the offspring of acquisition had both maintained the yield of original acceptor, cultivates again and collects high yield, high-quality, merit in one The new varieties and strain of body.For example, in the 1990s, Lei Bojun et al. is big by Exogenous DNA transfered using pollen tube passage method Beans, create high-quality high protein strain D89-982 (protein accounts for 45.32%) and double high strain D90-1217 (protein+fat 66%) fat accounts for.Heilongjiang Institute of Agricultural Sciences carries out genetic transformation, i.e. Direct introduction exogenous DNA using pollen tube passage method (DIED) technology, high protein wild soybean STb gene is introduced directly into the cultivated soybean, has been bred as first new soybean varieties --- it is black Raw 101.1996, Xu Xiangling, Li Xinghua etc. utilized agrobacterium rhizogenes (the soybean mosaic virus coat protein base with plasmid Cause) infection soybean varieties, transformed plant is obtained, new approach is provided for soybean breeding for disease resistance.Xu Xiangling etc. (1997) will B on PKT54B7C5, t, toxoprotein gene imports the kinds such as the black agriculture 37 of soybean, black agriculture 39 by agrobacterium-mediated transformation in K-8, Foreign gene is obtained to import and be incorporated into the regenerable soybean plant in soybean gene group.2001, Zhou Sijun, Li Xichen etc. were used Bt genes (crylA) are successfully imported soybean by agriculture bacillus mediated soybean cotyledon node conversion system.1999, the profit such as Xu Xiangling With agrobacterium-mediated transformation, antimycotic chitinase gene is imported into soybean varieties --- 14 product such as eastern agriculture 37, Jilin 28 Kind, obtain transformed plant.

Gene embodies its function by expressing, and promoter is accurate promotor gene expression " switch ".By gene The method of engineering, targetedly breeding can be carried out to plant using the promoter of tissue specificity and transformed.Therefore, organizing specific Property promoter for gene expression regulation research it is significant.But for various reasons, the tissue found at present is special Specific Promoters are simultaneously few.For example, some genes, understand producer such as nonstructural gene and transfer, so as to be difficult to find specific Specific expressed corresponding promoter in tissue.Only know that promoter turns positioned at gene for the universals of promoter region In the region for recording several kb in upstream of initiation site, there is certain conserved sequence feature, G/C content is higher etc., technical staff is simultaneously Promoter can not be accurately positioned only according to these universals；Even if in fact, designing multipair PCR primer, also having very much can It can not be accurately positioned promoter.Further, since various reasons, the definite transcription initiation site of many genes does not determine, arrives So far, the gene dosage for having illustrated promoter sequence and their regulatory mechanism is very limited.The eucaryote of standard The gene promoter logged in relevant startup subdata base Eukaryotic Promoter Database is also and few.

Although China has obtained encouraging success in terms of transgenic technology is applied to crop breeding, with world level phase Than still there is larger gap.Effective tissue-specific gene is found, and it is improvement soybean to build efficiently available conversion carrier The prerequisite of quality trait and research soybean function gene.But the structure of transgenosis plasmid is one of bottleneck of the technology, Its main cause is a lack of effective transgene carrier and can be oriented in legume to carry out constitutive expression, or carries out tissue spy Abnormal shape expression；And lack the carrier of energy Efficient Conversion.

In summary, this area is badly in need of finding the tissue-specific promoter in legume, particularly soybean, Jin Erzhun Really effectively change the various characters of legume, improve its strain, preferably regulate and control it and grow and yield.

The content of the invention

It is an object of the invention to provide a kind of tissue-specific promoter of legume and its application.

In a first aspect, the present invention provides a kind of promoter element, the promoter element is selected from the group：

(a) nucleotide sequence such as SEQ ID NO:Polynucleotides shown in 1；

(b) nucleotide sequence and SEQ ID NO:Homology >=95% (preferably >=98%) of sequence shown in 1, and there are beans The polynucleotides of the promoter activity of special startup function in section's root system of plant tissue；

(c) such as SEQ ID NO:5 ' the ends and/or 3 ' ends of polynucleotides shown in 1 truncate or 1-60 (preferably 1- of increase 30, more preferably 1-6) nucleotides, and with the multinuclear of the promoter activity of special startup function in legume root system tissue Thuja acid.

In a preferred embodiment, special startup function represents in described legume root system tissue, the startup Son does not have startup function in the tissue beyond the root system tissue of legume.

