CN104946665B - GmMYB62Application in cultivating transgenic plant with improved stress resistance - Google Patents

Abstract

The present invention relates to a plantGmMYB62Application of gene or its coded protein in culturing transgenic plant with improved stress resistanceGmMYB62The coding gene is from wild soybean, found by multiple sequence alignment and other plantsMYBThe class gene has higher conservation. In the transgenic combined plant, the real-time fluorescent quantitative PCR detection result shows that the over-expression is performedGmMYB62The gene can regulate the expression of drought-resistant related genes and regulate the expression of isoflavone synthesis related genes; under drought stress treatment, compared to controlsGmMYB62The drought resistance of the over-expression combined plant of the gene is obviously improved, which indicates that the geneGmMYB62Can be used as target gene to be introduced into plants (including monocotyledons and dicotyledons)Plant), improves the stress resistance of the plant, and has higher practical application value.

Description

GmMYB62Application in cultivating transgenic plant with improved stress resistance

Technical Field

The present invention relates to plantsGmMYB62The application of gene and its coded protein, especially the application of a gene from soybeanGmMYB62The application of gene and its coded protein in cultivating transgenic plant with raised stress resistance belongs to the field of molecular biology and biotechnology.

Background

Adversity stresses such as drought, low temperature and high salinity are important factors limiting plant growth and development and are also major abiotic stress factors affecting crop yield. When the plant is stressed by the outside, the stress signal stimulates the expression of the transcription factor, and then the transcription factor is combined with the corresponding cis-acting element to start the transcription expression of a specific gene, so that the physiological and biochemical changes of the plant are caused, and the stress resistance of the plant is improved. In recent years, hundreds of transcription factors for regulating the expression of drought, high salt, low temperature, hormone, pathogenic reaction and growth and development related genes are separated from higher plants.

Myb(v-mybavian myeloblastosis viral oncogene homolog) transcription factor is one of the largest plant transcription factor family members, participates in cell differentiation, regulation of cell cycle, hormone and environmental factor response, and has important regulation effects on plant secondary metabolism and organ morphogenesis such as leaves.MYBThe transcription factor-like family refers to a transcription factor containing a specific MYB structural domain at the N end of a gene. A MYB domain is a peptide segment of about 51-52 amino acids comprising a series of highly conserved amino acid residues and spacer sequences. Each MYB domain folds into a helix-turn-helix spatial structure containing 3 tryptophan residues separated by 18-19 amino acid residues, acting as a hydrophobic core.MYBTranscription-like factors consist of 3 conserved functional domains: a DNA Binding Domain (DBD), a Transcriptional Activation Domain (TAD), and an incompletely defined Negative Regulatory Domain (NRD) (Frampton, 2004; Thompson and Ramsay, 1995). The DNA binding domain is most conserved and typically comprises 1-3 incomplete repeats (R). Depending on the number of repeating segments (R), it is generally possible to combineMYBTranscription factors are divided into single MYB domain proteins (R1/R2), 2R proteins (R2R3) and 3R proteins (R1R2R 3).

A lot of research has been foundMYBThe transcription factor is involved in the response process of plants under drought stress. In Boea crassifoliaBcMYB1Is strongly induced by drought and can respond to stresses such as PEG, high salt, low temperature and the like to a certain degree. Of Arabidopsis thalianaAtMYB60Have also been shown to be involved in drought stress tolerance processes in plants. At the same time, the user can select the desired position,MYB transcription factors also cooperate with other response factors to respond to drought stress. Such as vinyl response factorsTSRF1Can be enhanced by binding with a GCC cassette of a promoter of a target geneMYBBy expression ofTSRF1qPCR analysis of the plants foundOsMYB59The expression of the gene is obviously increased compared with CK, thereby enhancing the drought resistance of rice.

