CN102618543B - Root-specific and harm inducible promoter from glycine max - Google Patents
Root-specific and harm inducible promoter from glycine max Download PDFInfo
- Publication number
- CN102618543B CN102618543B CN201210071088.7A CN201210071088A CN102618543B CN 102618543 B CN102618543 B CN 102618543B CN 201210071088 A CN201210071088 A CN 201210071088A CN 102618543 B CN102618543 B CN 102618543B
- Authority
- CN
- China
- Prior art keywords
- promoter
- gene
- plant
- root
- promotor
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a root-specific and harm inducible promoter GmChi1p separated from glycine max. A nucleotide sequence is shown as SEQ ID NO.1. A glycine max chitinase 1 gene promoter (GmChi1p) is cloned, and a plant expression vector pCAM1391Z-GmChi1p is constructed by a primer designed uniquely and taking deoxyribonucleic acid (DNA) of a glycine max 'Jungery' genome as a template; and functional verification is performed by bacillus-mediated tobacco genetic transformation and a mode of expressing a glucuronidase (GUS) gene, namely the promoter can drive the GUS gene to be expressed specifically in roots of transgenic tobaccos and to be subjected to inducible expression efficiently by harm in the transgenic tobaccos. The promoter can replace a 35S promoter to be applied to the study of transgenic plants, and particularly the study of the pest and disease resistance, adverse resistance, high yield or quality improvement of transgenic crops.
Description
Technical field
This invention relates to plant gene promoter and application thereof, provides a kind of root-specific available from soybean and to hold concurrently wound induced type promotor.Belong to biological technical field, particularly relate to crop disease and pest resisting and crop, degeneration-resistant, the genetically engineered field such as high yield or quality-improving.
Background technology
Soybean (Glycine max L.Merrill) is important oil crops and cash crop, in China's agriculture production and even whole national economy, all have critical role.In Soybean production, there is multiple disease and pest for a long time, wherein serious with grey speck of soybean, phytophthora root rot, oidium, root-knot nematode disease etc., mycosis and insect pest are the major reasons causing soybean quality and production declining always.By genetic engineering technique, related resistance genes being imported soybean, is the available strategy improving Soybean Resistance characteristic of disease and productivity now.
At present, the separated clone of a large amount of excellent new gene, but comparatively widely used promotor has the CaMV 35S promoter from cauliflower mosaic virus in plant genetic engineering, from promotor (Sanders et al., 1987 such as Act1, Ubi1 of plant itself; McElroy et al., 1990).These are all constitutive promoters.Gene due to constitutive promoter driving all has expression in various degree in plant different tissues organ, exposes some problems gradually in application.As a rule, people do not wish that foreign gene is in the whole plant of transgenic plant, wide expression in whole breeding time, because the metabolism burden of plant can be increased on the one hand, on the other hand, some foreign protein is non-essential even poisonous to plant, be unfavorable for plant normal growth (Kasuga et al., 1999).Therefore, study and utilize histoorgan specific promoter and inducible promoter to seem particularly important, when not only can realize implementing exogenous gene expression, the regulation and control of the three-dimensional of sky, amount, there is many-sided potential values (Venter, 2007) such as economy, environmental protection and Biosafety simultaneously.Tissue specificity or abduction delivering promotor are all the Focal point and difficult points of plant genetic engineering research all the time.
Tissue-specific promoter can make the expression of foreign gene only occur in some specific organ or tissue position, and often shows the characteristic of Growth adjustment.At present, the research of most of tissue specific promoter mainly concentrates on the over-ground part of plant, and the investigation and application of root-specific promoter also seldom (Potenza et al., 2004).But, the root of plant is the organ being uniquely grown on underground part, it not only has the vital role of absorption, transport, storage nutrient, also be the part contacted at first with pathogen in soil, or a part for plant self-defence system under some adverse environmental factor, therefore root specific promoter has good using value in plant disease-resistant and resistance improvement and plant quality improvement.Along with going deep into of research, in succession report the special promotor of some roots of plants (Xu et al., 1995; Sch ü nmann et al., 2004; Del Campillo, 2004; Koyama et al., 2005; Nitz et al., 2001; Vijaybhaskar et al., 2008; Liu et al., 2003; Winicov et al., 2004).But that can apply in genetically engineered genetic improvement and agriculture production is still little.