In a preferred embodiment, described legume includes crowtoe (Lotus corniculatus), pea (Lathyrus odoratus), soybean (Glycine max) or clover (Medicago sativa).

In another preferred embodiment, the sequence of the promoter element such as SEQ ID NO:Shown in 1.

In second aspect, the present invention provides a kind of construction, and the construction contains foreign gene and and foreign gene The promoter element described in first aspect present invention being operatively connected.

In a preferred embodiment, described foreign gene under native state and is not present.

In another preferred embodiment, the foreign gene includes：Resistant gene, riddled basins, antigen egg White gene, RNAi genes, microRNA genes, biological agent gene or plant quality related gene.

In another preferred embodiment, described resistant gene is selected from the group：Anti-herbicide gene, antiviral base Cause, cold tolerance gene, high temperature resistant gene, anti-drought gene, waterlogging-resistant gene or anti insect gene.

In another preferred embodiment, described riddled basins are selected from the group：Gus (beta-glucuronidase) Gene, hyg (hygromycin) gene, neo (neomycin) genes or gfp (green fluorescent protein) gene.

In another preferred embodiment, described antigenic protein gene is selected from the group：Bacterium class antigen protein is (as suddenly Random toxin B, tetanus toxin etc.), virus type antigen protein (such as canine parvovirus), protozoa antigen protein (such as Ah rice Bar cause of disease LecA) or autoantigen protein (CTB-pins antigen proteins of such as type i diabetes).

In another preferred embodiment, described biological agent gene is selected from the group：α 2b interferon genes or pancreas Island element like growth factor gene.

In another preferred embodiment, described plant quality related gene is selected from the group：Amino acid improvement is related Gene, fat improvement related gene, starch improvement related gene or male sterility related gene.

In the third aspect, the present invention provides a kind of expression cassette, and the expression cassette from 5 ' to 3 ' has following elements successively：Power Profit requires promoter element, gene ORF sequences and the terminator described in 1.

In a preferred embodiment, described expression cassette also includes the one or more elements being selected from the group：poly(A) Element, enhancer, transhipment element or gene target element.

In fourth aspect, the present invention provides a kind of carrier, and the carrier contains the promoter described in first aspect present invention Expression cassette described in element or third aspect present invention.

In a preferred embodiment, the carrier is selected from：Bacterial plasmid, bacteriophage, yeast plasmid or plant cell disease Poisonous carrier, shuttle vector.

At the 5th aspect, the present invention provides a kind of host cell, and the host cell contains described in fourth aspect present invention Carrier or its chromosome on be integrated with it is whole on the promoter element described in the first aspect present invention of external source or its chromosome Conjunction has the expression cassette described in third aspect present invention.

In a preferred embodiment, (such as 1-50 is individual, preferably with one or more for the chromosome of the host cell 2-6) copy claim 1 described in promoter element or the expression cassette described in claim 3.

In another preferred embodiment, described host cell is selected from the group：Prokaryotic (such as Escherichia coli, chain Mould category or Agrobacterium), low eukaryotic (such as yeast cells) or higher eucaryotic cells (such as plant cell).

In another preferred embodiment, described host cell is plant cell, be more preferably crops, vegetables, Or the plant cell of flowers, it is more preferably legume cell, is most preferably crowtoe (Lotus corniculatus), pea (Lathyrus odoratus), soybean (Glycine max) or clover (Medicago sativa) plant cell.

At the 6th aspect, the present invention provides the promoter element described in first aspect present invention, second aspect of the present invention institute The construction stated, the expression cassette described in third aspect present invention are used for specific regulatory control foreign gene in legume root system tissue In expression purposes.

At the 7th aspect, the present invention provides a kind of side of the specific expressed foreign gene in legume root system tissue Method, it the described method comprises the following steps：

(a) construction is provided, the construction contains foreign gene and the sheet being operatively connected with the foreign gene Promoter element described in invention first aspect；

(b) construction for obtaining step (a) imports legume cell, obtains the legume cell of conversion；

(c) by the legume cytothesis of conversion in step (b) into pulse family plant, so that the foreign gene is in beans It is specific expressed in section's root system of plant tissue.

In a preferred embodiment, the foreign gene in other tissues of the legume in addition to root system tissue not Expression is not expressed substantially.