2008, Yong Liao et al paired early-harvested 156 soybeansMYBsBase ofAfter alignment, 48 genes of the gene pairs have full-length open reading frames. At the 156 piecesGmMYBsOf these, 43 members responded to at least one of salt, low temperature, drought and ABA treatments,GmMYB76，GmMYB92andGmMYB177the three genes are up-regulated during ABA, high salt, drought and/or low temperature induction, and arabidopsis transgenic plants show the enhancement of stress resistance (Soybean)GmMYB76,GmMYB92 and GmMYB177genes resonance stress in transgenic Arabidopsis plants, Cell Res, 2008, 18: 1047-. Four were isolated and identified by Yangdonge et alMYB Transcription factors, respectively namedGmMYBZ1、GmMYBZ2、GmMYBJ6 AndGmMYBJ7inducing with UV-B ray, drought and high salt treatment of Zhongdou No. 27GmMYBJ6Increased expression level of the gene suggestsGmMYBJ6 Gene Expression is closely related to abiotic stress (Expression and functional analysis of GmMYBJ6 from soybean stress. heredities, 2009, 31(6): 645-. In 2012, Xuyan Li et al showed that GmMYB62 as a novel R1-type MYB protein can interact with GmMYB176 protein, presumably to participate in the synthesis of soybean isoflavones, but there is no clear indication thatGmMYB62Function of the gene (14-3-3 proteins as scaffold for GmMYB62 and GmMYB176 and ligand for intracellular localization in sobean, Plant signalling&Behavior 2012, 7(8): 965-968). These studies indicate that the study of soybean GmMYB gene function is very important for soybean stress-resistant molecular breeding.

Disclosure of Invention

The object of the present invention is to provide a soybean-derived foodMYBClass gene and protein GmMYB62 (encoded by same)Glycine maxUse of v-myb avian myeloblastosis viral oncogene homolog 62) for breeding transgenic plants with improved stress resistance. The method is characterized in that:

the geneGmMYB62Has the sequence shown in SEQ ID NO: 1;

the above-mentionedGmMYB62The encoded protein of (a) has the amino acid sequence of SEQ ID NO: 2, or has an amino acid residue sequence that is the same as SEQ ID NO: 2 through one or moreThe substitution and/or deletion and/or addition of several amino acid residues become the amino acid residue sequence with transcription activation function for improving the plant stress resistance.

Specifically, the above geneGmMYB62The DNA molecule can be a) or b) or c) as follows:

a) the DNA molecule shown in the sequence 1 in the sequence table consists of 1080 nucleotides;

b) can be combined with the sequence shown in SEQ ID NO: 1 to a DNA sequence defined in the specification;

c) the code is similar to the sequence shown in SEQ ID NO: 2, and (b) 2 a polynucleotide sequence of identical amino acid residue sequences.

The high stringency conditions are hybridization and membrane washing in a solution of 0.1 XSSPE (or 0.1 XSSC), 0.1% SDS at 65 ℃.

SEQ ID NO in the list: 1 consists of 1080 deoxynucleotides, the coding sequence is deoxynucleotides from 1 st to 1080 th position of a 5' end, and the coding sequence has the sequence shown in SEQ ID NO: 2, or a pharmaceutically acceptable salt thereof.

Wherein, SEQ ID NO: 2 consists of 359 amino acid residues byhttp:// www.ncbi.nlm.nih.gov/BLASTpThe result shows that the amino acid residues from about 111 th to about 155 th of the amino terminal (N terminal) of the protein are conserved MYB family protein specific conserved SANT structural domains.

The substitution and/or deletion and/or addition of one or several amino acid residues means the substitution and/or deletion and/or addition of not more than ten amino acid residues.

The expression vector, cell line and host bacterium containing the gene of the invention all belong to the protection scope of the invention. Amplification renGmMYB62A primer pair of one fragment is also within the scope of the present invention.

The application of regulating and controlling the stress resistance of the plants provided by the invention is to use the soybeansGmMYB62The gene is introduced into plant tissue or cell to regulate the synthesis of isoflavone and raise the resistance of plant.