Inducible promoter can make foreign gene produce response to some signal, only expresses under distinctive signal stimulates.The research of plant injury or pathogenic bacterium inducing type promotor is a lot, is a study hotspot of plant biotechnology field.Plants by phytopathogenic bacterium is infected to induce and produces multiple defense response, especially pathogenesis-related proteins (PR albumen: Pathogenesis-Related Proteins) is produced, chitinase is one of main plant pr-5 proteins, by the important component to fungal cell wall---chitinous hydrolysis, the growing multiplication of Antifungi, thus improve the fungal resistance of plant, resist plant in the defense response of fungal disease and play an important role (Boller et al., 1983).Chitinase is extensively present in each kind of plant, the developmental regulation of involved in plant, as bloomed, solid etc.; The also process (Kasprzewska, 2003) such as disease-resistant and pest-resistant of involved in plant.Research shows that chitinase expression amount in plant normal growth situation is extremely low or do not express, but be subject to pathogenic bacteria, injury and signaling molecule induction time expression amount to increase sharply (Xu et al., 2007; Whipps et al., 2008), quick and strong induced reaction characteristic implies that its promotor has important practical value in plant genetic engineering.
From the several plants such as Arabidopis thaliana, obtained the promoter sequence of chitinase gene at present, and its induction regulating controlling characteristic is identified: chitinase gene promotor as acid in Arabidopis thaliana is a kind of mycosis original evoked promoter, induced by dry thread Pyrenomycetes (Rhizoctonia solani); In transgenic Fructus Lycopersici esculenti, by tomato early blight bacterium (Alternaria solani) abduction delivering (Samac and Shah, 1991).Vitis Amurensis ClassIII chitinase gene VCH3 promoter applies SA induction specific high expression in vascular tissue by external source, and the size of expression amount is directly proportional to the quantity of the SA cis-acting elements contained in VCH3 promotor (Li et al., 2005).Wu Xuefeng etc. find that leaf mustard Class I chitinase gene promotor BjCHI1 can drive gus gene in transgene tobacco and Arabidopis thaliana, respond the induced strong of the biology such as injury, MeJA, NaCl and PEG and abiotic factor, and prove the MeJA inducing properties (Wu et al., 2009) of T/G-box (AACGTG) sequence imparting BjCHI1 promotor wherein first.The gus gene of capsicum class II chitinase gene CAChi2 promoters driven is subject to the induction strong expression (Hong and Hwang, 2011) of infection process, osmotic stress and SA.But degree of homology is low between above-mentioned promoter sequence, the controlling element of the responsing reaction of envrionment conditions to external world existed in promotor is distinguished to some extent, and each promotor also exists induction and starts activity difference.Up to the present, be only confined on minority model plant to the Study on Genetic Transformation that the Regulation Mechanism of chitinase gene promotor is carried out, little to the paractical research of farm crop, more have no the report that it carries out genetic transformation in soybean.
The successful Application of plant gene engineering technology not only needs the promotor regulating and controlling different levels in a large number, and need to be suitable for different plant background, different organs, tissue, transgenosis type promotor to avoid the disadvantageous effect in transgenic protocol.The plant endogenous organizing specific can selected in the high yield of soybean, quality-improving and disease and insect resistance genetically engineered Genetic carrier build or inducible promoter still little, therefore, from soybean, excavate the different and/or wound induced type promotor of more Gent have great importance to fundamental research and production application.
The dark harm by various mycosis insect pest in Soybean production process, soybean chitinase is equally also subject to abduction delivering (Liubas, 2001 of pathogenic bacteria, injury and exciton etc.; Gijzen et al., 2001), therefore, the promotor that inventor feels regulating and controlling soybean chitinase gene deeply has researching value.By the effort of inventor, successfully be separated to soybean chitinase gene promotor (GmChi1p), and prove that promotor of the present invention has root tissue specificity by experiment, and the induced strong that can be hurt is expressed, to hold concurrently wound induced type expression vector as the root-specific of plant-sourced, in crops quality improvement and disease and insect resistance genetically engineered, have good application prospect.
Reference used in literary composition is specific as follows:
1.Boller?T，Gehri?A，Mauch?F，et?al.Chintinase?in?bean?leaves：induction?by?ethylene，purification，properties，and?possible?function[J].Planta，1983，157：22-31.
