CN111454344B - Soybean MYB transcription factor, coding gene and application thereof - Google Patents

Soybean MYB transcription factor, coding gene and application thereof Download PDF

Info

Publication number
CN111454344B
CN111454344B CN202010408143.1A CN202010408143A CN111454344B CN 111454344 B CN111454344 B CN 111454344B CN 202010408143 A CN202010408143 A CN 202010408143A CN 111454344 B CN111454344 B CN 111454344B
Authority
CN
China
Prior art keywords
soybean
gmmyb7
transcription factor
gene
myb transcription
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN202010408143.1A
Other languages
Chinese (zh)
Other versions
CN111454344A (en
Inventor
赵剑
曾祥圣
李鹏辉
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Anhui Agricultural University AHAU
Original Assignee
Anhui Agricultural University AHAU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Anhui Agricultural University AHAU filed Critical Anhui Agricultural University AHAU
Priority to CN202010408143.1A priority Critical patent/CN111454344B/en
Publication of CN111454344A publication Critical patent/CN111454344A/en
Application granted granted Critical
Publication of CN111454344B publication Critical patent/CN111454344B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Nutrition Science (AREA)
  • Plant Pathology (AREA)
  • Botany (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention belongs to the technical field of biology, and particularly relates to a soybean MYB transcription factor, a coding gene and application thereof. The invention discloses a gene sequence and an amino acid sequence of a soybean MYB transcription factor GmMYB7 for the first time, and proves that the gene can promote the synthesis of soybean flavone and isoflavone but can not promote the synthesis of all kinds of isoflavone by over-expressing the GmMYB7 gene. Meanwhile, the invention detects the development-related gene changes after the GmMYB7 is over-expressed, and explores the metabolic pathway of the GmMYB7 when the synthesis of flavone and isoflavone is influenced.