SaidGmMYB62The gene may be obtained by containingGmMYB62The plant expression vector ofPutting an explant; the starting vector for constructing the plant expression vector can be any binary agrobacterium vector or a vector for plant microprojectile bombardment, such as pBI121, pCXSN or other derivative plant expression vectors; using the inventionGmMYB62When constructing the plant expression vector, any one of a constitutive promoter, a tissue-specific promoter, an inducible promoter or an enhanced promoter can be added before the transcription initiation nucleotide; in order to facilitate the identification and selection of transgenic plant cells or plants, the vectors used may be processed, for example, by adding antibiotic markers (kanamycin, hygromycin, etc.) or chemical agent resistance marker genes (herbicide resistance bar gene, etc.) and genes encoding enzymes or proteins capable of producing a color change (GUS gene, GFP gene, etc.) which are expressed in plants.

Carrying aGmMYB62The plant expression vector of (1) can be obtained by transforming a plant cell or tissue using a conventional biological method such as Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, conductance, agrobacterium mediation, etc., and cultivating the transformed plant cell or tissue into a plant. The method for regulating and controlling the stress resistance of the plants through transgenosis is suitable for all plants, not only can be suitable for monocotyledons (wheat, rice, corn and the like), but also can be suitable for dicotyledons (soybean, tobacco, cotton and the like).

The invention providesGmMYB62The gene is from wild soybean, and multiple sequence comparison finds that the gene has higher conservation with MYB genes of other plants; the real-time fluorescent quantitative PCR detection result shows thatGmMYB62The expression is carried out in all physiological development stages of the soybean, the expression is higher in roots, stems, leaves and flowers, and the expression is not detected in bean pods; in the transgenic combined plant, the real-time fluorescent quantitative PCR detection result shows that the over-expression is performedGmMYB62The gene can regulate the expression of drought-resistant related genes and regulate the expression of isoflavone synthesis related genes; under drought stress treatment, compared to controlsGmMYB62The drought resistance of the over-expression combined plant of the gene is obviously improved, which indicates that the geneGmMYB62Can be used as target gene to be introduced into plant (including monocotyledon and dicotyledon), and has effects of improving plant stress resistanceHigh practical application value.

Drawings

FIG. 1 is the conserved domain of GmMYB62 protein;

FIG. 2 is a multiple sequence alignment of the amino acids of the GmMYB62 protein with MYB proteins from other plants;

FIG. 3 shows the real-time fluorescent quantitative PCR detection results of expression abundance of MYB protein mRNA in different tissues and organs;

FIG. 4 is a physical map of a PCXSN plant overexpression vector;

FIG. 5 is an overexpressionGmMYB62Regulating the expression of drought-resistant related gene by gene;

FIG. 6 is overexpressionGmMYB62Regulating the expression of isoflavone synthesizing related gene;

FIG. 7 is PCXSN:GmMYB62and (5) carrying out drought resistance identification and PCR verification on the transgenic combined plant.

Detailed description of the invention

1. Materials and methods

1.1 materials, strains, reagents

The soybean material used in the experiment was G.max, and E.coli strain DH5 α was stored in the laboratory. pGEM-T Easy Vector T cloning kit, Trizol reagent, T4 DNA ligase from Fermentas; the primers are provided by Shanghai Ying Weishi Biotechnology Limited liability company, the RNA extraction kit is purchased from Promega, the gel recovery kit and the DNA purification recovery kit are purchased from Shanghai Jiehi bioengineering company, and other biological reagents such as DNA marker, Taq DNA polymerase, reverse transcription reagent and the like are purchased from Shanghai Haojia science and technology development Limited company.

