LU505178B1 - Ark1 gene of 84k populus l. and application thereof in hybrid populus l. - Google Patents

Ark1 gene of 84k populus l. and application thereof in hybrid populus l. Download PDF

Info

Publication number
LU505178B1
LU505178B1 LU505178A LU505178A LU505178B1 LU 505178 B1 LU505178 B1 LU 505178B1 LU 505178 A LU505178 A LU 505178A LU 505178 A LU505178 A LU 505178A LU 505178 B1 LU505178 B1 LU 505178B1
Authority
LU
Luxembourg
Prior art keywords
populus
gene
hybrid
ark1
transgenic
Prior art date
Application number
LU505178A
Other languages
German (de)
Inventor
Hanyao Zhang
Xiaozhen Liu
Original Assignee
Univ Southwest Forestry
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Univ Southwest Forestry filed Critical Univ Southwest Forestry
Priority to LU505178A priority Critical patent/LU505178B1/en
Application granted granted Critical
Publication of LU505178B1 publication Critical patent/LU505178B1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/10—Processes for modifying non-agronomic quality output traits, e.g. for industrial processing; Value added, non-agronomic traits
    • A01H1/101—Processes for modifying non-agronomic quality output traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine or caffeine
    • A01H1/109—Processes for modifying non-agronomic quality output traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine or caffeine involving lignin biosynthesis
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H5/00—Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy
    • A01H5/04—Stems
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H6/00—Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Botany (AREA)
  • Environmental Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Developmental Biology & Embryology (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Physiology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention belongs to the technical field of forestry breeding, in particular to an ARK1 gene of 84K Populus L. and application thereof in hybrid Populus L. In the present invention, a new vector is constructed from the ARK1 gene of 84K Populus L, and a ‘717’ hybrid Populus L. with the ARK1 gene is cultivated, and the auxin-related radicals promote plant growth due to upregulation expression; at the same time, the downregulation of lignin synthesis-related genes leads to the decrease of lignin content and improves industrial utilization value.