2.del?Campillo?E，Abdel-Aziz?A，Crawford?D，et?al.Root?cap?specific?expression?of?an?endo-β-1，4-D-glucanase(cellulase)：a?new?marker?to?study?root?development?in?Arabidopsis，Plant?Molecular?Biology，2004，56：309-323
3.Gijzen?M，Kuflu?K，Qutob?D，et?al.A?class?I?chitinase?from?soybean?seed?coat.J?Exp?Bot.，2001，52：2283-2289
4.Hong?JK?and?Hwang?BK.Promoter?activation?of?pepper?class?II?basic?chitinase?gene，CAChi2，and?enhanced?bacterial?disease?resistance?and?osmotic?stress?tolerance?in?the?CAChi2-overexpressing?Arabidopsis.Planta，2011，10.1007/s00425-005-0099-6(on?line)
5.Kasprzewska?A..Plant?chitinases-regulation?and?function.Cell?Mol?Biol?Lett.，2003，8：809-824
6.Kasuga?M，Liu?Q，Miura?S，Yamaguchi-Schinozaki?K，and?Shinozaki?K.Improving?plant?drought，salt，and?freezing?tolerance?by?gene?transfer?of?a?single?stress-induciable?transcription?factor.Nat?Biotechnol，1999，17：287-291
7.Koyama?T，Ono?T，Shimizu?M，et?al.Promoter?of?Arabidopsis?thaliana?phosphate?transporter?gene?drive?root-specific?expression?of?transgene?in?rice.J?Biosci?Bioeng，2005，99：38-42
8.Li?HY，Qi?J，Shu?HR，et?al.Isolation?and?Characterization?of?a?Chitinase?Gene?VCH3?Promoter?from?Grapevine(Vitis?amurensis)Journal?of?Plant?Physiology?and?Molecular?Biology?2005，31(5)：485-491
9.Liu?JJ，Ekramoddoullah?AK.Root-specific?expression?of?a?western?white?pine?PR10?gene?is?mediated?by?different?promoter?regions?in?transgenic?tobacco.Plant?Mol?Biol，2003，52：103-120
10.Liubas?KS.The?influence?of?fusarium?oxysporum?infection?and?low?temperatures?on?the?activity?of?soybean?esterase?and?PR?proteins[J].Icel?Agr?Sci，2001，14：67-73.
11.McElroy?D，Zhao?W，Cao?J，et?al.Isolation?of?an?efficient?actin?promoter?for?use?in?rice?transformation.Plant?Cell，1990，2：163-171
12.Nitz?I，Berkefeld?H，Puzio?PS，et?al.Pyk10，a?seedling?and?root?specific?gene?and?promoter?form?Arabidopsis?thaliana.Plant?Sci.，2001，161：337-346
13.Potenza?C，Aleman?L，Sengupta-Gopalan?C.Targeting?transgene?expression?in?research，agricultural，and?environmental?applications：promoters?used?in?plant?transformation.In?Vitro?Cell?Dev?Biol.，2004，40：1-22
14.Samac?DA?and?Shah?DM.Developmental?and?pathogen-induced?activation?of?the?Arabidopsis?acidic?chitinase?promoter[J].Plant?Cell，1991，3：1063-1072
15.Sanders?PR，Winter?JA，Barnason?AR，et?al.Comparison?of?cauliflower?mosaic?virus?35S?and?nopaline?synthase?promoters?in?transgenic?plants.Nucleic?Acids?Res，1987，15：1543-1558；
16.Schünmann?PHD，Richardson?AE，Smith?FW，et?al.Characterization?of?promoter?expression?patterns?derived?from?the?Phtl?phosphae?transporter?genes?of?barley(Hordeum?vulgare?L.).J?Exp?Bot.，2004，55：855-865
17.Venter?M.Synthetic?promoters：genetic?control?through?cis?engineering.Trends?Plant?Sci，2007，12：118-124
18.Vijaybhaskar?V，Subbiah?V，Kaur?J，et?al.Identification?of?a?root-specific?glycosyltransferase?from?Arabidopsis?and?characterization?of?its?promoter.J.Biosci.，2008，33：1852-193
19.Whipps?JM，Hand?P，Pink?D，et?al.Phyllosphere?microbiology?with?special?reference?to?diversity?and?plant?genotype.J?Appl?Microbiol.，2008，105：1744-1755.