1.2 Total RNA extraction and c DNA Synthesis

Grinding the root, stem and leaf of the seedling stage, the root, stem, leaf and flower of the flowering stage, the root, stem, leaf and pod of the pod stage and the like in liquid nitrogen, extracting total RNA by using a Promega RNA extraction kit, digesting by DNase I to remove DNA, and detecting the concentration and integrity of the total RNA by agarose gel electrophoresis with the mass volume fraction of 1.2%. cDNA synthesis is carried out by adopting the operation flow of a reverse transcription kit of Shanghai Haojia science and technology development Limited company.

1.3 cloning of the Gene

Amplifying full-length ORF from soybean seedling root tissue mRNA by using an RT-PCR method, wherein the sequence of the used forward Primer is Primer F: 5 'ATGACTCGGCGTTGCTCCCACTGC 3' and reverse Primer sequences are Primer R: 5 'CAAGCTCAGACAGCTTGAATT 3', using cDNA as template to amplify gene full-length DNA sequence, wherein the amplification system is: diluting cDNA or DNA, and adding proper amount; 5 XPS Buffer 5 mu L, 2.5 mmol L^–1 dNTPs 2 µL， 10 mmol L^–1Upstream and downstream primers are 0.5 muL and 5U mL respectively^–1PimerSTAR DNA polymerase 0.25 μ L, ddH₂And O is complemented to 25 mu L. The reaction procedure is as follows: pre-denaturation at 98 ℃ for 3 min; denaturation at 98 deg.C for 5s, renaturation at 55 deg.C for 10 s, extension at 72 deg.C for 5 min, 35 cycles; suspending the PCR program, adding 1 mu LTaqDNA polymerase, extension at 72 ℃ for 10 min. The PCR product is connected into a pGEM-T Easy Vector T cloning kit Vector, and is delivered to Nanjing Kingsry Biotech limited company for sequencing to obtain a target sequence.

1.4 sequence analysis

Searching a nucleotide and protein database of NCBI by using BLAST X and BLAST P to perform sequence similarity analysis and amino acid conservation prediction; performing amino acid sequence comparison and functional domain search and similar sequence analysis by using Clustal X; the results show that the protein amino acid sequence and rice (A)Oryza sativa) Arabidopsis thaliana (A) and (B)Arabidopsis thaliana) Corn (c)Zea mays) Alfalfa (c)Medicago truncatula) Plum blossom (A)Prunus mume) And tomato (A)Solanum lycopersicum) The MYB family genes have higher similarity and all have a conserved SANT structural domain between amino acids 111-155, as shown in FIGS. 1 and 2.

1.5 Gene expression analysis

A semi-quantitative RT-PCR analysis method is adopted, a primer is designed according to a cDNA sequence, a soybean housekeeping gene (Glycine max actin-1-like) (GmActin accession number: XM _003552652) is used as an internal reference, the sequence of a forward primer is 5'-CGGTGGTTCTATCTTGGCATC-3', the sequence of a reverse primer is 5'-GTCTTTCGCTTCAATAACCCTA-3', and a forward primer of a target gene: 5'-AAGGAGACTGGCGTGGGATA-3', respectively; reverse primer 5'-TGATTTGAGGGAGAGATTTA-3' (BLAST results on soybean genome found no other homologous genes, indicating gene specificity); the tissue expression analysis of the genes was performed using the extracted roots, stems, leaf tissues and flowers of the seedlings and the cDNA of the pods as templates, as shown in FIG. 3.

1.6 vector construction

By usingXcm1Forming a T/A cloning site by using an enzyme single cutting vector PCXSN, and amplifying a full-length ORF of a gene by using PCR (polymerase chain reaction), wherein the sequence of a forward Primer is Primer F: 5 'ATGACTCGGCGTTGCTCCCACTGC 3' and reverse Primer sequences are Primer R: 5 'CAAGCTCAGACAGCTTGAATT 3', then T4 ligase joins the amplification product into the enzyme-cleaved empty carrier, and then a positive clone with the correct direction obtained by amplification of a 35F forward primer 5'-ACTCGCCGTAAAGACTGG-3' and a gene reverse primer is transferred into agrobacterium rhizogenes K599 and agrobacterium tumefaciens EHA105 by a freeze-thaw method for subsequent transformation, as shown in FIG. 4.