In eighth aspect, the present invention provides a kind of method of prepare transgenosis legume, and methods described includes following step Suddenly：

(a) following legume cells are provided, the legume cell contain carrier described in fourth aspect present invention, Or its chromosomal integration has promoter described in first aspect present invention or its chromosomal integration to have described in third aspect present invention Expression cassette；

(b) it is pulse family plant by the legume cytothesis of (a), so as to obtain transgenic leguminous plants.

At the 9th aspect, the present invention provides a kind of legume callus or legume body cell, and the pulse family is planted Thing callus or legume body cell include following legume cells or by following legume cellularities：The beans Section's plant cell, which contains carrier described in fourth aspect present invention or its chromosomal integration, opening described in first aspect present invention Mover element or its chromosomal integration have the expression cassette described in third aspect present invention.

It should be understood that within the scope of the present invention, above-mentioned each technical characteristic of the invention and have in below (eg embodiment) It can be combined with each other between each technical characteristic of body description, so as to form new or preferable technical scheme.As space is limited, exist This no longer tires out one by one states.

Brief description of the drawings

Fig. 1 is carrier p1301.P0G structural representation.

Fig. 2 is the callus photo after transgenosis.

Fig. 3 is the crowtoe of normal growth.

Fig. 4 is shown to after the progress digestion of blade sample DNA, digestion products are made with PCR result.

After Fig. 5 shows crowtoe maturation, the root system and blade of homophyletic carry out the result of GUS dyeing.

Embodiment

Inventor is by in-depth study extensively, it was unexpectedly found that one in soybean from substantial amounts of soybean gene The promoter of middle tissue specificity promotor gene expression, so as to lay base for the tissue specificity carrier of structure transgene expression Plinth.The present invention is completed on this basis.

Promoter of the present invention

Inventor has cloned promoter sequence (SEQ ID NO in soybean gene group:1), it is building up to and starts GUS bases In the expression vector of cause, and convert legume crowtoe.Dyed by GUS, successfully obtain legume root system specificity and open Mover-P1 (SEQ ID NO:1-GTGTTGAGCCACAACCATAGCCATGCTTTCACTCACTCACTCTCAACAAAGGTAACA CAAGAAGGAGAGAATAAAAAGGCAAGGTTGTTTGGTGTTGGTACTAGTAATTAGGTAAAGGGTGTGCCTTTACATAA GAAAACTTAACTGGGGCAACGTTAAAGCGGAGAGAAACGAATGGAGACAGAGAAAAAGAGTGAGTATATTTTAGTGC AACCACAGTTAGCGGTTGTTTCTTCTTCTTCTTCTTCTCTACCGTGGAACCAGCTCAGAGAATAAAAAATAAAAGGG AAGAGAGAGAGAAAGAAAGAAACTCTCTTTCATTGAGAAAAAGAAAAATTGCAGCGAATGGCTCCAAAAAAAATGTT AAACAGGAAACGCTGGTAAAAGGACCAGCTAAGATAAAACCAAAGCGAACCGAACCCCCCACACCCCACTCACTGTC CCTTCTGGGCAGAAACCGAAAGATTGAATTTTGAAGGAAGCCCACTTGTAGTTGTCGTGAGTTGAGCTCAAATAGCG GGGTTTTGTAGAGAGGTGAGAGGAATCCGGAAGGGTTTGAAAAGAAAGAGAAAGAGAAAGAAGGAGGGGCTTGAGGT AGAAGGAAGGAATAGATAGGGGTTAAAGTTTTAAGAGGGTAAAGAAGAAGAAACCCTAAGAAGCATAAACATGTTGG AGTTGAATGAAGAAGGGTGAGAGAGGGAATAAAGTGAGAAAAATGAGAAGAGCACGAAGATCGAGAAACATGGGAGG GAGGTTTTCTTTATAATTTTCGGCGCATTTACGTCCTTGTCCCTGTTCCTTTGATCTGACAGGATGGGGCCCACACT CCAGAGTGAGTCCTCACCAACTCTTTTCTCATTGTCAATTCCGGACCGGAGTTCAATATCCATGGGACATACATAGG ATTGGGATCCTCTAACATTATTCTTATTCTTATCATTTAATTAATCACAATTATTTTTCTATTTCTTTGCAATAAAT TACTCTGCTCCTGCTTAAGATCTTTCCATTAATTAATTAACTATGTCAATTAATTATATTATTATTTTTATCTTTTT ATTCACTTAATTATTTATTATTATTATTATTATTTGAAGAAAGAATAATTAAATAAAAATATGTATAAAAAAATATT AATACATCTAATTTTTTTTTAAAAAAAATCTTATAGTTATGAACGAAGGAAATAAGAATTAAAAATGAATCTATCTA TCTAGTGCTTTGAAATATTGATTAAAAAATTAAAAAAAAATATCAAAAATCATATAACAACATATTTAAAAATTATA AGGAAATACGTTTTTGGTGTATTTAATAAAATGTTTTTATTTTATTTTTTAATTAGTTTCCTTAGCATTTGCCACTA ATTAAGAATTACGAATTACGAATCTTTTTTTATAAGAAGAACAAAATAAGTGAGGAATAAGGTAGATAAAAATATAA AAAAATAATAAAAATAAAAAATTTAATTGTGCCTTTTTTTATCTTCTAGCAATATTACTTGCGACATAATAACACTT TACG)。