20.Winicov?I，Valliyodan?B，Xue?L，et?al.The?MsPRP2?promoter?enables?strong?heterologous?gene?expression?in?a?root-specific?manner?and?is?enhanced?by?overexpression?of?Alfin?1.Planta，2004，219：925-935
21.Wu?XF，Wang?CL，Xie?EB，et?al.Molecular?cloning?and?characterization?of?the?promoter?for?the?multiple?stress-inducible?gene?BjCHI1?from?Brassicajuncea.Planta，2009，229：1231-1242
22.Xu?FH，Fan?CM，He?YQ，et?al.Chitinases?in?Oryza?sativa?ssp.japonica?and?Arabidopsis?thaliana[J].J.Genet.Genomics，2007，34(2)：138-150
23.Xu?Y，Buchholz?WG，DeRose?RT，et?al.Characterization?of?a?rice?gene?family?encoding?root-specific?proteins.Plant?Mol?Biol.，1995，27：237-248
Summary of the invention
Object of the present invention is intended to the deficiency overcoming prior art, one is to provide a kind of root-specific available from soybean holds concurrently wound induced type promotor, two recombinant vectorss being to provide this promotor a kind of, three are to provide the transformant prepared with this recombinant vectors, and four are to provide this root-specific holds concurrently the application of wound induced type promotor, recombinant vectors and transformant.
An object of the present invention realizes by following technical measures:
The invention provides a kind of new root-specific to hold concurrently wound induced type promotor, by the DNA with nucleotide sequence shown in SEQ ID NO.1.Induction herein refers to wound induced (as insect pest).
Two of object of the present invention realizes by following technical measures:
The root-specific available from soybean of this recombinant vectors wherein containing one of above-mentioned purpose is held concurrently wound induced type promotor, comprises for the structure gene of crop quality improvement and/or the structure gene of regulatory gene or antimycotic insect pest and/or regulatory gene thus makes it play a role under root-specific holds concurrently wound induced type promotor.
Three of object of the present invention realizes by following technical measures:
This transformant is obtained vector introduction host described in claim 2.
Three of object of the present invention also realizes by following technical measures:
Described host is plant materials.
Four of object of the present invention realizes by following technical measures:
Should holding concurrently available from the root-specific of soybean, wound induced type promotor, recombinant vectors and transformant are applied to plant quality improvement, prepared by the engineered industry of disease and insect resistance.It can drive foreign gene at transgenic plant root system specifically expressing or the abduction delivering that is hurt in transgenic plant, 35S promoter can be substituted and be applied to Agricultural biotechnologies breeding, to improve crop disease-resistant, pest-resistant proterties, resisting abiotic adverse circumstance and high crop yield, quality-improving.
The present invention is described further for tobacco:
Present invention obtains a kind of root-specific effectively played a role in dicotyledons is as tobacco to hold concurrently wound induced type promotor, achieve the organizing specific expression of this promoters driven foreign gene at tobacco root, and all there is efficient wound induced expression characterization in tobacco leaf, flower, anthocaulus.
Merged by root-specific of the present invention is held concurrently wound induced type promotor and gus reporter gene and follow the tracks of GUS enzyme with or without induce process under expression in tobacco plant, just can determine the different double wound induced expression pattern of the Gent of this promotor in tobacco plant.
Root-specific of the present invention wound induced type promotor of holding concurrently is obtained by following methods:
According to the soybean Class I chitinase gene (chitinase reported in GenBank, GmChi1) (GenBank:AF202731.1) sequence, in soybean database, (http://soybase.org/SequenceIntro.php) searches for and determines GmChi1 gene 5 ' upstream promoter district, design special primer, extract soybean gene group and carry out pcr amplification, the fragment obtained carries out sequencing, result shows to reach 99.8% with the sequence similarity in soybean database, thus clone the upstream regulatory sequence of GmChi1 gene start codon upstream 1641bp, comprise part 5 ' UTR district.