Applying a Hairy Root experiment system, including an in-vitro experiment system and an in-vivo experiment system, wherein one type is the verification of the injection rooting of the external bacterial liquid of the broad bean paste; the other is that after the bacterium liquid is injected in vivo to generate roots and then seedlings are regenerated to obtain transgenic combined plants, the transgenic combined plants are subjected to anti-drought or drought-enduring identification; the plant overexpression vector is transferred into agrobacterium rhizogenes K599 through a freeze thawing method, a transgenic combined plant (the root is transgenic, and the others are non-transgenic) is obtained through an injection method, and the results show that: over-expressionGmMYB62Gene-regulatable drought-resistant related geneRD20A、RD22AndERD1is expressed by whereinRD20AThe expression level of the gene is slightly reduced, andRD22andERD1the genes are all expressed in an up-regulation way; simultaneous overexpressionGmMYB62Gene regulating important regulating gene in isoflavone synthesizing path4CL、PAL、CHI、CHS、CHR、C4HAndIFSis expressed, and is other thanCHRBesides the gene expression is slightly up-regulated, other genes are obviously up-regulated; under drought stress, compared with an empty control plant, a transgenic plant over expressing the gene has stronger tolerance to the stress of a PEG (20% m/v) solution, and the gene plays an important role in regulating and controlling isoflavone synthesis and the drought and salt stress resistance of plants, as shown in figures 5, 6 and 7.

2. And (3) preliminary functional identification:

2.1 plant Material

The plant material is soybean seedling, and the soybean seed is sowed on vermiculite: sand (3: 1) in a medium, watering and culturing in a light incubator (Ningbo Hai Shuifu laboratory apparatus) at 25-28 deg.C for 12 hr per day with a light intensity of 2000lux until the seedling grows to 4-5 cm for subsequent injection.

2.2 bacterial liquid culture and injection

Picking single colony K599 (containing GsSIP gene expression vector) from the plate, placing the single colony K599 into a 15ml tube added with 1ml liquid LB (added with Kan50 mg/L), shaking for 1-2d at 200rpm on a shaking table at 28 ℃, then sucking 2ml for centrifugation, re-rotating the precipitate with 10m M magnesium sulfate solution, re-centrifuging once, and then diluting with magnesium sulfate to OD600 of about 0.8-1.0; the bacterial liquid is sucked by a 0.025ml range micro-syringe, injected at the cotyledonary node part of the soybean, injected into about 3 to 4 holes, then placed in a small beaker with water, sealed by a plastic film and cultured in a light incubator (12 h light/12 h dark) at 28 ℃.

2.3 Combined seedling growth management

After the injected hole grows out of the root when the culture is carried out for 5-7 days approximately, the plastic film is removed, the original root system is cut off, and the culture is carried out in Hoagland nutrient solution until the root is strong enough for the follow-up research.

2.4 identification of Positive plants of Combined seedlings

DNA was extracted by CTAB method and the quality of DNA was checked by 0.8% agarose gel electrophoresis. The total volume of the PCR reaction is 20 muL, the template DNA (20 ng/muL) is 1 mul, the forward and reverse primers (10 muM) are 0.4 mul respectively, the 10xPCR Buffer is 2 mul, and MgCl is adopted₂1.6 μ L (25mM), 1.6 μ L dNTP (10mM), 0.2 μ L rTaq (5U/μ L), and 12.8 μ L ddH2O 12.8. Reaction procedure 94 ℃ pre-denaturation 4min, 35 cycles: denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, extension at 72 ℃ for 50s, and final extension at 72 for 10 min. The primer used was the 35S forward primer 5'-ACTCGCCGTAAAGACTGG-3'; gene reverse primers 5 'CAAGCTCAGACAGCTTGAATT 3' were combined and amplified for validation. The result shows that the plants correspond to the corresponding transgenic vectors, i.e. the transgenic plants can be successfully amplified to achieve the aimThe band and the gene of interest were overexpressed, while the negative control did not, as shown in FIG. 7.