Description

Soybean MYB transcription factor, coding gene and application thereof
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a soybean MYB transcription factor, a coding gene and application thereof.
Background
Leguminous crops are the third largest family of plants, and dozens of leguminous crops widely cultivated in the world provide abundant food, medicines and industrial raw materials for human beings. Wherein, the soybean (Glycine max (L.) Merr.) originates from China, has long cultivation history, is rich in grease, protein and isoflavone, and is an important food crop and oil crop in the world.
The flavonoid compounds are secondary metabolites in plants and widely participate in various physiological activities of the plants, such as dormancy and vitality of seeds, seed coat development, interaction with root nodules and the like. Flavonoids are classified into chalcones (Chalcone), such as Isoliquiritigenin (Isoliquiritigenin), Xanthohumol (Xanthohumol), etc., according to the structure of the C-ring and the difference of functional groups at C-3 and C-4 positions; flavones (flavanone), such as Luteolin (Luteolin), Apigenin (Apigenin), and the like; flavonols (flavonols) such as Quercetin (Quercetin), Kaempferol (Kaempferol), Myricetin (Myricetin), etc.; flavanones such as Hesperetin (Hesperetin), Naringenin (Naringenin), etc.; flavanonols (flavanonoles), such as Taxifolin (Taxifolin); flavanols (flavanols), such as Catechin (Catechin) and Epicatechin (Epicatechin), and the like; anthocyanins (anthocyanidins) such as Cyanidin (Cyanidin), Pelargonidin (Pelargonidin), Peonidin (Peonidin), Delphinidin (Delphinidin), morning glory pigment (petuniadin), Malvidin (Malvidin), and the like; isoflavones (isoflavane) such as Daidzein (Daidzein), Glycitein (Glycitein), Genistein (Genistein), and corresponding glucosides, acetylglucoside, malonylglucoside compounds, and the like.
Meanwhile, in recent years, MYB transcription factors are reported to regulate seed development such as grain size, and the size of plant seeds is strictly regulated and controlled by seed coat development, embryos and endosperm. At present, it is clear that seed development goes through two distinct stages, and there are many factors affecting seed size, for example, the difference in kernel size is caused by genetic effects such as diploid, tetraploid differences; alternatively, genes such as MINISED 3, HAIKU1 and HAIKU2 promote grain size by affecting cell elongation, and genes such as TRANSPARENT TESTA GLABRA2 and AUXIN RESPONSE FACTOR 2 affect grain size by affecting cell expansion and proliferation.
Disclosure of Invention
Aiming at the problems in the prior art, the invention provides a soybean MYB transcription factor, a coding gene and application thereof, and aims to solve part of problems in the prior art or at least alleviate part of problems in the prior art.
The soybean MYB transcription factor has an amino acid sequence shown in SEQ ID NO.2, or has an amino acid sequence which is obtained by substituting and/or deleting and/or adding a plurality of amino acid residues in a sequence shown in SEQ ID NO.2 and has the same protein function; or derived from the amino acid sequence shown in SEQ ID NO.2, has more than 98 percent of homology and has the same protein function.
The invention also discloses a soybean MYB transcription factor coding gene, the nucleotide sequence of which is shown in SEQ ID NO.1, or a DNA sequence which is hybridized with the DNA sequence limited by the SEQ ID NO.1 and codes the same functional protein; or DNA molecule which has more than 90% of homology with the DNA sequence limited by SEQ ID NO.1 and codes the same functional protein.
The invention also discloses application of the soybean MYB transcription factor coding gene in regulating the content of soybean flavone.
Further, the flavone includes at least one of Isoliquiritigenin (Isoliquiritigenin), Isoliquiritigenin 4' -O-Glucoside (Isoliquiritigenin 4' -O-Glucoside, I4' OG), liquiritigenin (Liquiritin), Luteolin 7-O-Glucoside (Luteolin 7-O-Glucoside, L7OG), and Kaempferol 7-O-Glucoside (Kaempferol 7-O-Glucoside, K7 OG).
The invention also discloses application of the soybean MYB transcription factor coding gene in adjusting the content of soybean isoflavone.
Further, the isoflavone includes at least one of Genistin (Genistin), Daidzin (Daidzin), and Daidzein (Daidzein).
In summary, the advantages and positive effects of the invention are:
the invention discloses a gene sequence and an amino acid sequence of a soybean MYB transcription factor GmMYB7 for the first time, and proves that the gene can promote the synthesis of soybean flavone and isoflavone but can not promote the synthesis of all kinds of isoflavone by over-expressing the GmMYB7 gene. Meanwhile, the invention detects the development-related gene changes after the GmMYB7 is over-expressed, and explores the metabolic pathway of the GmMYB7 when the synthesis of flavone and isoflavone is influenced.
Drawings
FIG. 1 is a sequence alignment of GmMYB 7;