Term " promoter of the present invention " used herein, " legume root system specificity promoter ", " promoter P1 " or " P1 " is used interchangeably, and represents to come from the promoter element of legume, its sequence such as SEQ ID NO:Shown in 1.

The present invention promoter can efficiently, exclusively in legume root system specific promotor gene expression, and Expression quantity is extremely low in other tissues or does not express.Therefore, promoter of the invention, which can be used for specificity, improves legume Character, avoid foreign gene from having an impact other tissues of legume.

Term " promoter " used herein or " promoter region (domain) " refer to a kind of accurate and effective initial gene transcription work( The nucleotide sequence of energy, guiding gene nucleotide sequence are transcribed into mRNA, and it is typically found in the upstream (5 ' of target gene coded sequence End), usually, promoter or promoter region provide RNA polymerase and the correctly knowledge of other factors necessary to starting transcription Other site.

Herein, the promoter or promoter region (domain) include the variant of promoter, and promoter variants can pass through Regulatory region is deleted in insertion, carries out random or rite-directed mutagenesis etc. to obtain.

In view of the teachings of the present invention and prior art, it will be recognized by one of ordinary skill in the art that although the implementation of the present invention The promoter P1 provided in example sequence such as SEQ ID NO:Shown in 1, but the present invention should also include the promoter sequence with the present invention Arrange (SEQ ID NO:1) have 50% or more (preferably more than 60%, more than 70%, more than 80%, more preferably more than 90%, more preferably The nucleic acid of more than 95%, most preferably more than 98%, such as 99%) homology, if the nucleic acid also have it is special in legume root system The function of opposite sex expression." homology " refers to according to position identical percentage, the similar level between two or more pieces nucleic acid (i.e. sequence similarity or homogeneity).

Those of ordinary skill in the art should also be understood that after specific promoter is obtained, 5 ' ends of the promoter and/ Or 3 ' to truncate or increase some nucleotides and remain to obtain with the same or analogous promoter variants of former promoter function be to hold at end It is facile.For example, in a particular embodiment, present invention resides in SEQ ID NO:Polynucleotides shown in 15 ' end and/ Or 3 ' end truncate or increase 1-60, preferably 1-30, more preferably 1-6 nucleotides, and with legume root system specifically The polynucleotides of the promoter activity of startup function.

Legume

Pulse family (Leguminosae sp.) plant is distributed widely in the whole world.There are 172 category in China, 1485 kinds, 13 subspecies, 153 mutation, 16 modifications；Each provinces and regions are distributed.The section plant has important economic implications, it be starch in human food, One of protein, oil and important sources of vegetables.Legume crop agriculturally has soybean, peanut, broad bean, pea, red bean, green Beans, cowpea, kidney bean and French beans etc..

In a preferred embodiment, legume as described herein include crowtoe (Lotus corniculatus), Pea (Lathyrus odoratus), soybean (Glycine max) or clover (Medicago sativa).

Term " specific expressed " used herein refers to target gene specific time and/or specific group in plant The expression knitted, and expression quantity is extremely low in other tissues or does not express.Specifically, it is as described herein " in legume root system Specific expression " refer to the present invention promoter regulation under, target gene high degree of specificity and in specific manner pulse family plant Expressed in thing root system.Term " root system " used herein has the implication that those of ordinary skill in the art are generally understood that.It is overall next Say, " root system " as described herein is the general name of one plant of plant whole root.Root system has the system of taproot and the major class of the system of fibrous root two.It is most Gymnosperm and dicotyledon, such as legume have the system of taproot；Monocotyledonous main root is undeveloped, and its root system is palpus Root system.