The gene is transferred into cultivated soybean by an agrobacterium-mediated method, then the synthesis of isoflavone and the expression of drought-resistant key marker gene are measured, and the molecular mechanism of drought resistance is researched, so that new drought-resistant or drought-resistant germplasm resources are created, and a bridge parent is provided for breeding.

In summary, the present inventors provideGmMYB62The gene is a new gene separated from soybean for the first time, and the function of the gene participates in the synthesis of isoflavone of the soybean and the response of drought resistance and stress tolerance. According to the inventionGmMYB62The gene is from cultivated soybean, has optimized codon suitable for expression of dicotyledon, and the genetic engineering acceptor plant is suitable for dicotyledon, such as soybean, cotton, tobacco, etc. except monocotyledon rice, corn and wheat.

Sequence listing

<110> Jilin province academy of agricultural sciences of Jiangsu province

MYB family gene of <120> plant and coded protein and application thereof

<160>2

<210>1

<211>1080

<212>DNA

<213>Cultivation of soybean Glycine maxv-myb avian myeloblastosis viral oncogene homolog (abbreviation)GmMYB62)，

<400>1

atgactcggc gttgctccca ctgcagcaac aacggccaca attcccggac atgcccttcg 60

cgtgggggcg gaggtgtgaa gctcttcggg gtcaggctga cggatggatc aatcattatt 120

atatacgcca gcatgggcaa cctaaacctc tcctccgccg ccgcacatca ccaattccat 180

tcatctcctt cttcttccaa cctcgccgcc gccccctcat cccccaatcc aagctcccca 240

tgctccgacc ctccccaagg ttacttgtcc gatgaccccg cccatgtctc caccttcgct 300

aaccgccgcg gtgatagaaa aaaaggtgtt ccatggactg aagaagaaca tcggctgttc 360

ttaattggtc tccagaagct aggcaaagga gactggcgtg ggatagcacg caattttgtt 420

gtatcaagga cccctactca agtagcaagt catgcccaga agtattttat ccggcagagt 480

catgctacca ggagaaagag acgttccagt ctttttgaca tggttccaga tatgtcttca 540

gatcaacctt ctgtgccaga agaacaagtg ttgcttccac cttcccagaa ctcacaacct 600

tgcaatggaa aatcacagcc ttcattaaat ctctccctca aatcagaatt tgaacccatg 660

gagactactt ctcaagaaaa tgcgcaacag accaatgaaa ctatgatggg atcaatcgga 720

ctgacaccaa tggctcctca tggattcttt cctgcatatt tacctgttcc atttcccatg 780

tggccatcaa ctgtggctcc cccgtttgaa gaagttaagg gaggagagac atcccaccat 840

cagatccaca agccaatccc agtcattccc aaggaacctg ttaatgttga cgaacttgtg 900

ggaatgtctc atctaagcat tggggaagca aaggtacgtg atagagagcc ttcccctctt 960

tccttaaagt tgttaggaga gccctcaagg cagtcagcat tccatgcaaa tgctccagtt 1020

ggtacctcgg attttaaaca atggcaagga caacgcaatt caagctgtct gagcttgtaa 1080

<210>2

<211>359

<212>PRT

<213>Cultivation of soybean Glycine max

<400>2

Met Thr Arg Arg Cys Ser His Cys Ser Asn Asn Gly His Asn Ser Arg

1 5 10 15

Thr Cys Pro Ser Arg Gly Gly Gly Gly Val Lys Leu Phe Gly Val Arg

20 25 30

Leu Thr Asp Gly Ser Ile Ile Ile Ile Tyr Ala Ser Met Gly Asn Leu