FIG. 2 is tissue specific expression of GmMYB 7;
FIG. 3 is a measurement of flavone content of GmMYB7 over-expression and a control group;
FIG. 4 is an isoflavone content measurement of GmMYB7 overexpression versus control;
FIG. 5 shows the changes in the expression levels of structural genes involved in flavonoid biosynthesis;
FIG. 6 shows the change of expression level of genes possibly related to seed development after overexpression of GmMYB 7.
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail below with reference to examples, and the equipment and reagents used in the examples and test examples are commercially available without specific reference. The specific embodiments described herein are merely illustrative of the invention and are not intended to be limiting.
The invention discloses a soybean MYB transcription factor, a coding gene and application thereof, and particularly relates to the following embodiments. The nucleotide sequence of the soybean MYB transcription factor GmMYB7 gene is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO. 2.
The materials involved in the invention:
1. soybean (Glycine max): tianlong number one (PI1578450, 12W 12);
2. coli: DH5 a; agrobacterium rhizogenes: k599;
3. carrier: pGEM-T Easy, pDONR221, pB2GW 7;
4. LB culture medium: weighing 10g NaCl, 5g yeast extract, 10g trypsin
Adding 950mL of ultrapure water into peptone, stirring and dissolving, adding water to a constant volume of 1000mL, and sterilizing for 15min by high-pressure steam to obtain an LB liquid culture medium, wherein the LB solid culture medium is obtained by adding 15g of agar powder into the LB liquid culture medium;
5. ampicillin mother liquor (Amp +, 50 mg/mL): weighing 0.5g ampicillin Amp, dissolving in 10mL sterile water, filtering, sterilizing, packaging into small tubes, and storing at-20 deg.C;
kanamycin mother liquor (Kan +, 50 mg/mL): weighing 0.5g kanamycin Kan, dissolving in 10mL sterile water, filtering for sterilization, subpackaging into small tubes, and storing at-20 ℃;
spectinomycin stock (Spec +, 50 mg/mL): weighing 0.5g spectinomycin Spec, dissolving in 10mL sterile water, filtering, sterilizing, packaging into small tubes, and storing at-20 deg.C;
rifampicin mother liquor (Rif +, 20 mg/mL): weighing 0.2g rifampicin Rif, dissolving in 10mL dimethyl sulfoxide (DMSO), filtering, sterilizing, packaging into small tubes, and storing at-20 deg.C;
mother liquor of cefamycin (Cef +, 400 mg/mL): weighing 4g of cefuroxime, dissolving in 10mL of sterilized water, filtering for sterilization, subpackaging into small tubes, and storing at-20 ℃;
glufosinate mother liquor (PPT +, 2.5 mg/mL): 0.025g of glufosinate-ammonium PPT is weighed and dissolved in 10mL of sterilized water, filtered and sterilized, and then subpackaged with small tubes to be stored at the temperature of minus 20 ℃.
Example cloning of GmMYB7 Gene, construction of engineering Strain and transgenic rooted Soybean plant
1. Cloning of GmMYB7 gene and construction of engineering strain
Firstly, designing a specific primer, wherein the primer sequence is as follows:
F:ATGGGAAGAGCTCCTTGTTG，SEQ ID NO.3；
R:TTACACCAATAAAGATTGAG，SEQ ID NO.4；
extracting total RNA of wild R108 of medicago truncatula according to a plant total RNA extraction kit and an M-MLV cDNA synthesis kit specification, and performing reverse transcription to obtain cDNA.
The reverse transcribed cDNA was used as a template and amplified with specific primers, and the PCR system was 50. mu.L containing 0.5. mu.L of the enzyme, 2. mu.L of LDNA template, 5. mu.L of buffer, 4. mu.L of dNTPs, 2.5. mu.L of each of the forward and reverse primers, and the remainder was filled with sterilized water. The amplification procedure is pre-denaturation at 98 ℃ for 10s, annealing at 57 ℃ for 30s, extension at 68 ℃ for 1min, 35 cycles, and extension at 68 ℃ for 5min, and the obtained PCR product is stored at 4 ℃.
And purifying the PCR product by using a PCR purification kit, performing connection transformation by using a pGEM-T kit of Promega according to the instruction, performing colony PCR verification to obtain a positive colony, extracting colony plasmid to obtain a T vector containing the GmMYB7 gene, and simultaneously sending the bacterial liquid to Shanghai Producer company Limited for sequencing.
Designing a specific primer with attB joint sequence, wherein the primer sequence is shown as follows, performing PCR amplification by using the monoclonal colony plasmid with correct sequencing as a template, purifying a PCR product by the same method, and storing at-20 ℃.
F:GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGGAAGAGCTCCTTGTTG，SEQ ID NO.5；
R:GGGGACCACTTTGTACAAGAAAGCTGGGTTTACACCAATAAAGATTGAG，SEQ ID NO.6；
Using Gateway cloning technology, 1. mu.L of the above PCR product, pDONR221 intermediate vector of equivalent mass, and finally 11. mu.L of BP clone Mix were added, and DH 5. alpha. was transformed overnight at room temperature, and positive clones were verified as described above.