Term " external source " used herein or " heterologous " refer to the two or more pieces nucleic acid or protein of separate sources Relation between sequence.For example, if the combination of promoter and objective gene sequence were not usually naturally occurring, promoter It is external source for the target gene.For cell that particular sequence is inserted for it or organism and " external source ".

" cis-regulating element " used herein refers to the guarantor played regulatory role to the transcription initiation and transcriptional efficiency of gene Keeping property base sequence.

The promoter of the present invention operationally can be connected with foreign gene, and the foreign gene can be relative to promoter External source (heterologous).Foreign gene (or target gene) as described herein is not particularly limited, and can be RNAi genes or coding Gene with specific function albumen, such as some have key property or function in agricultural or the improvement of plant or legume Albumen.

The representative example of the foreign gene includes but is not limited to：Resistant gene, riddled basins, antigen protein Gene and biological agent gene or plant quality related gene.

Described resistant gene is selected from the group：It is anti-herbicide gene, antiviral gene, cold tolerance gene, high temperature resistant gene, anti- Non-irrigated gene, waterlogging-resistant gene or anti insect gene.Described riddled basins are selected from the group：Gus (beta-glucuronidase) base Cause, hyg (hygromycin) gene, neo (neomycin) genes or gfp (green fluorescent protein) gene.Described antigenic protein gene And biological agent gene is selected from the group：Bacterium class antigen protein (such as cholera toxin B, tetanus toxin etc.), virus type antigen egg (such as canine parvovirus), protozoa antigen protein (amoeba cause of disease LecA), autoantigen protein (such as type i diabetes in vain CTB-pins) or biological agent (such as α 2b interferon, IGF etc.).Described plant quality related gene It is selected from the group：Amino acid improvement related gene, fat improvement related gene, starch improvement related gene or male sterility dependency basis Cause.

Present invention also offers a kind of expression casette, the expression cassette has following elements successively from 5 ' -3 '：The present invention Promoter, gene ORF sequences and terminator.Preferably, the promoter sequence such as SEQ ID NO.:1 shown or and SEQ ID NO.:Homology >=95% of sequence shown in 1, preferably >=98%, more preferably >=99%.

Present invention also offers a kind of recombinant vector, and it includes the promoter of the present invention and/or expression casette.Preferred Embodiment in, the promoter downstream of the recombinant vector includes multiple cloning sites or at least one restriction enzyme site.Need table During up to target gene, target gene is connected into suitable multiple cloning sites or restriction enzyme site, so as to the purpose that is operably connected Gene and promoter.In another preferred embodiment, the recombinant vector includes on 5 ' to 3 ' directions：Promoter, mesh Gene and terminator.If desired, the recombinant vector can also include elements below：3 ' polymerized nucleosides are acidified signal；It is non- Translate nucleotide sequence；Transhipment and targeting nucleotide sequence；Resistance selective marker (dihyrofolate reductase, neomycin resistance, hygromycin Resistance and green fluorescent protein etc.)；Enhancer；Or operator.

Method for Prepare restructuring carrier is well known to those of ordinary skill in the art.Expression vector can be bacterium Plasmid, bacteriophage, yeast plasmid, plant cell virus, mammalian cell virus or other carriers.In a word, as long as it can Replicated in host and stably, any plasmid and carrier are all can be with adopted.

Those of ordinary skill in the art can use well known method structure to contain promoter of the present invention and/or target gene The expression vector of sequence.These methods include recombinant DNA technology in vi, DNA synthetic technologys, In vivo recombination technology etc..