35 40 45

Asn Leu Ser Ser Ala Ala Ala His His Gln Phe His Ser Ser Pro Ser

50 55 60

Ser Ser Asn Leu Ala Ala Ala Pro Ser Ser Pro Asn Pro Ser Ser Pro

65 70 75 80

Cys Ser Asp Pro Pro Gln Gly Tyr Leu Ser Asp Asp Pro Ala His Val

85 90 95

Ser Thr Phe Ala Asn Arg Arg Gly Asp Arg Lys Lys Gly Val Pro Trp

100 105 110

Thr Glu Glu Glu His Arg Leu Phe Leu Ile Gly Leu Gln Lys Leu Gly

115 120 125

Lys Gly Asp Trp Arg Gly Ile Ala Arg Asn Phe Val Val Ser Arg Thr

130 135 140

Pro Thr Gln Val Ala Ser His Ala Gln Lys Tyr Phe Ile Arg Gln Ser

145 150 155 160

His Ala Thr Arg Arg Lys Arg Arg Ser Ser Leu Phe Asp Met Val Pro

165 170 175

Asp Met Ser Ser Asp Gln Pro Ser Val Pro Glu Glu Gln Val Leu Leu

180 185 190

Pro Pro Ser Gln Asn Ser Gln Pro Cys Asn Gly Lys Ser Gln Pro Ser

195 200 205

Leu Asn Leu Ser Leu Lys Ser Glu Phe Glu Pro Met Glu Thr Thr Ser

210 215 220

Gln Glu Asn Ala Gln Gln Thr Asn Glu Thr Met Met Gly Ser Ile Gly

225 230 235 240

Leu Thr Pro Met Ala Pro His Gly Phe Phe Pro Ala Tyr Leu Pro Val

245 250 255

Pro Phe Pro Met Trp Pro Ser Thr Val Ala Pro Pro Phe Glu Glu Val

260 265 270

Lys Gly Gly Glu Thr Ser His His Gln Ile His Lys Pro Ile Pro Val

275 280 285

Ile Pro Lys Glu Pro Val Asn Val Asp Glu Leu Val Gly Met Ser His

290 295 300

Leu Ser Ile Gly Glu Ala Lys Val Arg Asp Arg Glu Pro Ser Pro Leu

305 310 315 320

Ser Leu Lys Leu Leu Gly Glu Pro Ser Arg Gln Ser Ala Phe His Ala

325 330 335

Asn Ala Pro Val Gly Thr Ser Asp Phe Lys Gln Trp Gln Gly Gln Arg

340 345 350

Asn Ser Ser Cys Leu Ser Leu

355

Claims (4)

1. GeneGmMYB62Or the application of the coded protein in the cultivation of transgenic soybeans with improved stress resistance, is characterized in that,

the geneGmMYB62Is SEQ ID NO: 1;

the above-mentionedGmMYB62The encoded protein of (a) is SEQ ID NO: 2The amino acid residue sequence shown;

the stress resistance is drought resistance;

the gene is introducedGmMYB62Introducing into plant tissue or cell to regulate isoflavone synthesis;

saidGmMYB62The gene is obtained by containingGmMYB62Introducing the plant expression vector of (a) into an explant;

the synthesis of the regulating isoflavone regulates the expression of related genes in the synthesis pathway of the isoflavone.

2. The use of claim 1, wherein said use is of a gene-containing compositionGmMYB62The expression vector of (3) is applied to culturing transgenic soybean with improved stress resistance.

3. The use according to claim 2, characterized in that the starting vector for constructing the plant expression vector is any one of binary Agrobacterium vectors or vectors for plant microprojectile bombardment.

4. The use of claim 1, wherein said use is of a gene-containing compositionGmMYB62The host bacterium of (2) is applied to culturing transgenic soybean with improved stress resistance.

Images