CN102618543A - Root-specific and harm inducible promoter from glycine max - Google Patents

Abstract

The invention provides a root-specific and harm inducible promoter GmChi1p separated from glycine max. A nucleotide sequence is shown as SEQ ID NO.1. A glycine max chitinase 1 gene promoter (GmChi1p) is cloned, and a plant expression vector pCAM1391Z-GmChi1p is constructed by a primer designed uniquely and taking deoxyribonucleic acid (DNA) of a glycine max 'Jungery' genome as a template; and functional verification is performed by bacillus-mediated tobacco genetic transformation and a mode of expressing a glucuronidase (GUS) gene, namely the promoter can drive the GUS gene to be expressed specifically in roots of transgenic tobaccos and to be subjected to inducible expression efficiently by harm in the transgenic tobaccos. The promoter can replace a 35S promoter to be applied to the study of transgenic plants, and particularly the study of the pest and disease resistance, adverse resistance, high yield or quality improvement of transgenic crops.

Description

A kind of root-specific available from soybean is held concurrently and is injured inducible promoter

Technical field

This invention relates to plant gene promoter and application thereof, provides a kind of root-specific available from soybean to hold concurrently and has injured inducible promoter.Belong to biological technical field, relate in particular to genetically engineered fields such as crop disease and pest resisting and crop, degeneration-resistant, high yield or quality-improving.

Background technology

Soybean (Glycine max L.Merrill) is important oil crops and cash crop, in China's agriculture prodn and even whole national economy, all has critical role.There is the several diseases insect pest in soybean in producing for a long time always, and is wherein serious with grey speck of soybean, phytophthora root rot, oidium, root-knot nematode disease etc., and mycosis and insect pest are the major reasons that causes soybean quality and output to descend.Importing soybean through the genetic engineering technique resistant gene of will being correlated with, is the available strategy that improves soybean disease resistance and yield-power now.

At present, a large amount of separated clones of good new gene, but comparatively widely used promotor has the CaMV 35S promoter from cauliflower mosaic virus in the plant genetic engineering are from promotor (Sanders et al., 1987 such as the Act1 of plant itself, Ubi1; McElroy et al., 1990).These all are constitutive promoters.Because the gene that constitutive promoter drives all has expression in various degree in plant different tissues organ, expose some problems in the application gradually.As a rule; People do not hope foreign gene wide expression in the whole plant of transgenic plant, whole growing; Because can increase the metabolism burden of plant on the one hand, on the other hand, some foreign protein is to plant and nonessential even poisonous; Be unfavorable for plant normal growth (Kasuga et al., 1999).Therefore; Research and utilize histoorgan Idiotype promotor and inducible promoter to seem particularly important; Not only can realize when exogenous gene expression implemented, the three-dimensional regulation and control of sky, amount, have many-sided potential values (Venter, 2007) such as economy, environmental protection and Biosafety simultaneously.Tissue specificity or abduction delivering promotor all are the emphasis and the difficult points of plant genetic engineering research all the time.

Tissue-specific promoter can make expression of exogenous gene only occur in some specific organ or tissue position, and often shows the characteristic of growing adjusting.At present, the research of most of organizing specific promotors mainly concentrates on the over-ground part of plant, and the research of root-specific promoter and application be (Potenza et al., 2004) also seldom.Yet; Plant roots is unique organ that grows in underground part; It not only has the vital role of absorption, transportation, storage nutrient; Also be with soil in the part that contacts at first of pathogen, the still part of plant self-defence system under some adverse environmental factor, so root specific promoter has excellent application value in plant disease-resistant and resistance improvement improve with plant quality.Along with going deep into of research, the special promotor of some roots of plants (Xu et al., 1995 have been reported in succession; Sch ü nmann et al., 2004; Del Campillo, 2004; Koyama et al., 2005; Nitz et al., 2001; Vijaybhaskar et al., 2008; Liu et al., 2003; Winicov et al., 2004).Yet, can in genetically engineered genetic improvement and agriculture prodn, use still seldom.