And extracting a plasmid of a positive clone with correct sequencing according to the kit operation, taking 1 mu L, adding an equal amount of pB2GW7 overexpression vector, finally adding 1 mu L of LR clone Mix, converting DH5 alpha after overnight at room temperature, verifying the positive clone by the same operation, and extracting the plasmid pB2GW7-GmMYB 7.
2. Construction of transgenic rooted soybean plants
The obtained pB2GW7-GmMYB7 overexpression plasmid is transformed according to the method of K599 rhizogenes agrobacterium competence transformation instruction, and positive clone is verified by colony PCR.
The soybean cotyledon node rooting genetic transformation method comprises the following steps:
(1) taking the Tianlong I seeds with good appearance varieties, and sterilizing the Tianlong I seeds for 12 hours by using chlorine gas (the chlorine gas is generated by the reaction of 30mL of sodium hypochlorite and 7mL of concentrated hydrochloric acid);
(2) washing sterilized semen glycines seed with sterilized water in superclean bench for 2-3 times, placing in culture dish paved with double-layer wet filter paper, and culturing under 16h illumination/8 h dark at 24-26 deg.C;
(3) selecting positive K599 Agrobacterium tumefaciens introduced with corresponding plasmid by an electric shock transformation method, adding 5mL of liquid LB culture medium (containing 20mg/mL of Rif and 50mg/mL of Spec), placing in a shaking table at 28 ℃ for 180r/min for overnight culture, centrifuging at 4000r/min for 10 minutes to collect bacteria, and re-suspending the bacteria to OD by using a fresh LB liquid culture medium 600 0.4 for standby;
(4) selecting soybean seedlings which germinate for about 7 days and have good growth conditions, cutting off radicles and the like by using a scalpel, only keeping two cotyledons, transversely cutting the cotyledons, dripping agrobacterium liquid at a wound, placing on a culture dish containing wet filter paper, and performing dark culture for 3 days at a proper temperature;
(5) placing the soybean cotyledon added with the bacterial liquid in a conical flask filled with 100mL of sterile water, oscillating and washing for 5 hours at 28 ℃, and then placing the soybean cotyledon on clean filter paper for drying;
(6) the blow-dried soybean cotyledons were placed on B5 solid medium (containing 400. mu.g/ml Cef + 50. mu.g/ml Amp + 2.5. mu.g/ml PPT), and cultured in 16h light/8 h dark at 24-26 ℃ until sufficient hairy root material was harvested for further analysis.
Detection method related to the invention
Measurement of flavone and isoflavone compound content
Using ESI-LC-MS, wherein HPLC is Agilent HP1100 reversed phase chromatography, C18 chromatographic column (J.T. Baaker), gradient mobile phase washing, flow rate of 0.8mL/min, phase A is 0.1% acetic acid water, phase B is acetonitrile, washing gradient is 0-5 min, 5% B; 5 to 15min,5 to 15% B; 15 to 20min,15 to 17% B; 20 to 25min,17 to 23% B; 25 to 60min,23 to 50% B; 60 to 60.5min,50 to 95% B; 60.5 to 70.5min, 95% B. The mass spectrometer detector is in positive ion mode, the ESI source voltage is 3000V, and the scanning range is 50-2200 m/z.
Tissue specific expression detection
Taking different tissues of soybean or different treated samples, quickly freezing in liquid nitrogen, and storing in a refrigerator at-80 deg.C for use. RNA was extracted and reverse transcribed as described above to obtain cDNA template, which was detected using iQ5 fluorescent quantitative PCR detection system from Bio-Rad, 20. mu.L of PCR reaction containing 2.5. mu.L of 2X Power SYBR Master Mix (Applied Biosystems), 1. mu.L of primer Mix, 2. mu.L of 1: 30 diluted cDNA template, the remainder was made up with water. PCR programs and analytical methods are described in Ahmad MZ, Li P, Wang J, Rehman NU, Zhao J. (2017) Isoflex malonyltransferases GmIMaT1 and GmIMaT3 differential modification isoflex carbohydrates in sobean (Glycine max) under vacuum stresses.
The invention compares the GmMYB7 with related gene sequences in a database, and the result is shown in figure 1.
The tissue-specific expression result of GmMYB7 is shown in FIG. 2, and the result shows that GmMYB7 has expression in all tissues, has the highest expression level in seed coats, has higher expression level in roots, flowers and root nodules, and has almost no expression level in stems, leaves, pods and cotyledons; the GmMYB7 has expression in each period of seed development, reaches the highest level in the middle prophase and is reduced in the later development stage.
The measurement results of the flavone content of the GmMYB7 overexpression and control group are shown in figure 3 (isoliquiritigenin, isoliquiritigenin 4'-O-glucoside, liquiritigenin, luteolin 7-O-glucoside, kaempferol 7-O-glucoside and kaempferol 3-O-glucoside are sequentially arranged from left to right), the results show that the content of isoliquiritigenin, isoliquiritigenin 4' -O-glucoside, liquiritigenin, luteolin 7-O-glucoside and kaempferol 7-O-glucoside in the hairy roots of the overexpression GmMYB7 is higher than that of the GFP control group, and the difference reaches a significant level. In addition, kaempferol 3-O glucoside content was elevated compared to the GFP control, but did not reach a significantly different level.