Promoter, expression cassette or the carrier of the present invention, can be used for converting appropriate host cell, so that host expresses egg White matter.Host cell can be prokaryotic, such as Escherichia coli, streptomyces, Agrobacterium：Or low eukaryotic, such as ferment Mother cell；Or higher eucaryotic cells, such as plant cell.Persons skilled in the art are aware that how to select appropriate carrier And host cell.It can be carried out with recombinant DNA conversion host cell with routine techniques well known to those skilled in the art.When host is During prokaryotes (such as Escherichia coli), CaCl2 methods can be used to handle, it is also possible to which electroporation is carried out.When host is eucaryote, Following DNA transfection methods can be selected：Calcium phosphate precipitation, conventional mechanical methods (such as microinjection, electroporation, liposome Packaging etc.).The methods of Agrobacterium-mediated Transformation or via Particle Bombardment Transformation can also be used in conversion plant, such as leaf disk method, rataria conversion method, flower Bud infusion method etc..Wherein, Agrobacterium Ti/Ri plasmids conversion method is common transgenic technology.Agrobacterium energy infection plant, and energy Section of DNA on its plasmid is inserted in people's Plant Genome, causes the change of plant genetic characteristic.Using this characteristic, external source Gene integration is on plasmid, using plasmid as vector introduction recipient cell.This method is mainly carried out former using Ti/Ri plasmid-derived vectors Plastid co-cultivation, plant tissue co-cultivation and protoplast fusion are given birth to realize gene transfer.Plant cell, group for conversion Knit or organ can regenerate plant with conventional method, so as to obtain the plant of transgenosis.

In a preferred embodiment, the method for prepare transgenosis plant is：To carry the promoter that is operatively connected and The carrier of target gene is transferred to Agrobacterium, and the carrier segments containing promoter and target gene are incorporated into the dye of plant by Agrobacterium again On colour solid.In a particular embodiment, recombinant vector of the invention is P1301.p0G plasmids, by the promoter structure of the present invention It is built in the carrier, transformed plant, promoter will activate the expression of GUS base prisoners, and the startup is activated sub-district cis acting The regulation and control of element, it can effectively simulate gene and be activated in vivo the situation of transcription.

Beta-glucuronidase (GUS) the energy a series of beta-glucosidase of catalytic pyrolysis, generation have chromophore or fluorescence Material, can be with carrying out quantitative analyzing with space orientation to GUS activity the methods of spectrophotometer, fluorescence photometer or histochemistry. In the art, gus gene has been widely used as the reporter gene of genetically modified plants, bacterium and fungi, and particularly it can quilt Specific cell and tissue site for Study of Exogenous gene expression.

In a particular embodiment of the present invention, under the startup of promoter of the present invention, gus gene can be specifically in pulse family Express in root system of plant, and do not expressed in other tissues.Therefore the promoter, which can be used for the specificity in root system, improves beans The character of section plant, without causing foreign gene to impact other tissues.

Promoter, construction or expression cassette of the present invention etc. can be used for the specifically expressing external source base in legume root system Cause, so as to improve the economical character of legume (yield, the quality of such as legume), or enhancing legume to adverse environment The resistivity of (such as freezing, high temperature, arid, virus, germ, insect pest or artificial weeding agent).Present invention may also apply in pulse family Protein product (such as antigen protein and biological agent) is specifically produced in root system of plant, or for Study of Exogenous gene in root system In specific function.

Advantages of the present invention

1. the expression vector comprising promoter of the present invention expresses downstream reporter gene or function base in the root system of legume Because, and do not express in its hetero-organization or low expression, so as to effectively control the expression position of gene；

2. the promoter of the present invention is the own sequence of legume, suitable for a variety of including soybean, crowtoe Legume, avoid the disorder of gene expression dose in plant caused by exogenous array possibility；Opened based on promoter of the present invention The transgenic strain of hair is not present as caused by promoter sequence the problem of biological safety；

3. the expression vector of the present invention is not influenceed by transgenic technology species, suitable for infecting callus group including Agrobacterium Knit, a variety of transgenic technologys including stem apex method；

4. it is (degeneration-resistant, anti-to carry out genetic modification using the transgene expression vector of promoter of the present invention structure and to soybean Insect pest, improve nitrogen-fixing efficiency) instrument, can effectively excavate the gene of unknown function, screen effective tissue specific promoter Carrier, for building transgene carrier；

5. enable to external source target gene height in particular organization using promoter of the present invention in plant genetic engineering Effect expression, is timed to exogenous gene expression, pinpoints, quantitative three-dimensional accuracy controlling to realize.

With reference to specific embodiment, the present invention is expanded on further.It should be understood that these embodiments are merely to illustrate the present invention Rather than limitation the scope of the present invention.The experimental method of unreceipted actual conditions in the following example, generally according to conventional strip Part such as Sambrook et al., molecular cloning：Lab guide (New York：Cold Spring Harbor Laboratory Press, 1989) condition described in, or according to the condition proposed by manufacturer.Unless otherwise indicated, otherwise percentage and Number is calculated by weight.