Inducible promoter can make foreign gene that some signal is produced response, only under distinctive signal stimulates, expresses.The research of plant injury or pathogenic bacterium inducing type promotor is a lot, is a research focus of plant biotechnology field.Plant can be induced by pathogen infection and produces multiple defense response; Especially produce pathogenesis-related proteins (PR albumen: Pathogenesis-Related Proteins), chitinase is one of main plant pr-5 proteins, through important component to fungal cell wall---chitinous hydrolysis; Suppress fungi growth propagation; Thereby improve the fungal resistance of plant, in plant is resisted the defense response of fungal disease, bringing into play important effect (Boller et al., 1983).Chitinase extensively is present in each kind of plant, the developmental regulation of involved in plant, as bloom, solid etc.; The process (Kasprzewska, 2003) such as disease-resistant and pest-resistant of involved in plant also.Research shows that chitinase expression amount under the plant normal growth situation is extremely low or do not express, but when receiving pathogenic bacteria, injury and signaling molecule and induce expression amount increase sharply (Xu et al., 2007; Whipps et al., 2008), fast and its promotor of intensive induced reaction characteristic hint has important practical value in plant genetic engineering.

From several plants such as Arabidopis thaliana, obtained at present the promoter sequence of chitinase gene; And its induction regulating controlling characteristic identified: like the acid chitinase gene promotor of Arabidopis thaliana is a kind of mycosis original evoked promoter, induced by dry thread Pyrenomycetes (Rhizoctonia solani); In transgenic Fructus Lycopersici esculenti, receive tomato early blight bacterium (Alternaria solani) abduction delivering (Samac and Shah, 1991).Vitis Amurensis ClassIII chitinase gene VCH3 promotor receives external source to apply SA and induces specific efficiently expressing in vascular tissue; And the quantity of the SA cis-acting elements that contains in the size of expression amount and the VCH3 promotor be directly proportional (Li et al., 2005).Discovery leaf mustard Class I chitinase gene promotor BjCHI1 such as Wu Xuefeng can drive gus gene responds biologies such as injury, MeJA, NaCl and PEG and abiotic factor in transgene tobacco and Arabidopis thaliana induced strong; And proof T/G-box (AACGTG) sequence is wherein given the MeJA inducing properties (Wu et al., 2009) of BjCHI1 promotor first.Capsicum class II chitinase gene CAChi2 promoter-driven GUS gene receives that infection process, osmotic stress and SA's induce strong expression (Hong and Hwang, 2011).But the homology degree is low between above-mentioned promoter sequence, and the controlling element of the responsing reaction of envrionment conditions to external world that exists in the promotor is distinguished to some extent, and each promotor exists induces the startup activity difference.Up to the present, the Study on Genetic Transformation that the Regulation Mechanism of chitinase gene promotor is carried out only is confined on the minority model plant, to the paractical researchs of farm crop but seldom, does not see that more it carries out the report of genetic transformation in soybean.

The successful Application of plant gene engineering technology not only needs the promotor of a large amount of regulation and control different levelss, and the promotor that need be suitable for different plant backgrounds, different organ, tissue, transgenic type is to avoid the disadvantageous effect in the transgenic process.The plant endogenous organizing specific that in high yield, quality-improving and the disease and insect resistance genetically engineered Genetic carrier of soybean make up, can select for use or inducible promoter are still seldom; Therefore, from soybean, excavating the different and/or injury inducible promoter of more Gent has great importance to fundamental research and production application.

Receive the harm of various mycosis insect pests in the soybean production process deeply, the soybean chitinase equally also receives abduction delivering (Liubas, 2001 of pathogenic bacteria, injury and exciton etc.; Gijzen et al., 2001), therefore, the promotor that the inventor feels the regulating and controlling soybean chitinase gene deeply has researching value.Effort through the inventor; Success be separated to soybean chitinase gene promotor (GmChi1p); And has the root tissue specificity through experiment proof promotor of the present invention; And the induced strong that can be hurt is expressed, and can hold concurrently as the root-specific of plant-sourced and injure inducible expression vector, in crops quality improvement and disease and insect resistance genetically engineered, good application prospects is arranged.