The 1.64Kb control region of clone is built in plant expression vector pCAMBIA1391Z, obtains the pCAM1391Z-GmChi1p recombinant expression vector driving gus gene to express by GmChi1 gene promoter.Then by pCAM1391Z-GmChi1p recombinant plasmid freeze-thaw method transformation Agrobacterium EHA105, leaf disc method is utilized to carry out genetic transformation to tobacco.GUS histochemical stain is carried out to transfer-gen plant, proves that this promotor is root tissue specific promoter; GUS histochemical stain is carried out to the transfer-gen plant of injury process, proves that this promotor is wound induced type promotor.
The advantage of this invention is to obtain a kind of novel root-specific and holds concurrently wound induced type promotor, this promotor can drive foreign gene efficient specifically expressing in transgenic plant root system, and by the efficient abduction delivering of injury, be applicable to building plant expression vector and improve and high crop yield, quality-improving for crop disease-resistant worm or resistance.
Accompanying drawing explanation
Fig. 1: GmChi1p promotor clone and vector construction digestion verification; Swimming lane M:Wide Range DNA Marker (500-12,000); Swimming lane 1:pMD18-T-GmChi1p plasmid enzyme restriction is verified; Swimming lane 2: soybean gene group GmChi1p pcr amplification result; Swimming lane 3:pCAM1391Z-GmChi1p plasmid enzyme restriction is verified.
Fig. 2: plant expression vector pCAM1391Z and pCAM1391Z-GmChi1p builds schematic diagram.
Fig. 3, pCAM1391Z-GmChi1p transgene tobacco T
0pCR for plant identifies; Swimming lane M:DNA Marker 2000; Swimming lane CK
+: plasmid pCAM1391Z-GmChi1p is the PCR positive control of template; Swimming lane CK
-: ddH
2o is the blank of template; Swimming lane 0: non-transgene tobacco genomic dna is the negative contrast of template; Swimming lane 1 ~ 33:pCAM1391Z-GmChi1p transgene tobacco T
0genomic dna for plant is the PCR primer of template; 559bp is the PCR result of Hyg gene; 706bp is the PCR result of Gus gene.
The bioinformatic analysis of Fig. 4, GmChi1p promotor
GUS histochemical stain result in Fig. 5, pCAM1391Z-GmChi1p transgenic tobacco plant; Wherein A is the T of non-processor
0for the coloration result of transgenic tobacco plant (seedling of taking root), B be round spend first dyeing after cut the coloration result of observation again.
The wound induced expression of results of GmChi1p promotor in Fig. 6, pCAM1391Z-GmChi1p transgenic tobacco plant; Wherein A is for damaging 1 hour poststaining result in non-transgenic tobacco leaf toothpick bundle hole, and B is blade cut or damages 1 hour poststaining result with toothpick bundle hole, and C is horse back coloration result after whole flower blade longitudinally cuts.
Embodiment
Following embodiment is convenient to better understand the present invention, but does not limit the present invention.Experimental technique in following embodiment, if no special instructions, is ordinary method, and the primer sequence is synthesized by Shanghai Sheng Gong Bioisystech Co., Ltd.
Embodiment 1: the Cloned culturing of soybean chitinase gene promotor-GmChi1p
According to the soybean Class I chitinase gene (Chitinase reported in GenBank, GmChi1) (GenBank:AF202731.1) sequence, in soybean database, (http://soybase.org/SequenceIntro.php) searches for and determines GmChi1 gene 5 ' upstream promoter district, design special primer.Upstream primer: 5 ' CCCTAACTAGGAATTTAGCCACTCA3 '
Downstream primer: 5 ' GAAAGAAACGGTGTATGATGTGAAT3 '
With soybean " Jungery " genomic dna for template, above-mentioned primer is utilized to carry out pcr amplification, preparation GmChi1 promoter gene fragment.PCR reaction system:
PCR response procedures: 94 DEG C of denaturations 5 minutes; 94 DEG C of sex change 30 seconds, 58 DEG C of annealing 50 seconds, 72 DEG C extend 2 minutes, totally 35 circulations; Last 72 DEG C extend 10 minutes; 4 DEG C of insulations.