The results of measuring the isoflavone content of the over-expressed GmMYB7 and the control group are shown in FIG. 4 (acetyl genistin, glycitin, genistin, daidzin, malonyl daidzin, acetyl glycitin, daidzein, malonyl daidzin, malonyl genistin, acetyl daidzin and glycitein from left to right in sequence), and the results show that the contents of the genistin, the daidzin and the glycitein are increased compared with the contents of the GFP control group, and the difference reaches a significant level. Meanwhile, after the GmMYB7 is over-expressed, the content is increased but does not reach a significant difference level, such as malonyl daidzein.
Meanwhile, the invention also detects the change condition of the genes related to development after the GmMYB7 is over-expressed, and the result is shown in fig. 5 and fig. 6. FIG. 5 shows the change of expression level of structural genes involved in flavonoid biosynthesis, and the up-regulation of genes such as Phenylalanine Ammonia Lyase (PAL), cinnamic acid carboxylase (C4H), 4-coumaroyl-CoA ligase (4CL) by 1.6-3.7 times may result in the increase of the content of flavonoids such as isoliquiritigenin; the up-regulation of isoflavone synthases IFS1 and IFS2 by 1.2 and 1.6 times, respectively, may result in an increase in the content of compounds such as isoflavones. FIG. 6 shows the changes of gene expression levels possibly related to seed development after overexpression of GmMYB7, the gene expression levels related to auxin signal response and regulation of expansin, ethylene response factor and gibberellin are increased, and partial genes are specifically expressed in seeds, which suggests that GmMYB7 may be involved in regulation of seed development.
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.
Sequence listing
<110> agriculture university of Anhui
<120> soybean MYB transcription factor, coding gene and application thereof
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 846
<212> DNA
<213> nucleotide sequence (GmMYB7)
<400> 1
atgggaagag ctccttgttg ctctaaagta gggttgcaca gaggtccatg gactcctcga 60
gaagatgcat tgctcaccaa gtatattcaa gctcatggaa aaggccagtg gagatcacta 120
ccaaaaacag ctggtcttct tagatgcgga aaaagttgcc gactgagatg gatgaactat 180
ctgagacctg atataaagag aggaagcata accccagaag aagatgatct tataattaga 240
atgcattcgc ttttaggaaa tagatggtcc ctcatcgcgg ggagattacc aggacgaaca 300
gataatgaga ttaagaacta ctggaatacc catctcagca agaagctgag aaatcaagga 360
accgatccaa agacacacga caagttaact gaggcaccag agaagaagaa gggtaaaaag 420
aggaataagc aaaagaatga gaataacaaa gggtcagaga agactttagt ttatctacca 480
aaacccataa gggttaaggc tttatcatca tgtataccca gaacggatag caccttaacc 540
cttaattcca attcagcaac tgcatcaact agcgaagaga aagttcaaag cccaggagca 600
gaagtaaaag aggtgaacat ggtttggggg gtaggtgacg atgcagacaa tggtgggatt 660
gaaatattct ttggtgaaga ccaagaccta gtcaacaata ctgcctctta cgtggaatgc 720
tattctgatg ttcacactga tgatcatggt acgctagaaa aactctacga agagtacttg 780
cagctcttga atgttgagga gaagccagat gaattagatt cttttgctca atctttattg 840
gtgtaa 846
<210> 2
<211> 281
<212> PRT
<213> amino acid sequence (GmMYB7)
<400> 2
Met Gly Arg Ala Pro Cys Cys Ser Lys Val Gly Leu His Arg Gly Pro
1 5 10 15
Trp Thr Pro Arg Glu Asp Ala Leu Leu Thr Lys Tyr Ile Gln Ala His
20 25 30
Gly Lys Gly Gln Trp Arg Ser Leu Pro Lys Thr Ala Gly Leu Leu Arg
35 40 45
Cys Gly Lys Ser Cys Arg Leu Arg Trp Met Asn Tyr Leu Arg Pro Asp
50 55 60
Ile Lys Arg Gly Ser Ile Thr Pro Glu Glu Asp Asp Leu Ile Ile Arg
65 70 75 80
Met His Ser Leu Leu Gly Asn Arg Trp Ser Leu Ile Ala Gly Arg Leu
85 90 95
Pro Gly Arg Thr Asp Asn Glu Ile Lys Asn Tyr Trp Asn Thr His Leu
100 105 110
Ser Lys Lys Leu Arg Asn Gln Gly Thr Asp Pro Lys Thr His Asp Lys
115 120 125
Leu Thr Glu Ala Pro Glu Lys Lys Lys Gly Lys Lys Arg Asn Lys Gln
130 135 140
Lys Asn Glu Asn Asn Lys Gly Ser Glu Lys Thr Leu Val Tyr Leu Pro
145 150 155 160
Lys Pro Ile Arg Val Lys Ala Leu Ser Ser Cys Ile Pro Arg Thr Asp
165 170 175
Ser Thr Leu Thr Leu Asn Ser Asn Ser Ala Thr Ala Ser Thr Ser Glu
180 185 190
Glu Lys Val Gln Ser Pro Gly Ala Glu Val Lys Glu Val Asn Met Val
195 200 205
Trp Gly Val Gly Asp Asp Ala Asp Asn Gly Gly Ile Glu Ile Phe Phe
210 215 220
Gly Glu Asp Gln Asp Leu Val Asn Asn Thr Ala Ser Tyr Val Glu Cys
225 230 235 240
Tyr Ser Asp Val His Thr Asp Asp His Gly Thr Leu Glu Lys Leu Tyr
245 250 255
Glu Glu Tyr Leu Gln Leu Leu Asn Val Glu Glu Lys Pro Asp Glu Leu
260 265 270
Asp Ser Phe Ala Gln Ser Leu Leu Val
275 280
<210> 3
<211> 20
<212> DNA
<213> Artificial sequence (GmMYB7-F)
<400> 3
atgggaagag ctccttgttg 20
<210> 4
<211> 20
<212> DNA
<213> Artificial sequence (GmMYB7-R)
<400> 4
ttacaccaat aaagattgag 20
<210> 5
<211> 51
<212> DNA
<213> Artificial sequence (GmMYB7-F)
<400> 5
ggggacaagt ttgtacaaaa aagcaggctt catgggaaga gctccttgtt g 51
<210> 6
<211> 49
<212> DNA
<213> Artificial sequence (GmMYB7-R)
<400> 6
ggggaccact ttgtacaaga aagctgggtt tacaccaata aagattgag 49