Reference used in the literary composition is specific as follows:

1.Boller?T，Gehri?A，Mauch?F，et?al.Chintinase?in?bean?leaves：induction?by?ethylene，purification，properties，and?possible?function[J].Planta，1983，157：22-31.

2.del?Campillo?E，Abdel-Aziz?A，Crawford?D，et?al.Root?cap?specific?expression?of?an?endo-β-1，4-D-glucanase(cellulase)：a?new?marker?to?study?root?development?in?Arabidopsis，Plant?Molecular?Biology，2004，56：309-323

3.Gijzen?M，Kuflu?K，Qutob?D，et?al.A?class?I?chitinase?from?soybean?seed?coat.J?Exp?Bot.，2001，52：2283-2289

4.Hong?JK?and?Hwang?BK.Promoter?activation?of?pepper?class?II?basic?chitinase?gene，CAChi2，and?enhanced?bacterial?disease?resistance?and?osmotic?stress?tolerance?in?the?CAChi2-overexpressing?Arabidopsis.Planta，2011，10.1007/s00425-005-0099-6(on?line)

5.Kasprzewska?A..Plant?chitinases-regulation?and?function.Cell?Mol?Biol?Lett.，2003，8：809-824

6.Kasuga?M，Liu?Q，Miura?S，Yamaguchi-Schinozaki?K，and?Shinozaki?K.Improving?plant?drought，salt，and?freezing?tolerance?by?gene?transfer?of?a?single?stress-induciable?transcription?factor.Nat?Biotechnol，1999，17：287-291

7.Koyama?T，Ono?T，Shimizu?M，et?al.Promoter?of?Arabidopsis?thaliana?phosphate?transporter?gene?drive?root-specific?expression?of?transgene?in?rice.J?Biosci?Bioeng，2005，99：38-42

8.Li?HY，Qi?J，Shu?HR，et?al.Isolation?and?Characterization?of?a?Chitinase?Gene?VCH3?Promoter?from?Grapevine(Vitis?amurensis)Journal?of?Plant?Physiology?and?Molecular?Biology?2005，31(5)：485-491

9.Liu?JJ，Ekramoddoullah?AK.Root-specific?expression?of?a?western?white?pine?PR10?gene?is?mediated?by?different?promoter?regions?in?transgenic?tobacco.Plant?Mol?Biol，2003，52：103-120

10.Liubas?KS.The?influence?of?fusarium?oxysporum?infection?and?low?temperatures?on?the?activity?of?soybean?esterase?and?PR?proteins[J].Icel?Agr?Sci，2001，14：67-73.

11.McElroy?D，Zhao?W，Cao?J，et?al.Isolation?of?an?efficient?actin?promoter?for?use?in?rice?transformation.Plant?Cell，1990，2：163-171

12.Nitz?I，Berkefeld?H，Puzio?PS，et?al.Pyk10，a?seedling?and?root?specific?gene?and?promoter?form?Arabidopsis?thaliana.Plant?Sci.，2001，161：337-346

13.Potenza?C，Aleman?L，Sengupta-Gopalan?C.Targeting?transgene?expression?in?research，agricultural，and?environmental?applications：promoters?used?in?plant?transformation.In?Vitro?Cell?Dev?Biol.，2004，40：1-22

14.Samac?DA?and?Shah?DM.Developmental?and?pathogen-induced?activation?of?the?Arabidopsis?acidic?chitinase?promoter[J].Plant?Cell，1991，3：1063-1072

15.Sanders?PR，Winter?JA，Barnason?AR，et?al.Comparison?of?cauliflower?mosaic?virus?35S?and?nopaline?synthase?promoters?in?transgenic?plants.Nucleic?Acids?Res，1987，15：1543-1558；

16.Schünmann?PHD，Richardson?AE，Smith?FW，et?al.Characterization?of?promoter?expression?patterns?derived?from?the?Phtl?phosphae?transporter?genes?of?barley(Hordeum?vulgare?L.).J?Exp?Bot.，2004，55：855-865

17.Venter?M.Synthetic?promoters：genetic?control?through?cis?engineering.Trends?Plant?Sci，2007，12：118-124

18.Vijaybhaskar?V，Subbiah?V，Kaur?J，et?al.Identification?of?a?root-specific?glycosyltransferase?from?Arabidopsis?and?characterization?of?its?promoter.J.Biosci.，2008，33：1852-193

19.Whipps?JM，Hand?P，Pink?D，et?al.Phyllosphere?microbiology?with?special?reference?to?diversity?and?plant?genotype.J?Appl?Microbiol.，2008，105：1744-1755.