The amplified production obtained, electrophoresis detection on the sepharose of 1%, result shows: have specific band (accompanying drawing 1) at about 1600bp place, size conforms to estimated theoretical value.Reclaim test kit with DNA sepharose and reclaim this PCR primer of purifying; Purified product is connected with pMD18-T carrier, obtain recombinant plasmid called after pMD18-T-GmChi1p, transformation of E. coli DH5 α competent cell, carry out Amp, the screening of blue hickie, choose recombinant plasmid and identify that the clone bacterium liquid being the positive (accompanying drawing 1) send the order-checking of precious biological (TaKaRa) company in Dalian through PCR and Hind III/EcoR I double digestion (choosing the restriction enzyme site of pMD18-T carrier); Gained sequence carries out homology comparison with Blast instrument on NCBI website, result shows to reach 99.8% with the known array similarity in soybean database, confirmation gained sequence is the upstream regulatory sequence (GmChi1p) of GmChi1 gene, length is 1641bp, comprise part 5 ' UTR district, its sequence is see SEQ ID NO:1.Utilize PLACE (Higo K, Ugawa Y, Iwamoto M, Korenaga T.Plant cis-acting regulatory DNA-elements (PLACE) .Nucl Acids Res 1999, 27:297-300) with PlantCARE (Lescot M, D é hais P, Thijs G, Marchal K, Moreau Y, Van de Peer Y, Rouz é P, Rombauts S.PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools in silico analysis of promoter sequences.Nucl Acids Res 2002, 30:325-327) nucleotide sequence (SEQ ID NO:1 in sequence table) of software to GmChi1p carries out sequential analysis (accompanying drawing 4), find this sequence except the basic transcription element possessing promotor, also containing the different response element of multiple Gent, multiple and Whitfield's ointment, the element of the hormone responses such as jasmonic, and some are to (see table 1) such as the transcriptional elements of stress response, infer that this promotor may be the different and evoked response being subject to hormone or coercing of Gent.Wherein, sequence is transcription initiation site from 3 ' end the 32nd bit base, is designated as+1 (accompanying drawing 4).
The statistical study of table 1 promoter transcription element binding sites
Embodiment 2 utilizes pCAMBIA1391Z vector construction GmChi1p::GUS fusion gene recombinant expression vector
Vector plasmid pCAMBIA1391Z (this bacterial strain is bought from biotech firm or CAMBIA) is extracted, with reclaiming large carrier segments (wherein including gus reporter gene sequence) after Hind III/EcoR I double digestion from intestinal bacteria.From the TA clone prepared by embodiment 1, extract plasmid pMD18-T-GmChi1p, after Hind III/EcoR I double digestion, reclaim GmChi1p promoter fragment by agarose gel electrophoresis.Above-mentioned 2 fragments are spent the night in 16 DEG C of connections under ligase enzyme catalysis, completes the GmChi1p::GUS Fusion gene construction on pCAMBIA1391Z carrier, recombinant plasmid called after pCAM1391Z-GmChi1p (accompanying drawing 2 is shown in by vector construction collection of illustrative plates).
Linked system:
Connect product conversion bacillus coli DH 5 alpha competent cell, method is with embodiment 1.Select the white colony on transformation plate (Kan resistance), extract plasmid according to a conventional method, PCR and Hind III/EcoR I double digestion qualification (accompanying drawing 1) is carried out to recombinant plasmid.With the positive colony Plastid transformation Agrobacterium EHA105 of freeze-thaw method by qualification, obtain through engineering approaches Agrobacterium, for Plant Transformation.
The GUS detection of expression of the tobacco genetic transformation that embodiment 3 is agriculture bacillus mediated and transfer-gen plant
With agrobacterium tumefaciens bacterium liquid leaf disc method transformation of tobacco blade (size 0.5 × 0.5) containing pCAM1391Z-GmChi1p plasmid, Dual culture 2 days, move to division culture medium (containing 50mg/L Totomycin) subsequently and carry out resistance screening, kanamycin-resistant callus tissue every two weeks subcultures once, until there is resistance seedling, move in root media (containing 50mg/L Totomycin) and take root, acclimatization and transplants, until results T
1for seed.The resistant plant PCR method obtained carries out positive detection, and primer is respectively gus gene and hyg gene internal primer, and product size is respectively 559bp and 706bp (accompanying drawing 3).