Description

ARK1 GENE OF 84K POPULUS L. AND APPLICATION THEREOF IN HUS05T78
HYBRID POPULUS L.
TECHNICAL FIELD
The invention belongs to the technical field of forestry breeding, and in particular, to a transgenic breeding method of hybrid Populus L.
BACKGROUND
Populus L. is a deciduous woody plant belonging to Dicots of Angiosperms,
Salicaceae and Populus. Populus L. grows rapidly, has wide adaptability and strong flexibility and is widely used in ecological protection, urban greening, industry and fiber production. Populus L. has many characteristics, such as wide distribution, rapid growth, high yield, strong environmental adaptability and easy improvement, and its whole-genome sequencing has been completed, making it an ideal model plant for forest genetic breeding and improvement. All Populus L. species have the ability of asexual reproduction. Populus L. is a natural host of Agrobacterium tumefaciens, which is convenient for the genetic transformation of plants by Agrobacterium tumefaciens. Therefore, Populus L. is considered one of the model plants for forest genetic engineering research, and Populus L. and its hybrids are considered the first choice perennial plants for bioenergy raw material production. Populus L. is the fastest growing tree species in temperate regions and has many agronomic characteristics and species advantages. At present, the biomass growth rate is close to 10-15 kg/hm” per year. Biomass can be stored in roots and germinated and regenerated by irrigation, which can minimize the investment in storage facilities; compared with other fiber crops, Populus L. has a shorter cultivation and harvesting cycle, which is very beneficial to the net effect of greenhouse gas emissions.
Populus tremulaxP. alba’ INRA 717-1B4' is an excellent variety selected from the hybrid population of Populus davidiana and Populus alba, which has strong stress tolerance and great application value for vegetation restoration, soil erosion prevention and saline-alkali land restoration and can also be used for biomass energy and fiber energy development. Hybrid Populus L. ‘717’ is a perennial plant. 1005178
Compared with Panicum miliaceum, such as Oryza sativa and Arabidopsis thaliana, hybrid Populus L. ‘717’ has unique advantages in studying wood formation and seasonal dormancy, and its regulatory mechanism is more complicated during the evolution process. Therefore, it 1s particularly important to analyze the gene function of hybrid Populus L. “717.
SUMMARY
The invention discloses an ARK1 gene of 84K Populus L., and the nucleotide sequence of the ARK1 gene is shown in SEQ. ID. NO. 1
The ARK1 gene of 84K Populus L. was used to cultivate a ‘717’ hybrid Populus
L. with the ARK1 gene.
The application of the ARK1 gene of 84K Populus L. lies in constructing the transgenic vector of the ARK] gene (from 84K Populus L.) and obtaining the ‘717’
Populus L. plant with the ARK/ gene through transgene. The transgenic hybrid
Populus L. of the present study had significant differences in node spacing, stem diameter, petiole length, leaf width, leaf length and seedling height, and there were differences in plant growth and development and lignin regulation-related genes. The
ARK1 gene of 84K Populus L. is involved in the growth process of plants, and it is an important growth-related gene that has broad application prospects in crop germplasm improvement, genetics and breeding.
In the present study, a new vector was constructed from the ARK1 gene of 84K
Populus L., a ‘717’ hybrid Populus L. with the ARK1 gene was cultivated, and auxin-related genes were upregulated, which promoted plant growth; at the same time, the downregulation of lignin synthesis-related genes led to a decrease in lignin content and improved industrial utilization value.
BRIEF DESCRIPTION OF THE FIGURES
Fig. 1 is a PCR detection diagram, in which M is the D2000 marker; CK is a
PCR product using the DNA of non-transgenic ‘717’ hybrid Populus L. as a template;
and 1-11 are PCR products using the DNA of different plants of transgenic ‘717 1005178 hybrid Populus L. as templates.
Fig. 2 is the morphological diagram of non-transgenic ‘717’ hybrid Populus L. and transgenic ‘717’ Populus L. with the ARK1 gene, A: non-transgenic ‘717’ hybrid
Populus L.; B and C: the ‘717’ hybrid Populus L. transformed with the ARK1 gene;
Fig. 3 shows the microscopic observation of cells A and B, which are non-transgenic ‘717’ hybrid Populus L.; C, D, transgenic ‘717’ hybrid Populus L. with the ARK1 gene;
Fig. 4 shows the difference in gene expression.
DESCRIPTION OF THE INVENTION
S1, Design and synthesis of primers 1) Amplification primer of target gene
Primer ARBF, sequence
S'-ogagaggacacgctgagatgggegetetetetgg-3', length 37 bp, sequence as shown in SEQ. ID. NO. 2
Primer ARBR, sequence 5'- ATCCTTGTTAGTCGAATTCAAGCAGTGGGGAGATGTC-3', length 39 bp, sequence as shown in SEQ. ID. NO. 3. 2) Target gene amplification and gel recovery were performed, and the target gene band was recovered by using a Batek gel recovery kit. 3) Linking the target gene with PART-CAM-FLAG to construct a vector.
The PART-CAM-FLAG gene construction scheme was as follows: 1) Digestion of plasmid PART-CAM-FLAG with Xhol and EcoRI and recovery of large fragments;
LU5051 78 double enzyme digestion reaction system:
Reaction system Application amount 10xTango buffer 4.0 ul enzymatic digestion at 37°C for 2.5 h; inactivation at 65°C for 20 min. 2) Cloning the target gene with upstream and downstream primers, digesting
PCR products with Xhol and EcoRI, and recovering small fragments; 3) Recombining and connecting the fragments obtained in 1) and 2) with recombinant ligase and transforming them into DHSa competent cells; colony PCR detection; and 4) Sequencing and verifying positive colonies to obtain the successfully constructed vector and related strains.
Because some vectors will be linked with the foreign gene ARK1, some will not be linked with the foreign gene, some will be in a linear state, and some will be in a circular state, only vectors containing foreign genes and in a circular state are effective and can be amplified in Escherichia coli, so it is necessary to select positive clones. The constructed vector is easily amplified in Æ. coli, and it is easy to screen the circular vector containing the foreign gene ARK 1. Populus L. cannot be infected by Populus euphratica, and only Agrobacterium tumefaciens can infect Populus L.
Therefore, it is necessary to screen the Æ. coli containing the vector of the ARK1 gene, amplify it to a sufficient amount, isolate it, and transform it into Agrobacterium tumefaciens to carry out the next infection.
S2, Transforming Agrobacterium tumefaciens with the vector.
Plasmids were extracted from DHS5a containing the ARK1 gene vector, and HUS05T78
Agrobacterium tumefaciens strain LBA4404 was transformed. Positive strains were selected by PCR amplification and used for impregnation in the next step.
S3, Transgenesis and detection of hybrid Populus L. 5 1) Establishment of a tissue culture system of the ‘717’ hybrid Populus L.
The explants were treated with 75% alcohol for 15 s and 0.1% mercuric chloride for 10 min for disinfection. In callus induction, the medium used was MS+1.0 mg/L6-BA+1.2 mg/l NAA. The formula for adventitious bud differentiation was
MS+1.0 mg/l6-BA+0.4 mg/l ZT. The rooting formula of seedlings was 1/2 MS+0.02 mg/L NAA+0.6 mg/L IBA. 2) Constructing the genetic transformation system of ‘717’ hybrid Populus L. leaves.
Based on establishing the tissue culture system of ‘717’ hybrid Populus L. leaves, the selection pressure of Kan concentration in ‘717’ hybrid Populus L. leaves was 100 mg/L, and the optimal inhibitory concentration of carbenicillin was 200 mg/L. When the concentration of the bacterial solution was 0.3 and the soaking time was 10 min, the transformation effect of hybrid Populus L. leaves by Agrobacterium was the best, and the transformation method was the leaf disc method, comprising the following steps: a) Infection
On an ultraclean workbench, the precultured ‘717’ hybrid Populus L. leaves were removed from the culture bottle, soaked in the bacterial liquid that was activated in the early stage for some time, and then the ‘717’ hybrid Populus L. explants were removed and placed on sterile paper to absorb the attached bacterial liquid. b) Coculture inoculating agrobacterium-infected ‘717’ hybrid Populus L. leaves on callus induction medium (MS+NAA 1.0 mg/L+6-BA 1.0 mg/L), culturing in the dark at 28°C for 2 - 4 days, and observing Agrobacterium-induced plaque around the leaves; c) Selective culture washing the cocultured callus with sterile water approximately 3 times, HUS05T78 absorbing the water with sterile paper, and then transferring to sterile differentiation medium (MS+10 mg/L 6-BA+04 mg/L ZT) with selective pressure (carbenicillin+Kan) for selective culture at 16/8 h and 28°C; d) Subculture selective culture approximately 28 days later, changing the selection medium once to induce its differentiation, new callus and bud; e) Rooting culture
When the adventitious buds grew to 2 - 3 cm, the adventitious buds were transferred to rooting medium (1/2 MS+0.02 mg/L NAA+0.6 mg/L IBA) containing selective pressure (carbenicillintKan) for rooting culture; after the plants grew adventitious roots, the plants were transferred to a greenhouse for seedling training. 3) Molecular detection of transgenic plants
According to the constructed expression vector, the corresponding specific detection primers were designed. The upstream primer was the sequence inside the gene of ARK 1, and the downstream primer adopted the sequence in the vector NPT II.
The sequences of the primers were as follows:
The sequence of forward 5’-AAGATCCAGCCCTTGACCAA-3’ is as follows:
The sequence of reverse 5’-CATTGCCATCACCACAACCA-3’ is as follows:
Using the above primers, PCR was carried out according to the following system. “717 hybrid Populus L. DNA 2.0 ul
Upstream primer 1.5ul
Downstream primer 1.5 ul
Primer STAR Max DNA Polymerase 10.0 ul
Dd H0 5.0 ul
After adding the above components, the liquid was collected to the bottom of the HUS05T78 tube by short centrifugation, and PCR was carried out by using Prime STAR Max
Premix DNA polymerase from Takara Company.
The PCR amplification procedure was as follows: 98°C, 3 min; 35 cycles; 94°C, 30 s, 55°C, 30 s; 72°C, 5 min; and 72°C, 10 min.
Then, PCR was carried out, and the PCR steps were consistent with colony PCR.
Then, the PCR products were detected by 1.2% agarose gel (0.5 pg/mol ethidium bromide) electrophoresis.
The DNA of leaves of the ‘717’ hybrid Populus L. transformed with the ARK 1 gene was extracted and detected by PCR. The positive rate was 31.43%, which preliminarily proved that the genetic transformation of the ‘717’ hybrid Populus L. with the ARK gene was successful (as shown in Fig. 1). 4) Detection of morphological changes in transgenic plants
The morphological differences between transgenic and non-transgenic plants of the ‘717’ hybrid Populus L. were compared and measured.
The thickness of stem segments, the number of internodes and the length of internodes in the same growth cycle were repeated 3 times in each group.
The results showed that there were significant differences in internode spacing, stem diameter, petiole length, leaf width, leaf length and seedling height between transgenic ‘717’ hybrid Populus L. seedlings and non-transgenic seedlings.
Transgenic ‘717’ hybrid Populus L. seedlings have long and thin stems, usually bunchy and multibranched, without long and thin petioles and long and thin leaves, and some leaves are not fully developed (as shown in Fig. 2). 5) Paraffin section and microstructure observation a) Material selection: quickly cut the stem segment under the fifth leaf of the ‘717° hybrid Populus L, which is approximately 3 - 5 mm long, and immediately immersed in FAA fixed solution (50.0% alcohol, 5.0% acetic acid, 3.7% formaldehyde and 41.3% water); b) Fixation: fixing in FAA fixed solution at room temperature for more than 24 h;
c) Dehydration: washing with distilled water; then, carrying out gradient HUS05T78 dehydration with the mixed solution of tert-butyl alcohol and alcohol, where the sequence is 70%-85%-95%-100%-100% and each step is 2 h; pumping air for 45 minx8, dewatering step by step to 100% tert-butanol, and dewatering with 100% tert-butanol for 3 h, and repeating 3 times; d) Wax dipping: melted paraffin was added to the sample of the ‘717’ hybrid
Populus L., and the sample was placed in an incubator at 65°C for more than 24 h; e) Embedding: The paraffin melted at 65°C was poured into a 3 cmx3 cm paper box, and when the paraffin was slightly solidified and the bottom was white, the ‘717’ hybrid Populus L. material was inserted vertically into the paraffin, the bubbles were removed with a dissecting needle, the sample was allowed to stand until the paraffin block solidified, and the sample was placed in an ice box at 5°C for later use. f) Slicing: trimming the wax block and sticking it on the wood block, slicing with a slicer with a thickness of 8 um, sticking the slice on the glass slide with a dipping tablet, and letting the glass slide stay overnight in a 45°C incubator, or air drying the glass slide at room temperature; g) Dewaxing: after slicing is dried, xylene — xylene —1/2 xylene +1/2 alcohol — twice 100% alcohol — 95% alcohol — 95% alcohol — 70% alcohol — 50% alcohol — distilled water for 1 min; h) Staining: hematoxylin for 10 min, 50% alcohol — 70% alcohol — 85% alcohol — 95% alcohol — 70% alcohol — twice 100% alcohol —1/2 xylene+50% alcohol — twice xylene 1) Microscopic examination: the film was sealed, and the section was observed under a microscope.
The results showed that the number of xylem and phloem cells in the stems of transgenic ‘717’ hybrid Populus L. seedlings decreased and that the cell diameter decreased compared with that of non-transgenic seedlings (as shown in Fig. 3). 4. Transcriptome sequencing
The mRNA of transgenic ‘717’ hybrid Populus L. and non-transgenic ‘717’ hybrid Populus L. samples was extracted and reverse transcribed into cDNA, and the cDNA of transgenic ‘717’ hybrid Populus L. and non-transgenic ‘717’ hybrid Populus 1005178
L. samples was analyzed by HiSeq, including sequencing data filtering, GO function analysis and pathway function analysis, and the related differentially expressed genes were screened and analyzed.
The results showed that 45.8 GB of clean reads were obtained after the original data were filtered by quality control, and redundant sequences and low-quality reads were removed. Among them, the base percentage of Q30 was 91.85% and above, and the average GC content in the four samples was 47.69%, which indicated that the sequencing quality was good and met the requirements of database construction. At the same time, after the sequence alignment of the sequenced clean reads with the
Populus L. reference genome, the alignment efficiency ranged from 55.61% to 60.61%, and approximately 57.53% of the sequences could be annotated by the reference genome. Among them, the alignment rate of clean reads with the unique alignment position of the reference sequence was 56.61%. Among the genes in the differentially expressed gene set, 641 differentially expressed genes were screened out, including 389 upregulated genes and 252 downregulated genes (as shown in Fig. 4).
By analyzing the genes that are significantly differentially expressed in the regulation and pathway of cell tip growth and meristem growth, plant hormone signal transduction and the phenylpropanoid biosynthesis pathway, the invention screened 27 differentially expressed genes involved in Populus L. growth, including proteins, transcription factors and protein kinases, which are related to plant growth and lignin regulation. In transgenic plants, the expression of plant growth-related genes is mostly upregulated, which means that the growth-related genes are upregulated in the transgenic Populus L. ‘717’, indicating that the ARK1 gene has a positive regulatory effect on plant growth; enzymes related to lignin synthesis in the phenylpropane pathway, such as P-hydroxyphenyl lignin, guaiacyl lignin, 5-hydroxyguaiacyl lignin, syringyl lignin, p-coumaric acid and A (p-coumaroyl-CoA). Moreover, the phenotype of the plant shows abnormal growth in height and diameter.
Lignin is one of the three main chemical components of wood (lignin, cellulose and hemicellulose) and has important biological functions in plants. Lignin restricts the development of the paper industry due to environmental pollution and the need for HUS05T78 a large amount of wood production energy. The reduction in lignin content in trees can not only improve the economic and environmental benefits of the pulp and paper industry but also promote the decomposition of lignocellulose and improve the conversion efficiency of sugar.
In summary, this transgenic research can improve the growth rate of Populus L. and its value in the paper industry.
The study is supported by the Yunnan Academician (expert) Workstation Project (202305AF 150020), Agricultural Joint key projects in Yunnan Province (202301BD070001-003).

Claims (2)

CLAIMS LU5051 78
1. An ARK1 gene of 84k Populus L., wherein the nucleotide sequence of the ARK1 gene is shown in SEQ. ID. NO. 1.
2. An application of the ARK1 gene of 84K Populus L. according to claim 1, wherein ‘717’ hybrid Populus L. with the ARK1 gene is cultivated.
LU505178A 2023-09-27 2023-09-27 Ark1 gene of 84k populus l. and application thereof in hybrid populus l. LU505178B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
LU505178A LU505178B1 (en) 2023-09-27 2023-09-27 Ark1 gene of 84k populus l. and application thereof in hybrid populus l.

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
LU505178A LU505178B1 (en) 2023-09-27 2023-09-27 Ark1 gene of 84k populus l. and application thereof in hybrid populus l.

Publications (1)

Publication Number Publication Date
LU505178B1 true LU505178B1 (en) 2024-03-27

Family

ID=90526799

Family Applications (1)

Application Number Title Priority Date Filing Date
LU505178A LU505178B1 (en) 2023-09-27 2023-09-27 Ark1 gene of 84k populus l. and application thereof in hybrid populus l.

Country Status (1)

Country Link
LU (1) LU505178B1 (en)

Similar Documents

Publication Publication Date Title
Zhang et al. SHALLOT-LIKE1 is a KANADI transcription factor that modulates rice leaf rolling by regulating leaf abaxial cell development
CN109384837B (en) Poplar drought-resistant gene and application thereof
CN109609514B (en) Pear transcription factor PbrMYB169 and application thereof
CN107058317B (en) Pollen specific promoter and application thereof
CN116064572B (en) MdWOX11 gene and protein for promoting adventitious root development and application thereof
LU505178B1 (en) Ark1 gene of 84k populus l. and application thereof in hybrid populus l.
CN106854652B (en) Poplar PtCYP85A3 gene and application thereof
CN115976050A (en) Kiwi fruit infectious disease gene and applicable VIGS silencing system construction
CN116083445A (en) CrBZR1 gene and application thereof
CN108484742B (en) Du pear cold-resistant transcription factor PbrMYB5 and application thereof
CN101503703A (en) Use of cotton steroids 5 alpha-reductase gene and expression vector including the same
CN103898134A (en) Application of CDS sequence of oryza sativa transcription factor Os05g25910 gene
CN114250232B (en) Application of Paeonia lactiflora PLTOE3 gene in high temperature resistance of plants
CN116731139B (en) Application of PtoERF15 gene of populus tomentosa in regulation and control of drought resistance of poplar
CN115838738B (en) Paeonia ostii PoWRKY71 gene and application thereof in drought tolerance of plants
CN114507666B (en) Soybean-derived root-specific promoter pro-GmPRlike and application thereof
CN110527688A (en) 84K poplar ARK1 gene and its utilization in Hybrid Poplar
CN118207252A (en) Application and method of knock-out populus tomentosa PtoTCP gene in improving lodging resistance of plants
CN117736286A (en) Pdecambp-1 proteins associated with plant organogenesis and biomass and uses thereof
CN117736285A (en) Application of poplar calmodulin binding protein PdecaMBP in regulation of plant organ formation and biomass
CN118308409A (en) Application of corn ZmC3H7 gene in negative regulation of drought resistance of corn
CN116253785A (en) Separated negative regulation drought-resistant grape MYB transcription factor VviMYB30 and application thereof
CN118345091A (en) Gene PagERF for regulating and controlling development of poplar leaves and stems and application thereof
CN117757832A (en) Application of cotton GhLSM1B gene in improving callus proliferation rate of cotton tissue culture
CN116622722A (en) Limonium bicolor gene LbSAD2 and application thereof

Legal Events

Date Code Title Description
FG Patent granted

Effective date: 20240327