20.Winicov?I，Valliyodan?B，Xue?L，et?al.The?MsPRP2?promoter?enables?strong?heterologous?gene?expression?in?a?root-specific?manner?and?is?enhanced?by?overexpression?of?Alfin?1.Planta，2004，219：925-935

21.Wu?XF，Wang?CL，Xie?EB，et?al.Molecular?cloning?and?characterization?of?the?promoter?for?the?multiple?stress-inducible?gene?BjCHI1?from?Brassicajuncea.Planta，2009，229：1231-1242

22.Xu?FH，Fan?CM，He?YQ，et?al.Chitinases?in?Oryza?sativa?ssp.japonica?and?Arabidopsis?thaliana[J].J.Genet.Genomics，2007，34(2)：138-150

23.Xu?Y，Buchholz?WG，DeRose?RT，et?al.Characterization?of?a?rice?gene?family?encoding?root-specific?proteins.Plant?Mol?Biol.，1995，27：237-248

Summary of the invention

The object of the invention is intended to overcome the deficiency of prior art; One provides a kind of double injury of root-specific inducible promoter available from soybean; Two provide a kind of recombinant vectors of this promotor; Three provide the transformant with this recombinant vectors preparation, and four provide the application of the double injury of this root-specific inducible promoter, recombinant vectors and transformant.

One of the object of the invention can be realized through following technical measures:

The present invention provides a kind of new root-specific to hold concurrently and injures inducible promoter, by the DNA with nucleotide sequence shown in the SEQ ID NO.1.Inducing here is meant that injury induces (like insect pest).

Two of the object of the invention can be realized through following technical measures:

This recombinant vectors wherein contain one of above-mentioned purpose available from the root-specific of the soybean injury inducible promoter of holding concurrently, thereby comprise the structure gene that is used for the crop quality improvement and/or the structure gene and/or the regulatory gene of regulatory gene or antimycotic insect pest plays a role it under root-specific is held concurrently the injury inducible promoter.

Three of the object of the invention can be realized through following technical measures:

This transformant is carrier described in the claim 2 to be imported the host make.

Three of the object of the invention also can be realized through following technical measures:

Described host is a plant materials.

Four of the object of the invention can be realized through following technical measures:

Should holding concurrently available from the root-specific of soybean, injury inducible promoter, recombinant vectors and transformant are applied to the plant quality improvement, the engineered industry of disease and insect resistance prepares.It can drive foreign gene at the transgenic plant root system specifically expressing or the abduction delivering that in transgenic plant, is hurt; Can substitute 35S promoter and be applied to the Agricultural biotechnologies breeding, to improve crop disease-resistant, pest-resistant proterties, resisting abiotic adverse circumstance and high crop yield, quality-improving.

The present invention is that example is described further with the tobacco:

The present invention has obtained the double injury of a kind of root-specific that in dicotyledons such as tobacco, effectively plays a role inducible promoter; Realized the organizing specific expression of this promoters driven foreign gene, and in tobacco leaf, flower, anthocaulus, all had and injure the abduction delivering characteristic efficiently at tobacco root.

Merge with gus reporter gene and follow the tracks of the GUS enzyme and induce the expression in the tobacco plant under the processing having or not through injury inducible promoter that root-specific of the present invention is held concurrently, just can confirm the different double injury abduction delivering pattern of the Gent of this promotor in tobacco plant.

The double injury of root-specific of the present invention inducible promoter is obtained by following method:

According to the soybean Class I chitinase gene (chitinase that has reported among the GenBank; GmChi1) (GenBank:AF202731.1) sequence; (http://soybase.org/SequenceIntro.php) search and definite GmChi1 gene 5 ' upstream promoter district in the soybean DB, the design special primer extracts the soybean gene group and carries out pcr amplification; The fragment that obtains is carried out sequencing; The result show with the soybean DB in the sequence similarity degree reach 99.8%, thereby clone the upstream regulatory sequence of GmChi1 gene start codon upper reaches 1641bp, comprise part 5 ' UTR district.