GUS histochemical stain is carried out to transgene tobacco.Method, utilizes X-Gluc reaction solution to process following vegetable material respectively: (1) T
0for the whole strain of transgenic tobacco plant (seedling of taking root), (2) whole flower cuts dyeing at once, (3) whole spend first to dye cut afterwards, (4) blade toothpick is pricked hole and is damaged 1 hour poststaining, and (5) non-transgenic tobacco leaf toothpick is pricked hole and damaged 1 hour poststaining.Each sample material adds X-Gluc reaction solution 37 DEG C reaction 24 hours, by reaction solution sucking-off, with 75% ethanol decolorization 2-3 time, is white to negative-type.Visual inspection or photomicrography.
As shown in Figure 5, GUS is active strong demonstrates very dark blueness to result, without blueness then indicate without GUS activity or GUS active very low.Have very strong in the root of the transgene tobacco be not subject to processing whole strain seedling
GUS expresses, and dyes very blue color, more than root organizes and then expresses (Fig. 5 A) without GUS; Except chapiter and petal have faint expression, at other positions of flower all without expression (Fig. 5 B).Simultaneously, this promotor is also expressed by wound induced, in all injuries place, comprise paddle cutout place (Fig. 6 B), blade stab place (Fig. 6 B right), flower incision (6C) and anthocaulus incision (6C) all by efficient abduction delivering, and as the otch of the non-transgenic tobacco leaf of negative control and the place of stabbing all without GUS expression (Fig. 6 A).We obtain transfer-gen plant 46 strain altogether, get wherein 12 strains and carry out above GUS expression analysis, result shows that different transgenic line all shows consistent result, illustrates that having very strong root-specific by sequence shown in SEQID NO:1 holds concurrently the promoter activity of wound induced.
Claims (3)
1. to hold concurrently a wound induced type promotor GmChilp available from the root-specific of soybean, the DNA sequence dna as shown in SEQ ID NO.1 in sequence table; This promotor can make goal gene at plant root specific high-efficiency expression.
2. the application of promotor described in claim 1 in plant disease-resistant insect pest or resistance improvement.
3. a transformant, this transformant DNA fragmentation shown in SEQ ID NO.1 is inserted the recombinant plasmid importing Agrobacterium obtained between the Hind III of pCAMBIA1391Z and EcoR I restriction enzyme site to obtain.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210071088.7A CN102618543B (en) | 2012-03-13 | 2012-03-13 | Root-specific and harm inducible promoter from glycine max |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210071088.7A CN102618543B (en) | 2012-03-13 | 2012-03-13 | Root-specific and harm inducible promoter from glycine max |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102618543A CN102618543A (en) | 2012-08-01 |
| CN102618543B true CN102618543B (en) | 2015-01-21 |
Family
ID=46558753
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210071088.7A Expired - Fee Related CN102618543B (en) | 2012-03-13 | 2012-03-13 | Root-specific and harm inducible promoter from glycine max |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102618543B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104560985B (en) * | 2013-10-09 | 2017-09-26 | 中国农业科学院作物科学研究所 | Root-specific promoter GmTIPp 1546 and its application from soybean |
| CN104560987B (en) * | 2013-10-09 | 2017-10-13 | 中国农业科学院作物科学研究所 | Root-specific promoter GmTIPp 2504 and its application from soybean |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104560989B (en) * | 2013-10-09 | 2017-08-08 | 中国农业科学院作物科学研究所 | Root-specific promoter GmTIPp 253 and its application from soybean |
| CN104673792B (en) * | 2013-11-27 | 2018-04-27 | 中国科学院上海生命科学研究院 | Legume beanpod linked groups' specificity promoter and its application |
| CN104673793B (en) * | 2013-11-27 | 2017-12-08 | 中国科学院上海生命科学研究院 | Legume root system tissue-specific promoter and its application |
| CN114457082B (en) * | 2022-03-17 | 2024-07-16 | 西南大学 | Pepper NaCl-induced promoter, recombinant vector and application thereof |
Family Cites Families (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE19960843A1 (en) * | 1999-12-16 | 2001-06-28 | Florian Grundler | Root-specific promoter |