Claims (4)

1. A soybean MYB transcription factor has an amino acid sequence shown in SEQ ID NO. 2.
2. A soybean MYB transcription factor coding gene has a nucleotide sequence shown in SEQ ID NO. 1.
3. The use of a soybean MYB transcription factor-encoding gene of claim 2 for increasing daidzein content; the flavone is selected from at least one of Isoliquiritigenin (Isoliquiritigenin), Isoliquiritigenin 4' -O-Glucoside (Isoliquiritigenin 4' -O-Glucoside, I4' OG), liquiritigenin (Liquiritin), Luteolin 7-O-Glucoside (Luteolin 7-O-Glucoside, L7OG) and Kaempferol 7-O-Glucoside (Kaempferol 7-O-Glucoside, K7 OG).
4. Use of a soybean MYB transcription factor-encoding gene of claim 2 for increasing soybean isoflavone content; the isoflavone is selected from at least one of Genistin (genistein), Daidzin (Daidzin) and Daidzein (Daidzein).
CN202010408143.1A 2020-05-14 2020-05-14 Soybean MYB transcription factor, coding gene and application thereof Expired - Fee Related CN111454344B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010408143.1A CN111454344B (en) 2020-05-14 2020-05-14 Soybean MYB transcription factor, coding gene and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010408143.1A CN111454344B (en) 2020-05-14 2020-05-14 Soybean MYB transcription factor, coding gene and application thereof

Publications (2)

Publication Number Publication Date
CN111454344A CN111454344A (en) 2020-07-28
CN111454344B true CN111454344B (en) 2022-08-05

Family

ID=71677109

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010408143.1A Expired - Fee Related CN111454344B (en) 2020-05-14 2020-05-14 Soybean MYB transcription factor, coding gene and application thereof