Clone's 1.64Kb control region is built among the plant expression vector pCAMBIA1391Z, obtains driving the pCAM1391Z-GmChi1p recombinant expression vector that gus gene is expressed by the GmChi1 gene promoter.Then the pCAM1391Z-GmChi1p recombinant plasmid is transformed Agrobacterium EHA105 with freeze-thaw method, utilize the leaf disc method that tobacco is carried out genetic transformation.Transfer-gen plant is carried out the GUS histochemical stain, prove that this promotor is the root tissue specific promoter; The transfer-gen plant that injury is handled carries out the GUS histochemical stain, proves that this promotor is the injury inducible promoter.

The advantage of this invention has been to obtain the double injury of a kind of novel root-specific inducible promoter; This promotor can drive foreign gene efficient specifically expressing in the transgenic plant root system; And expressed by the injury efficient induction, be fit to make up plant expression vector and be used for crop disease-resistant worm or resistance improvement and high crop yield, quality-improving.

Description of drawings

Fig. 1: GmChi1p promotor clone and vector construction enzyme are cut checking; Swimming lane M:Wide Range DNA Marker (500-12,000); The checking of swimming lane 1:pMD18-T-GmChi1p plasmid enzyme restriction; Swimming lane 2: soybean gene group GmChi1p pcr amplification result; The checking of swimming lane 3:pCAM1391Z-GmChi1p plasmid enzyme restriction.

Fig. 2: plant expression vector pCAM1391Z and pCAM1391Z-GmChi1p make up synoptic diagram.

Fig. 3, pCAM1391Z-GmChi1p transgene tobacco T ₀PCR for plant identifies; Swimming lane M:DNA Marker 2000; Swimming lane CK ⁺: plasmid pCAM1391Z-GmChi1p is the PCR positive control of template; Swimming lane CK ^-: ddH ₂O is the blank of template; Swimming lane 0: the transgene tobacco genomic dna is not the negative contrast of template; Swimming lane 1～33:pCAM1391Z-GmChi1p transgene tobacco T ₀Genomic dna for plant is the PCR product of template; 559bp is the PCR result of Hyg gene; 706bp is the PCR result of Gus gene.

The bioinformatic analysis of Fig. 4, GmChi1p promotor

GUS histochemical stain result in Fig. 5, the pCAM1391Z-GmChi1p transgenic tobacco plant; Wherein A is the T of non-processor ₀For the coloration result of transgenic tobacco plant (seedling of taking root), B rounds to cut the coloration result of observing again after spending dyeing earlier.

The injury abduction delivering result of GmChi1p promotor in Fig. 6, the pCAM1391Z-GmChi1p transgenic tobacco plant; Wherein A is not for the transgene tobacco blade is with 1 hour poststaining result of toothpick bundle hole damage, and B is that blade cuts with blade or pricks the hole with toothpick and damage 1 hour poststaining result, and C is that whole flower vertically cuts back horse back coloration result with blade.

Embodiment

Following embodiment is convenient to better understand the present invention, but does not limit the present invention.Experimental technique among the following embodiment like no specified otherwise, is ordinary method, and the primer sequence is given birth to worker Bioisystech Co., Ltd by Shanghai and synthesized.

Embodiment 1: clone and the sequential analysis of soybean chitinase gene promotor-GmChi1p

According to the soybean Class I chitinase gene (Chitinase that has reported among the GenBank; GmChi1) (GenBank:AF202731.1) sequence; (http://soybase.org/SequenceIntro.php) search and definite GmChi1 gene 5 ' upstream promoter district in the soybean DB, the design special primer.Upstream primer: 5 ' CCCTAACTAGGAATTTAGCCACTCA3 '

Downstream primer: 5 ' GAAAGAAACGGTGTATGATGTGAAT3 '

With soybean " Jungery " genomic dna is template, utilizes above-mentioned primer to carry out pcr amplification, preparation GmChi1 gene promoter fragment.The PCR reaction system:

PCR response procedures: 94 ℃ of preparatory sex change 5 minutes; 94 ℃ of sex change 30 seconds, 58 ℃ of annealing 50 seconds, 72 ℃ were extended totally 35 circulations 2 minutes; Last 72 ℃ were extended 10 minutes; 4 ℃ of insulations.