| CN1624129A (en) * | 2003-12-03 | 2005-06-08 | 中国科学院遗传与发育生物学研究所 | Specific promoter of root and its application |
| WO2005070088A2 (en) * | 2004-01-15 | 2005-08-04 | University Of Georgia Research Foundation, Inc. | Chimeric sequences for tissue-specific gene expression in plants |
| KR100953763B1 (en) * | 2008-03-12 | 2010-04-21 | 대한민국 | A root-specific promoter m |
| CN101280313B (en) * | 2008-05-21 | 2010-06-02 | 中国农业大学 | Root specific promoter and recombinant expression vector thereof |
| KR100987007B1 (en) * | 2008-05-26 | 2010-10-12 | 대한민국 | A root-specific promoter f |
| KR100987008B1 (en) * | 2008-05-26 | 2010-10-12 | 대한민국 | A root-specific promoter l |
| KR100987009B1 (en) * | 2008-05-26 | 2010-10-12 | 대한민국 | A root-specific promoter r |
| EP2527450A1 (en) * | 2008-12-11 | 2012-11-28 | BASF Plant Science GmbH | Plant root-specific nematode resistance |
-
2012
- 2012-03-13 CN CN201210071088.7A patent/CN102618543B/en not_active Expired - Fee Related
Non-Patent Citations (2)
| Title |
|---|
| Gijzen,M et al..A class I chitinase from soybean seed coat.《Journal of Experimental Botany》.2001,第52卷(第365期),2283-2289. * |
| Gijzen,M et al..Accession No:AF335589.1.《Gene Bank》.2001,全文. * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104560985B (en) * | 2013-10-09 | 2017-09-26 | 中国农业科学院作物科学研究所 | Root-specific promoter GmTIPp 1546 and its application from soybean |
| CN104560987B (en) * | 2013-10-09 | 2017-10-13 | 中国农业科学院作物科学研究所 | Root-specific promoter GmTIPp 2504 and its application from soybean |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102618543A (en) | 2012-08-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102618543B (en) | Root-specific and harm inducible promoter from glycine max | |
| CN104946665B (en) | GmMYB62Application in cultivating transgenic plant with improved stress resistance | |
| CN108251432B (en) | Notoginseng disease course related protein genePnPRlikeAnd applications | |
| CN102464710B (en) | Helicoverpa armigera juvenile hormone binding protein (Ha-JHBP) and encoding gene and application thereof | |
| CN103074342B (en) | Inducible promoter for pathogenic bacteria of rice | |
| Li et al. | Isolation and characterization of two novel root-specific promoters in rice (Oryza sativa L.) | |
| CN110734482A (en) | Lilium regale WRKY transcription factor gene LrWRKY4 and application thereof | |
| CN110408626B (en) | Gene GmWRKY148 capable of improving phytophthora sojae resistance and application thereof | |
| CN102154296B (en) | Promoter efficiently expressing in cotton root and application thereof | |
| WO2021141082A1 (en) | Enhancer | |
| CN104004073B (en) | Derive from disease resistance associated protein TaCPK7-R of Semen Tritici aestivi and relevant biological material thereof and application | |
| CN103275202B (en) | Disease resistance-related protein RCR1 derived from wheat, related biomaterials thereof, and application for same | |
| CN111778250A (en) | Castor plant promoter PDAT1-2P5 capable of being induced at low temperature and cloning and application thereof | |
| CN103820457B (en) | A kind of corn pathogenic bacteria evoked promoter pGRMZM2G315431 | |
| Cong et al. | Cloning and analysis of a functional promoter of fungal immunomodulatory protein from Flammulina velutipes | |
| CN104046629A (en) | Plant salt inducible expression promoter POsSalt1 and application thereof | |
| CN110157710B (en) | NaD1 gene promoter of nicotiana tabacum and application thereof | |
| CN103614385B (en) | A gene KT525 is improving the application on plant stress tolerance | |
| CN102517284A (en) | Promoter miR390 and applications thereof | |
| CN101831424A (en) | Promoter for expressing specificity of plant tissue and later development and application thereof | |
| KR101494191B1 (en) | Promoter for directing the guard-cell specific expression | |
| CN104098663B (en) | Soybean protein and encoding gene application in regulating plant drought resistance thereof | |
| Radhakrishnan et al. | New insights into the novel and functional promoter sequences of β-1, 3-glucanase gene from Hevea brasiliensis | |
| CN116254267B (en) | Specific expression promoter of rubber grass milk tube and application thereof | |
| CN102329796A (en) | Capsella bursapastoris cold regulated protein gene promoter and application thereof in plant cold resistance improvement |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150121 Termination date: 20170313 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |