CN116004653B - PagERF81 gene for regulating and controlling poplar lignin synthesis and application thereof - Google Patents

Abstract

The invention discloses a PagERF81 gene for regulating and controlling the development of poplar xylem and application thereof, and relates to the technical field of biological genetic engineering; the nucleotide sequence and the amino acid sequence of the coding region of PagERF81 gene are respectively shown as SEQ ID NO.3 and SEQ ID NO. 4. According to the invention, the PagERF81 gene is knocked out through CRISPR/Cas9, compared with a wild type transgenic poplar, the quantity of duct cells in a xylem area is increased, the area of the duct cells is reduced, the lignin content is obviously improved, and the PagERF81 can regulate and control the development of the xylem of the poplar and obviously inhibit lignin synthesis. The invention provides a new choice for the regulation and control means of lignin synthesis, and has important application value in the field of forest genetic engineering.

Description

PagERF81 gene for regulating and controlling poplar lignin synthesis and application thereof

Technical Field

The invention relates to a PagERF81 gene for regulating and controlling poplar lignin synthesis and application thereof, belonging to the technical field of plant genetic engineering.

Background

Lignin is one of the important components of vascular plant cell secondary walls, mainly deposited in the cell secondary walls of the vascular tissue (e.g., ducts or tracheids), mechanical tissue (e.g., fibers, thick-walled tissue, etc.), and protective tissue (e.g., epidermis). Lignin is the second largest organic matter in the plant, the second only to cellulose, and is the largest class of secondary substances, accounting for about 30% of the total biomass of the plant. In the secondary wall of the plant cell, lignin molecules are crosslinked with polysaccharide molecules such as cellulose, hemicellulose and the like, so that the mechanical strength of the plant cell and tissue is improved; moreover, the hydrophobicity of the plant cell is not easy to permeate water, is favorable for long-distance transportation of moisture and nutrient substances in the plant body, and has important influence on lodging resistance, disease resistance and stress resistance of the plant. However, the presence of lignin also severely affects the development and utilization of wood fibers, such as the use of large amounts of chemicals in the paper industry to remove lignin, is costly and pollutes the environment; lignin is a major limiting factor in the production of fuel ethanol from wood fibers.

Recently, a series of progress has been made in lignin high-valued research, for example, the application technologies of producing antibacterial carriers, biodegradable materials and antioxidants, lignin-based superhydrophobic coatings, graphene and the like by using lignin are gradually matured. Therefore, the molecular mechanism of lignin biosynthesis is studied, the content and the monomer proportion of the plant lignin are regulated and controlled by means of genetic engineering and the like, and the lignin biological synthesis method has important application prospects in the fields of papermaking raw materials, biological energy sources, biological carbon fixation and the like.

In the last twenty years, systematic research on key genes related to main pathways such as lignin biosynthesis and metabolism and molecular regulation networks thereof has been carried out. Lignin is mainly formed by connecting 3 main woody alcohols such as coumaryl alcohol, coniferyl alcohol and sinapyl alcohol through different chemical bonds, the woody alcohols are hydroxylated or methylated phenylpropane derivatives with different degrees, structural units such as coumaryl alcohol residue (H), coniferyl alcohol residue (G) and sinapyl alcohol residue (S) are respectively formed in lignin molecules, and the different types of woody alcohols are subjected to oxidative polymerization by peroxidase, laccase and the like to respectively form macromolecular H-type lignin, G-type lignin and S-type lignin. Although the biosynthesis of lignin is not completely clear, it has been widely recognized through many years that it can be roughly divided into 3 steps: firstly, the synthesis process from assimilation products after photosynthesis of plants to aromatic amino phenylalanine, tyrosine, tryptophan and the like is called shikimic acid pathway; secondly, phenylalanine to Hydroxycinnamate (HCA) and its coa esters, known as the phenylpropane metabolic pathway; finally, the process from hydroxycinnamoyl coa esters to the synthesis of xylitol and its polymers is known as a specific pathway for lignin synthesis.

It has been demonstrated that in the phenylpropane metabolic pathway of lignin synthesis, there are a number of enzymes involved, such as phenylalanine-based lyase (PAL), cinnamic acid 4-hydroxylyase (C4H), coumaric acid 3-hydroxylase (C3H), etc., and that the enzymes in their specific pathway are mainly: coumaroyl-coa reductase (CCR) and Cinnamyl Alcohol Dehydrogenase (CAD).

Lignin biosynthesis is synergistically regulated by multiple families of transcription factors. A number of MYB-like transcription factors associated with lignin biosynthesis have been identified in arabidopsis: MYB46 is a direct target protein of SND1, and can directly regulate and control lignin pathways; MYB58, MYB63 and MYB85 are thought to be specific transcription factors for lignin biosynthesis, and their overexpression induces ectopic deposition of lignin. MYB58 and MYB63 are regulated by SND1 and its cognate proteins NST1, NST2, VND6, VND7 and downstream target protein MYB46, via SND 1-mediated transcriptional networks to the lignin biosynthetic pathway. PttMYB3Ra, pttMYB4a and PttMYB21a in poplar participate in the regulation of lignin synthesis pathway. Wherein, pttMYB21a has higher expression level in the secondary cell wall forming region, and the CCoAOMT transcription level in the phloem of the transgenic poplar plant which antisense inhibits PttMYB21a expression is increased, which indicates that PttMYB21a is a transcription inhibitor of CCoAoMT; overexpression of poplar PtrMYB3 and PtrMYB20 activates cellulose, xylan and lignin biosynthesis.

The AP2/ERF gene family is a plant-specific transcription factor, contains one or two conserved AP2/ERF domains, can respond to drought, low temperature and high salt stresses by combining dehydration response elements DRE and CRT, and responds to stresses by combining with GCC-box and induction elements. The transcription factor is involved in a variety of biological processes including plant growth, flower development, fruit development, seed development, biotic/abiotic stress responses, and the like.

The present inventors have studied to find that: the lignin content of poplar PagERF81 mutant plants is obviously increased, and further research shows that: in the mutant, a plurality of lignin synthesis key enzyme genes are obviously up-regulated for expression, pagERF81 can be directly combined with a cinnamoyl-CoA Reductase (CCR) promoter to inhibit the expression of the mutant, and the research result has important significance for lignin modified poplar genetic engineering breeding.

Disclosure of Invention

The invention aims to provide a gene PagERF81 capable of regulating and controlling the synthesis of poplar lignin, and a poplar mutant plant is obtained by utilizing gene editing so as to improve the content of the poplar lignin, thereby providing a technical means for cultivating or screening excellent tree species and laying a foundation for exploring the molecular mechanism of lignin biosynthesis.

In order to solve the technical problems, the invention adopts the following technical scheme:

the invention is based on analysis and research on poplar Ethylene Response Factor (ERF) family members, and identifies a dominant expression gene PagERF81 capable of regulating and controlling poplar lignin synthesis, and the nucleotide sequence and the amino acid sequence of a coding region are respectively shown as SEQ ID NO.3 and SEQ ID NO. 4. PagERF81 CDS is 966bp in length, encoding 321 amino acids and 1 stop codon.

And (3) designing an sgRNA primer by utilizing a conserved sequence, constructing a CRISPR/Cas9 vector of the PagERF81 gene, and transforming poplar to obtain the PagERF81 knockout plant.

In the course of the specific study, populus alba×P.glandulosa was transformed with the above vector by Agrobacterium-mediated transformation to obtain PagERF81 knockout plants (# 3, # 4).

Phenotype and microscopic morphology observation of the different transgenic lines shows that the PagERF81 knockout line has increased duct cell number, reduced duct cell area and obviously increased lignin content.

The research results prove that PagERF81 has a key regulation and control effect on poplar lignin synthesis, and has important application value in molecular breeding of woods and breeding of good varieties.

The beneficial effects are that:

compared with the prior art, the invention takes the silver gland poplar 84k as a material, screens and identifies the PagERF81 gene, and the phenotype identification based on the PagERF81 gene knockout plant shows that the PagERF81 gene can regulate and control the poplar lignin synthesis, which indicates that the PagERF81 gene is a key regulator for regulating and controlling the development of the poplar xylem, provides a new choice for a regulation and control means of lignin synthesis, and has important application value in the field of forest genetic engineering.

The invention is further illustrated by the following detailed description and the accompanying drawings, which are not meant to limit the scope of the invention.

Drawings

FIG. 1 is a diagram showing analysis of tissue expression characteristics of the PagERF81 gene of poplar in example 1 of the present invention.

FIG. 2 shows the results of testing erf81#3 and erf81#4 knockout transgenic plants in example 1 of the present invention.

FIG. 3 shows, from left to right, the overall phenotype of a wild 84K poplar in example 1 of the present invention, the overall phenotype of a PagERF81 knockout transgenic poplar erf81#3 in example 1 of the present invention, and the overall phenotype of a PagERF81 knockout transgenic poplar erf81#4 in example 1 of the present invention, respectively.

FIG. 4-1 is a section of the xylem tissue of a wild-type 84K poplar in example 1 of the present invention.

FIG. 4-2 is a graph of tissue sections of the xylem of transgenic poplar erf81#3 with PagERF81 knockdown in example 1 of the present invention.

FIGS. 4-3 are tissue sections of the xylem of transgenic poplar erf81#4 with PagERF81 gene knockout in example 1 of the present invention.

FIG. 5 is a table showing the statistics of plant height and diameter of transgenic poplar obtained by knocking out the wild 84K poplar and PagERF81 gene in example 1 of the present invention.

FIG. 6-1 shows the xylem vessels (top-down) of a wild 84K poplar with PagERF81 gene knocked-out in example 1 of the present invention.

FIG. 6-2 is a graph of quantitative analysis and statistics of xylem vessels of wild 84K poplar and PagERF81 knocked-out transgenic poplar in example 1 of the present invention.

FIG. 7-1 is a graph of the xylem area of a wild-type 84K poplar in example 1 of the present invention.

FIG. 7-2 is a graph of the xylem vessel area of a transgenic poplar erf81#3 with PagERF81 knockdown in example 1 of the invention.

FIGS. 7-3 are graphs of xylem vessel areas of transgenic poplar erf81#4 with PagERF81 knockdown in example 1 of the invention.

FIGS. 7-4 are graphs of analysis and statistics of xylem vessel area of wild 84K poplar and PagERF81 knocked-out transgenic poplar in example 1 of the present invention.

FIG. 8-1 is a graph showing the lignin stain content of wild-type 84K poplar in example 1 of the present invention.

FIG. 8-2 is a statistical plot of the lignin stain content of the PagERF81 knockout transgenic poplar erf81#3 of example 1 of the present invention.

FIG. 8-3 is a statistical plot of the lignin stain content of the PagERF81 knockout transgenic poplar erf81#4 of example 1 of the present invention.

FIGS. 8-4 are statistical graphs of the lignin stain content of wild 84K poplar and PagERF81 knock-out transgenic poplar in example 1 of the present invention.

Detailed Description

The invention will be further illustrated with reference to specific examples, which are not described in detail below, by reference to molecular cloning, and the use of the relevant kit.

Unless otherwise indicated, all reagents referred to in the examples below are commercially available conventional reagents and methods used are those commonly used in the art.

Example 1:

1. tissue expression analysis of poplar PagERF81 gene

1. Cloning of the Poplar PagERF81 Gene

Extracting 84K poplar total RNA by using silver gland poplar 84K (P.alba X P.glandulosa) as a material and using a RNeasy Plant Mini kit and an RNase-free DNase I kit (Qiagen, hilden, germany); 2.0 μg of RNA was taken per sample and full-length amplification of the gene was performed by synthesizing the first strand of cDNA using SuperScript III first-strand synthesis system (Life Technologies, carlsbad, calif., USA), referencing published populus genome sequences, using Primer3 software to design primers (amplicon contains start and stop codons).

Wherein, pagERF81 ORF forward primer PagERF81-CDS-F is shown in SEQ ID NO.1 (Table 1) in the sequence table, and reverse primer PagERF81-CDS-R is shown in SEQ ID NO.2 (Table 2).

TABLE 1

Name of the name	Sequence 1 (SEQ ID NO. 1)
		PagERF81-CDS-F	ATGCTGATCTACAACCCCAA

TABLE 2

Name of the name	Sequence 2 (SEQ ID NO. 2)
		PagERF81-CDS-R	TTAGCAAATGCCCTCCACCA

The PCR reaction system is as follows: taKaRa high-fidelity amplification enzyme mixture PrimeSTAR 12.5. Mu.l, forward primer PagERF81-CDS-F (10. Mu.M) 1. Mu.l, reverse primer PagERF81-CDS-R (10. Mu.M) 1. Mu.l, template (84K poplar cDNA) 1. Mu.l, sterile ddH ₂ O is added to 25 mu l;

the reaction procedure: pre-denaturation at 98℃for 5min;98 ℃ for 30s;56 ℃ for 30s;72 ℃,3min,10 cycles; 98 ℃ for 30s;60 ℃ for 30s;72 ℃,3min,25 cycles; 72 ℃ for 10min; finally, the full-length cDNA sequence of the obtained gene is 966bp, named PagERF81 gene, the sequence is shown in a sequence table SEQ ID NO.3 (table 3), and the compiled expression protein sequence is shown in a sequence table SEQ ID NO.4 (table 4).

TABLE 3 Table 3

TABLE 4 Table 4

2. Analysis of tissue expression Properties

Plant material was obtained from individual internodes of 84K Yang Yesheng plants grown in the greenhouse for 2 months, including shoots (shoots), a mixture of 2 nd and 3 rd internodes, 4 th, 6 th, 8 th, 10 th, 12 th internodes.

Each sample contains three biological repeats, all plant materials are frozen by liquid nitrogen and then stored in a refrigerator at the temperature of minus 80 ℃ for standby, RNA of the sample is extracted, cDNA is synthesized by reverse transcription, poplar ACTIN is taken as an internal reference gene, the tissue expression characteristics of PagERF81 genes are analyzed by semi-quantitative PCR, and amplification primers are PagERF81-RT-F (SEQ ID NO.5, table 5) and PagERF81-RT-R (SEQ ID NO.6, table 6).

TABLE 5

Name of the name	Sequence 5 (SEQ ID NO. 5)
		PagERF81-RT-F	AACGTCTGTTCTTCGATGCG

TABLE 6

Name of the name	Sequence 6 (SEQ ID NO. 6)
		PagERF81-RT-R	AACCCAAAAGCGTCAACGTC

The semi-quantitative PCR reaction system is as follows: taKaRa high-fidelity amplification enzyme mixture PrimeSTAR 12.5. Mu.l, forward primer PagERF81-RT-F (10. Mu.M) 1. Mu.l, reverse primer PagERF81-RT-R (10. Mu.M) 1. Mu.l, template (84K poplar cDNA) 1. Mu.l, sterile ddH ₂ O is added to 25 mu l;

the reaction procedure: pre-denaturation at 98℃for 5min;98 ℃ for 30s;56 ℃ for 30s;72 ℃,3min,10 cycles; 98 ℃ for 30s;60 ℃ for 30s;72 ℃,3min,25 cycles; 72 ℃ for 10min; pagERF81-RT-F (SEQ ID NO.5, table 5) and PagERF81-RT-R (SEQ ID NO.6, table 6).

FIG. 1 is a diagram showing the analysis of tissue expression characteristics of the PagERF81 gene of poplar in example 1 of the present invention; it was found by semi-quantitative PCR analysis that PagERF81 expression increased in mature tissues, while secondary cell walls accumulated predominantly in mature tissues, and thus PagERF81 might be involved in wood formation.

2. Construction of PagERF81 Gene knockout vector

(1) Primer design: designing a full-length genome primer according to the genome sequence of the PagERF81 of the populus tomentosa from a source of the genome sequence of the PagERF81 of the populus tomentosa, cloning the genome sequence of the PagERF81 of the populus tomentosa by taking the genome DNA of the populus tomentosa as a template, selecting a 20bp random nucleotide sequence (PAM) at a position without SNP (Single Nucleotide Polymorphism ) site as a target sequence, and synthesizing a target primer sequence AtU dT1F (SEQ ID NO. 7) (table 7) and AtU dT1R (SEQ ID NO. 8) (table 8) and AtU6-1T1F (SEQ ID NO. 9) and AtU6-29T1R (SEQ ID NO. 10);

TABLE 7

Name of the name	Sequence 7 (SEQ ID NO. 7)
		AtU3dT1F	gtcaAGCAGCAGCATCCTTCTTCA

TABLE 8

Name of the name	Sequence 8 (SEQ ID NO. 8)
		AtU3dT1R	aaacTGAAGAAGGATGCTGCTGCT

TABLE 9

Name of the name	Sequence 9 (SEQ ID NO. 9)
		AtU6-1T1F	gtcaTGAAATAAGATTGCTAGAGC

Table 10

Name of the name	Sequence 10 (SEQ ID NO. 10)
		AtU6-1T1R	aaacGCTCTAGCAATCTTATTTCA

(2) Preparation of target sequence linker: diluting the target sequence primer into 1 mu M mother solution by using TE Buffer solution or double distilled water, taking 10 mu L of each of the upstream and downstream target sequence primers, uniformly mixing, carrying out denaturation at 90 ℃ for 30s, and then moving to room temperature, and gradually cooling and annealing to form double chains;

(3) Preparation of 1 XBsaI cleavage ligation reaction solution (10. Mu.l System) in 10. Mu.l System:

the reaction was performed for 5 cycles using a PCR apparatus: 37 ℃ for 5min;20 ℃ for 5min; obtaining an enzyme cutting connection product;

(4) Amplifying the gRNA expression cassette by adopting 2 rounds of PCR amplification to obtain a more stable specific target product and avoid amplification of an idle product;

1) In the first round of PCR amplification, two PCR reactions were performed for the forward target sequence and the reverse complementary target sequence, and 1. Mu.l of the cleavage ligation product obtained in step (3) was used as a template, and PCR reactions were performed using the primers shown in Table 7, table 8, table 9 and Table 10, wherein the primer concentrations were 10. Mu.M:

the reaction conditions of both reaction 1 and reaction 2 are: 95 ℃ for 15sec;60 ℃ for 15sec;72 ℃,15sec; the cycle number is 25-28 cycles, 5 μl of PCR product is taken, and 2% agarose gel electrophoresis detection is carried out; and 1. Mu.l of each of the PCR products of reaction 1 and reaction 2 was taken and subjected to ddH ₂ After 10-fold dilution of O, 2. Mu.l was aspirated therefrom as a template for the second round of PCR reaction;

TABLE 11

Name of the name	Sequence 11 (SEQ ID NO. 11)
		U-F	CTCCGTTTTACCTGTGGAATCG

2) Second round PCR reaction (50. Mu.l system):

the reaction conditions are the same as those of the first round of PCR reaction, 5 mu l of the obtained PCR product is subjected to electrophoresis detection, and the remaining 45 mu l is purified and recovered by using a Takara purification kit for the next enzyme digestion and ligation reaction;

table 12

TABLE 13

Name of the name	Sequence 13 (SEQ ID NO. 13)
		BL	AGCGTGGGTCTCGACCGACGCGTCCATCCACTCCAAGCTC

(5) pYLCRISPR/Cas9-DH final vector cleavage ligation (15. Mu.l System):

the reaction conditions are as follows: enzyme cutting at 37 ℃ for 2min; and (3) carrying out variable-temperature cyclic enzyme digestion and connection for 10-15 cycles: 10 ℃ for 3min;20 ℃ for 5min; finally, enzyme cutting is carried out for 2min at 37 ℃; obtaining enzyme cutting connection reaction liquid;

(6) Sucking the enzyme-cleaved ligation reaction solution in the step (5), and performing escherichia coli competent cell transformation to obtain a pYLCRISPR/Cas9-DH vector plasmid containing the ligation target sequence;

3. genetic transformation and detection of PagERF81 gene

Genetic transformation of PagERF81 Gene

The constructed gene knockout vector (containing pYLCRISPR/Cas9-DH connected with a target sequence) is transferred into agrobacterium GV3101 by an electric shock method, and is transferred into poplar by agrobacterium-mediated genetic transformation, and the transformation steps are as follows: 84K poplar tissue culture seedlings for genetic transformation are cultured under conditions that the culture temperature is 23-25 ℃, the light irradiation is 16/8h (day/night) and the light intensity is 50 mu M m-2s-1, agrobacterium containing the target expression vector infects leaves when the OD600 = 0.6-0.8, the infected leaves are placed on adventitious bud induction medium (SIM, murashige-Skoog (MS) minimal medium added with 0.5 mg/L6-benzyl aminopurine (6-benzyl aminopurine) (6-BA) and 0.05mg/L naphthalene acetic acid (naphthaleneacetic acid) (NAA)) and co-cultured for 3 days under dark conditions that the temperature is 22+ -2 ℃, transferring the leaves after co-culture to SIM containing 3mg/L hygromycin (hygromycin B) and 200mg/L Timentin (Timentin), inducing and screening resistant adventitious buds under the conditions that the culture temperature is 23-25 ℃, the illumination is 16/8h (day/night) and the illumination intensity is 50 mu M m-2s < -1 >, transferring the resistant adventitious buds to rooting culture medium (RIM, 1/2MS minimal medium is added with 0.05mg/L IBA and 0.02mg/L NAA) containing 3mg/L hygromycin (hygromycin B) and 200mg/L Timentin after 30 days of induction culture, extracting the leaf DNA of the rooted plant for PCR verification;

CRISPR-Cas9 mediated PagERF81 Gene editing mutant plant identification

Designing mutant plant hygromycin detection primers 9-C9-F300 (SEQ ID NO.14, table 14) and 9-C9-R300 (SEQ ID NO.15, table 15); extracting transgenic plant DNA as a template, carrying out PCR amplification by using high-fidelity enzyme (Baoli doctor, prime STAR Max DNA polymerase), connecting the obtained PCR product to a T vector (Aidelai zero background pTOPO-TA/Blunt general cloning kit, aidelai, beijing) and converting the obtained PCR product into competent cells of coliform bacteria, carrying out PCR identification to obtain positive clones, sequencing the positive clones by a sequencing company, and selecting more than 30 monoclone to carry out sequence comparison analysis, wherein the sequencing result is shown in figure 2, and is the detection result of erf81#3 and erf81#4 knockout transgenic plants in the embodiment 1 of the invention, and the sequencing result shows that 1 base (sequence in Table 16) is replaced by knockout (sequence in Table 17) on two chromosomes of the strain;

TABLE 14

Name of the name	Sequence 14 (SEQ ID NO. 14)
		9-C9-F300	AAGACCAATGCGGAGCATATACG

TABLE 15

Name of the name	Sequence 15 (SEQ ID NO. 15)
		9-C9-R300	AAGGAATCGGTCAATACACTACATGG

Table 16

TABLE 17

4. Phenotypic observation of PagERF81 transgenic plants

Simultaneously planting PagERF81 mutant plants and wild type 84K poplar in a greenhouse, repeating biologically for three times, and carrying out phenotype measurement and photographing on plants in different batches respectively, wherein the phenotype of the wild type 84K poplar in the embodiment 1 of the invention, the phenotype of the transgenic poplar erf81#3 obtained by knocking out PagERF81 in the embodiment 1 of the invention and the phenotype of the transgenic poplar erf81#4 obtained by knocking out PagERF81 in the embodiment 1 of the invention are respectively from left to right as shown in FIG. 3; as shown in FIG. 4-1, a section of the xylem tissue of a wild 84K poplar in example 1 of the present invention is shown; 4-2, a tissue slice of the xylem of a transgenic poplar erf81#3 with PagERF81 knocked out in example 1 of the present invention; 4-3, are tissue sections of the xylem of transgenic poplar erf81#4 with PagERF81 knocked-out in example 1 of the present invention; the phenotype photograph after 4 months of transplanting is shown, and compared with non-transgenic 84K Yang Zhizhu, the overall plant height of the mutant plant is not changed significantly; as shown in fig. 5, which is a table of statistics of plant heights and ground diameters of transgenic poplar knocked out by wild type 84K poplar and PagERF81 in example 1 of the present invention, the wild type 84K poplar and the transgenic poplar knocked out were analyzed for a slice of ground stems, and the overall ground diameters of the mutant plants were not significantly changed compared with those of non-transgenic 84K Yang Zhizhu;

5. PagERF81 transgenic xylem section observations

1. Taking stem sections 5cm above the ground of a greenhouse cultivated poplar with a size of 4 months, fixing the stem sections in a slicing groove of an oscillation slicer Leica VT1200S through LOCTITE 495 glue, cutting the stem sections into cross section slices with a thickness of 50 mu m, and storing the slices in 70% alcohol;

2. histochemical staining and photographic observation analysis: fresh sections were stained with 0.05% TBO for 1min, washed three times with water to remove flooding and excess staining solution, covered with coverslips, and TBO-stained sections were observed using an Olympus BX51 plain light microscope and photographed to analyze changes in morphology of stem section cross-sections, as shown in FIGS. 6-1, 6-2, 7-1, 7-2, 7-3, and 7-4: FIG. 6-1 shows the xylem vessels (top-down) of a wild 84K poplar with PagERF81 gene knocked out in example 1 of the present invention; FIG. 6-2 is a graph showing quantitative analysis and statistics of xylem vessels of wild 84K poplar and PagERF81 knocked-out transgenic poplar in example 1 of the present invention; as shown in FIG. 7-1, a graph of the area of the xylem vessels of a wild 84K poplar in example 1 of the present invention is shown; 7-2, is a graph of the xylem vessel area of the transgenic poplar erf81#3 with PagERF81 knocked out in example 1 of the present invention; 7-3, are graphs of xylem vessel areas of transgenic poplar erf81#4 with PagERF81 knockdown in example 1 of the present invention; 7-4 are graphs of analysis and statistics of xylem vessel areas of wild 84K poplar and PagERF81 knocked-out transgenic poplar in example 1 of the present invention; the PagERF81 mutant plants had increased numbers of vessel cells in the xylem region, while decreased vessel area compared to 84K Yang Duizhao; counting the number of ducts of the erf81#3 and erf81#4 plants, it was found that the duct area was increased by 13.79% and 10.62%, respectively, while the duct area was decreased by 14.30% and 19.29%; these results demonstrate that the PagERF81 gene affects secondary xylem development;

6. PagERF81 transgenic lignin content analysis

1. Taking a stem section 5cm above the ground of a soil culture Miao Yangshu with a size of 4 months, fixing the stem section in a slicing groove of an oscillation slicer Leica VT1200S through LOCTITE 495 glue, cutting into a cross section slice with a thickness of 50 mu m, and storing the slice in 70% alcohol; after the fresh sections were subjected to phloroglucinol staining, the intensity of pink reaction with lignin was observed, and the results are shown in fig. 8-1 to 8-3: FIG. 8-1 is a graph showing the lignin stain content of wild-type 84K poplar in example 1 of the present invention; FIG. 8-2 is a statistical chart of the lignin stain content of the PagERF81 knockout transgenic poplar erf81#3 of example 1 of the present invention; FIG. 8-3 is a statistical chart of the lignin stain content of the PagERF81 knockout transgenic poplar erf81#4 of example 1 of the present invention; sections of the erf81#3 and erf81#4 knockout plants produced a stronger color response compared to the wild type, indicating that more lignin was produced in the knockout plants.

2. The stem segments 2cm above the ground of the earth culture Miao Yangshu with the size of 4 months are taken, the stem segments are preserved by using liquid nitrogen, crushed into powder by a tissue crusher, dried for 48 hours in an 80-DEG C oven, and the lignin content in the stem segments is measured by using a lignin content kit of Suzhou Ming Biotechnology Co., ltd. And the result is shown in figures 8-4, which are statistical graphs of the lignin content of transgenic poplar with wild 84K poplar and PagERF81 knocked out genes in the embodiment 1 of the invention, wherein the lignin content is increased by 54.32% and 46.26% in two gene knocked out strains respectively.

Phenotype and lignin content analysis of the different transgenic lines show that the PagERF81 knockout line has no obvious change in the whole plant height and ground diameter; basal stem section observations found that more, but smaller area, ductal cells were produced in the PagERF81 knockout line woody part; lignin content analysis results indicate that the PagERF81 knockout line produced more lignin. The research results prove that PagERF81 has negative regulation and control effects on the development of poplar xylem and can obviously inhibit lignin synthesis. The PagERF81 knockout line with stable heredity has important application value in molecular breeding of forest trees and breeding of good varieties.

While the foregoing is a detailed description of the inventive concepts and embodiments, it will be appreciated by those skilled in the art that various modifications and changes may be made thereto without departing from the scope of the invention as set forth in the appended claims.

Claims (3)

1. Knock-outPagERF81Use of genes to promote increased lignin content in poplar, saidPagERF81The nucleotide sequence and the amino acid sequence of the coding region of the gene are respectively shown as SEQ ID NO.3 and SEQ ID NO. 4.

2. The knockout of claim 1PagERF81The application of the gene in promoting the increase of the lignin content of poplar is characterized in that: the saidPagERF81The CDS of the gene is 966bp in total length.

3. The knockout of claim 1PagERF81The application of the gene in promoting the increase of the lignin content of poplar is characterized in that: the saidPagERF81The CDS of the gene encodes 321 amino acids and 1 stop codon.