Unless otherwise defined, anticipated known to all specialties used in text and scientific words and one skilled in the art Justice is identical.In addition, any method similar or impartial to described content and material all can be applied in the present invention.Described in text Preferable implementation only present a demonstration and be used with material.

Embodiment

The clone of root system specificity promoter in the soybean of embodiment 1.

The soybean Williams82 genomic DNAs extracted in conventional manner are template, utilize following primer pair (SEQ ID NO.:2-3；With SEQ ID NO:4-5) with KOD high-fidelity enzymes, promoter is expanded by conventional PCR method, and purify；Wherein, Primer pair SEQ ID NO:4-5 clones promoter P1 (the SEQ ID NO of the present invention:1), primer pair SEQ ID NO:2-3 Specific promoter sequence is not cloned.

Forward primer:GGGGTACCGGTCACCCAGATATCATTTGCTGAAA(SEQ ID NO:2)；

Reverse primer:TCCCCCGGGGCCACAGCCATAGCCATGCTTTC(SEQ ID NO:3)；

Forward primer:GGGGTACCGTGTTGAGCCACAACCATAGCCA(SEQ ID NO:4)；

Reverse primer:GGAATTCGTAAAGTGTTATTATGTCGCAAGTAATATTGCTA(SEQ ID NO:5)；

PCR amplification conditions are：

94℃,2min；

98℃,10sec；

60℃,30sec；

68℃,1min；

68℃,7min；

35 circulations.

Agarose gel electrophoresis reclaims PCR primer.

Embodiment 2. builds GUS expression vectors

The promoter sequence that embodiment 1 is obtained and commercial vector p1301.P0G (Liu Wei etc., M. truncatula small G-protein RO Effect during symbiosis：The functional analysis that 2.MtROP5 regulation root hairs grow, Scientia Agricultura Sinica, 2010,43 (8)) it is connected, is transformed into e.colistraindh5α (Shanghai Jie Mei genes Pharmaceutical Technology Co., Ltd, Shanghai) and is protected Deposit.After sequence verification, agrobacterium tumefaciens EHA105 (Beijing Baeyer enlightening biotech company, Beijing) is converted.Specific steps are such as Shown in lower：

1. digestion PCR primer and p1301.P0G carriers

Double digestion is made to PCR primer and p1301.P0G carriers with restriction endonuclease Hind III/Sal1, wherein, PCR primer Endonuclease reaction condition is as follows：

PCR primer：1ug

10*fast digest buffer：5ul

Hind III:1ul

Sal1:1ul

Cumulative volume：50ul

37℃,5min。

The endonuclease reaction condition of carrier is as follows：

P1301.p0G plasmids：1ug

10*fast digest buffer：5ul

Hind III：1ul

Sal1：1ul

Cumulative volume：50ul

37℃,5min。

Agarose gel electrophoresis, rubber tapping recovery are made to the digestion products of PCR primer and carrier.The PCR digestion products of recovery And carrier digestion products make quantitative analysis through agarose electrophoresis.PCR digestions are calculated with Alpha Imager gel imaging systems to produce Mol ratio relation between thing and carrier digestion products.

2. carrier connects

Carrier is connected with T4DNA ligases and PCR primer obtains connection product, and reaction condition is as follows：

10*T4DNA ligase buffer solutions：1ul

p1301.P0G：50ng

PCR primer：20ng

T4DNA ligases：1ul

Cumulative volume：10ul

16℃,24h

3. connection product transformed competence colibacillus cell DH5 α

Take 100ul freezing competent cells (exponential phase, OD：0.4-0.5), 10ul connection products are added, sample is light It is light to mix, place 30 minutes on ice.Heat shock 90 seconds at 42 DEG C, are put in rapidly cooled on ice 2 minutes.400ul is added into EP pipes LB culture mediums, 37 DEG C of shaken cultivations 1 hour.Nutrient solution 100ul is taken to be coated on the LB flat boards containing kanamycins, 37 DEG C incubated Overnight (12-16 hours).

4. clone's checking

Picking 10 is cloned and numbered.Whether it is positive with bacterium colony PCR checkings clone.PCR amplification conditions are as described above. Pcr amplification product enters row agarose gel electrophoresis, and the clone of autotelic band numbering can be primarily determined that as positive colony.

6. carrier sequence verification

Picking colony PCR positive colonies, liquid LB+Kan are cultivated 16 hours in 37 DEG C, extract plasmid.Send raw work biology work Journey (Shanghai) limited company is sequenced with universal primer.Sequence confirms errorless, vector construction success.

7. convert agrobacterium tumefaciens EHA105

Take 100ul to freeze competent cell, add 10ul connection products, sample gently mixes, and places 30 minutes on ice.42 Heat shock 90 seconds at DEG C, are put in rapidly cooled on ice 2 minutes.400ul LB culture mediums are added into EP pipes, 37 DEG C of shaken cultivations 1 are small When.Nutrient solution 100ul is taken to be coated on the LB flat boards containing kanamycins, 37 DEG C incubated overnight (12-16 hours).

The acquisition of the transfer-gen plant of embodiment 3.

Whole plant conversion is carried out to legume using the agrobacterium tumefaciens that embodiment 2 obtains.Select the arteries and veins of legume hundred Root is used for the function of verifying tissue specific expression carrier.By the agrobacterium tumefaciens containing organizing specific expression promoter vector EHA105 transfects plant callus, in being cultivated in greenhouse, so as to obtain transfer-gen plant.Fig. 2 and Fig. 3, which is respectively illustrated, turns base The crowtoe of callus photo and normal growth because after.

Embodiment 4.GUS histochemical stains

After transgenosis crowtoe maturation, blade sample DNA is extracted, according to designed restriction enzyme site：Hind III and Sal1, carries out digestion, and recovery digestion products enter performing PCR.Shown in result figure 4.Left side second strip is Reference Strip, the 3rd to Five bands are the sample of 3 leaves, and gus gene fragment is about 600bp or so, as a result show that gus gene is present.

The root system tissue of ripe plant and blade is taken to carry out GUS dyeing again, alcohol observes root system tissue and blade after decolourizing Color, as a result as shown in Figure 5.As shown in Figure 5 as can be seen that gus gene is only expressed in root system tissue, phenotype is obvious, and Although leaf tissue exists but not expressed.So as to illustrate the promoter of the present invention can in the root system tissue of legume it is special Different in nature ground is correct to start gus gene expression.

In summary, transgene carrier of the invention can successfully infect legume plant, build transgenic strain, this turn Gene strain unobvious change plant forms.Transgene carrier can be successively inserted into genome, in blade and root system tissue DNA The presence of gus gene can be detected in sample, but only has the expression of gus gene in root system tissue, it was demonstrated that be constructed Organizing specific expression carrier is successful.

Thus, the present invention has obtained specific expressed promoter in the root system tissue of legume.

All it is incorporated as referring in this application in all documents that the present invention refers to, it is independent just as each document It is incorporated as with reference to such.In addition, it is to be understood that after the above-mentioned instruction content of the present invention has been read, those skilled in the art can To be made various changes or modifications to the present invention, these equivalent form of values equally fall within the model that the application appended claims are limited Enclose.

Claims (7)

1. a kind of promoter element, the promoter element are：

Nucleotide sequence such as SEQ ID NO:Polynucleotides shown in 1.

2. a kind of construction, the construction contains foreign gene and the claim 1 being operatively connected with foreign gene institute The promoter element stated.

3. a kind of expression cassette, the expression cassette from 5 ' to 3 ' has following elements successively：Promoter member described in claim 1 Part, gene ORF sequences and terminator.

4. a kind of carrier, the carrier contains the expression cassette described in promoter element or claim 3 described in claim 1.

5. the promoter element described in claim 1, the construction described in claim 2, expression cassette described in claim 3 Purposes, for expression of the specific regulatory control foreign gene in legume root system tissue.

6. a kind of method of the specific expressed foreign gene in legume root system tissue, the described method comprises the following steps：

(a) construction is provided, the construction contains foreign gene and the right being operatively connected with the foreign gene will Seek the promoter element described in 1；

(b) construction for obtaining step (a) imports legume cell, obtains the legume cell of conversion；

(c) by the legume cytothesis of conversion in step (b) into pulse family plant, so that the foreign gene is planted in pulse family It is specific expressed in thing root system tissue.

7. a kind of method of prepare transgenosis legume, the described method comprises the following steps：

(a) following legume cells are provided, the legume cell contains carrier described in claim 4 or its chromosome It is integrated with promoter described in claim 1 or its chromosomal integration is had the right expression cassette described in requirement 3；

(b) it is pulse family plant by the legume cytothesis of (a), so as to obtain transgenic leguminous plants.