The amplified production that obtains, electrophoresis detection on 1% sepharose, the result shows: specific band (accompanying drawing 1) is arranged at about 1600bp place, and size conforms to the expectation theoretical value.Reclaim test kit with the DNA sepharose and reclaim this PCR product of purifying; Purified product is connected with the pMD18-T carrier; Obtain recombinant plasmid called after pMD18-T-GmChi1p; Transformed into escherichia coli DH5 α competent cell; Carry out Amp, the screening of blue hickie, choose recombinant plasmid and identify that through PCR and Hind III/EcoR I double digestion (choosing the restriction enzyme site of pMD18-T carrier) the clone bacterium liquid of all positive (accompanying drawing 1) send the order-checking of precious biological (TaKaRa) company in Dalian; Institute's calling sequence carries out the homology comparison with the Blast instrument on the NCBI website; The result show with the soybean DB in the known array similarity reach 99.8%; Conclusive evidence institute calling sequence is the upstream regulatory sequence (GmChi1p) of GmChi1 gene; Length is 1641bp, comprises part 5 ' UTR district, and its sequence is referring to SEQ ID NO:1.Utilize PLACE (Higo K, Ugawa Y, Iwamoto M; Korenaga T.Plant cis-acting regulatory DNA-elements (PLACE) .Nucl Acids Res 1999,27:297-300) and PlantCARE (Lescot M, D é hais P; Thijs G, Marchal K, Moreau Y; Van de Peer Y, Rouz é P, Rombauts S.PlantCARE; A database of plant cis-acting regulatory elements and a portal to tools in silico analysis of promoter sequences.Nucl Acids Res 2002; 30:325-327) software carries out sequential analysis (accompanying drawing 4) to the nucleotide sequence (the SEQ ID NO:1 in the sequence table) of GmChi1p, finds this sequence except that the basic transcription element that possesses promotor, also contains a plurality of Gent abnormal sounds and answers element; A plurality of and Whitfield's ointment; The element of hormones such as jasmonic responses, and some transcribe element etc. (seeing table 1) to what coerce response is inferred the evoked response that this promotor maybe be different for Gent and be received hormone or coerce.Wherein, sequence is a transcription initiation site from 3 ' end the 32nd bit base, is designated as+1 (accompanying drawing 4).

The site statistical study of table 1 promoter transcription combination of elements

Embodiment 2 utilizes pCAMBIA1391Z vector construction GmChi1p::GUS fusion gene recombinant expression vector

From intestinal bacteria, extract vector plasmid pCAMBIA1391Z (this bacterial strain is bought from biotech firm or CAMBIA), with reclaiming big carrier segments (wherein including the gus reporter gene sequence) behind the Hind III/EcoR I double digestion.From embodiment 1 prepared TA clones, extract plasmid pMD18-T-GmChi1p, behind Hind III/EcoR I double digestion, reclaim the GmChi1p promoter fragment through agarose gel electrophoresis.Above-mentioned 2 fragments are spent the night in 16 ℃ of connections under ligase enzyme catalysis, and the GmChi1p::GUS fusion gene of accomplishing on the pCAMBIA1391Z carrier makes up recombinant plasmid called after pCAM1391Z-GmChi1p (the vector construction collection of illustrative plates is seen accompanying drawing 2).

Linked system:

Connect product transformed into escherichia coli DH5 α competent cell, method is with embodiment 1.Select the white colony that transforms on dull and stereotyped (Kan resistance), extract plasmid, recombinant plasmid is carried out PCR and Hind III/EcoR I double digestion evaluation (accompanying drawing 1) by ordinary method.With freeze-thaw method the positive colony plasmid of identifying is transformed Agrobacterium EHA105, obtain the through engineering approaches Agrobacterium, be used for Plant Transformation.