Country Status (1)

Country Link
CN (1) CN111454344B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112280787B (en) * 2020-11-10 2021-09-21 中国科学院华南植物园 Glycyrrhiza MYB1 gene, and encoded protein and application thereof
CN116004653B (en) * 2022-10-13 2023-08-15 中国林业科学研究院林业研究所 PagERF81 gene for regulating and controlling poplar lignin synthesis and application thereof

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102124111B (en) * 2008-06-06 2014-09-24 格拉斯兰兹技术有限公司 Novel genes involved in biosynthesis
CN104946665B (en) * 2015-06-26 2021-06-25 江苏省农业科学院 GmMYB62Application in cultivating transgenic plant with improved stress resistance
CN105713077B (en) * 2016-04-11 2019-04-26 南京农业大学 A kind of soybean MYB class transcription factor GmMYB29 and its encoding gene and application
CN106047889B (en) * 2016-06-03 2019-09-24 吉林大学 The application of soybean myb transcription factor gene raising isoflavones biosynthesis
CN110894506B (en) * 2018-09-10 2023-05-05 中国科学院分子植物科学卓越创新中心 Gene for regulating plant flavonoid synthesis and ultraviolet resistance and application thereof

Also Published As

Publication number Publication date
CN111454344A (en) 2020-07-28

Similar Documents

Publication Publication Date Title
CN111454344B (en) Soybean MYB transcription factor, coding gene and application thereof
Nakatsuka et al. Light-induced expression of basic helix-loop-helix genes involved in anthocyanin biosynthesis in flowers and leaves of Asiatic hybrid lily
CN111690662B (en) Application of soybean bHLH transcription factor GmPIF1 gene in promotion of isoflavone synthesis
Pandith et al. Functional promiscuity of two divergent paralogs of type III plant polyketide synthases
CN110408649B (en) Application of NOR gene and protein coded by same in regulating and controlling synthesis of flavonoid compounds in tomato fruits
CN109055399A (en) One kind gene order relevant to flavones synthetic in radix scutellariae and its application
Liu et al. Over-expression of GmMYB39 leads to an inhibition of the isoflavonoid biosynthesis in soybean (Glycine max. L)
CN110305884A (en) A kind of gene NtAOS1 improving tobacco leaf jasmine acid content and its cloning process and application
CN101123870A (en) Isolated polypeptides and polynucleotides encoding same for generating plants with increased cuticlar water permeability
Si et al. Functional analysis of Flavanone 3-hydroxylase (F3H) from Dendrobium officinale, which confers abiotic stress tolerance
CN110184247A (en) Alfalfa epiphysin synthesizes gene M sASMT and its application in regulation plant epiphysin and Flavonoid substances synthesis
CN112391398A (en) Apple flavone ketotransferase gene MdGT1 and application thereof
CN115991753A (en) Application of soybean C2H2 type zinc finger protein transcription factor GmZFP7 and/or gene thereof in regulating isoflavone
Singh et al. Mutation in shoot-to-root mobile transcription factor, ELONGATED HYPOCOTYL 5, leads to low nicotine levels in tobacco
Zhang et al. Flavonol synthase gene MsFLS13 regulates saline-alkali stress tolerance in alfalfa
AU2009285705B2 (en) Epicatechin glucosyltransferase
Yao et al. Chalcone synthase homologous genes cloning and expression pattern in flowering Fagopyrum tataricum Gaertn
Liu et al. Cloning and functional characterization of chalcone isomerase genes involved in anthocyanin biosynthesis in Clivia miniata
CN101514344B (en) Flavone synthetase gene and polypeptide encoded thereby
US20080317880A1 (en) Plant isoflavone and isoflavanone o-methyltransferase genes
CN115197951B (en) Tea tree flavonol synthesis candidate gene CsNAC086 and application thereof
CN112662641B (en) Marchantia cuneata flavonoid glycosyltransferase and coding gene and application thereof
CN110964740A (en) Preparation method and application of tobacco with high flavonol content
KR20170011474A (en) A flavonol synthase gene and a transgenic plant with the same
KR101829803B1 (en) Anthocyanin biosynthesis genes involved in pigmentation of zoysiagrass and uses thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20220805

CF01 Termination of patent right due to non-payment of annual fee