The tobacco genetic transformation that embodiment 3 is agriculture bacillus mediated and the GUS detection of expression of transfer-gen plant

With the agrobacterium tumefaciens bacterium liquid leaf disc method transformation of tobacco blade that contains the pCAM1391Z-GmChi1p plasmid (size 0.5 * 0.5); Cultivated altogether 2 days, and moved to division culture medium (containing the 50mg/L Totomycin) subsequently and carry out resistance screening, kanamycin-resistant callus tissue per two all subcultures once; Until the resistance seedling occurring; Move in the root media (containing the 50mg/L Totomycin) and take root, acclimatization and transplants is until results T ₁For seed.The resistant plant that obtains carries out positive detection with the PCR method, and primer is respectively gus gene and the inner primer of hyg gene, and the product size is respectively 559bp and 706bp (accompanying drawing 3).

Transgene tobacco is carried out the GUS histochemical stain.Method utilizes the X-Gluc reaction solution to handle following vegetable material respectively: (1) T ₀For the whole strain (seedling of taking root) of transgenic tobacco plant, (2) whole flower cuts dyeing at once, and (3) whole spending dye earlier and afterwards cuts, and (4) blade is pricked the hole with toothpick and damaged 1 hour poststaining, and 1 hour poststaining is damaged in (5) not transgene tobacco blade toothpick bundle hole.Each specimen material adds 37 ℃ of reactions of X-Gluc reaction solution 24 hours, and with the reaction solution sucking-off, with 75% ethanol decolorization 2-3 time, extremely negative material is white in color.Visual inspection or photomicrography.

The result shown in accompanying drawing 5, the active strong very dark blueness that demonstrates of GUS, no blueness then representes not have the GUS activity or the GUS activity is very low.Have very strong in the root of the whole strain seedling of the transgene tobacco of being handled

GUS expresses, and dyes very blue color, organizes more than the root and does not then have GUS expression (Fig. 5 A); Except that chapiter and petal have the faint expression, all there is not expression (Fig. 5 B) at other positions of flower.Simultaneously; This promotor is also by the injury abduction delivering; In all injuries place; Comprise that paddle cutout place (Fig. 6 B), blade thorn injury (Fig. 6 B is right), flower incision (6C) and anthocaulus incision (6C) all expressed by efficient induction, do not express (Fig. 6 A) and all have GUS as the otch of the not transgene tobacco blade of negative control and thorn injury.We obtain transfer-gen plant 46 strains altogether; Get wherein 12 strains and carried out above GUS expression analysis; The result shows that different transgenic lines all show consistent result, explains by sequence shown in the SEQID NO:1 to have the epigamic promoter activity of the double injury of very strong root-specific.

Claims (9)

1. the root-specific available from soybean is held concurrently and is injured inducible promoter GmChi1p, is one of following nucleotide sequence:

1) dna sequence dna shown in the SEQ ID NO.1 in the sequence table;

2) under stringent condition, can hybridize and have the nucleotide sequence of promoter function with the dna sequence dna that SEQ ID NO.1 in the sequence table limits.

2. promotor according to claim 1 is characterized in that, this promotor can make goal gene at the plant root specific high-efficiency expression.

3. promotor according to claim 1 is characterized in that, this promotor can be by the injury abduction delivering.

4. the recombinant expression vector that contains the said promotor of one of claim 1～3.

5. recombinant expression vector as claimed in claim 4 is characterized in that: said recombinant expression vector obtains recombinant plasmid for the MCS at pCAMBIA1391Z inserts the said dna fragmentation of claim 1.

6. recombinant expression vector as claimed in claim 4 is characterized in that: said recombinant expression vector is the recombinant plasmid that obtains between the Hind III of the insertion of dna fragmentation shown in SEQ ID NO.1 pCAMBIA1391Z and EcoR I restriction enzyme site.

7. the application of the said promotor of claim 1～3 in plant disease-resistant insect pest or resistance improvement and plant quality improvement.

8. transformant, this transformant are carrier described in the claim 4～6 to be imported the host make.

9. transformant according to claim 7 is characterized in that described host is plant materials.

Images