CN116253785A - Separated negative regulation drought-resistant grape MYB transcription factor VviMYB30 and application thereof - Google Patents

Abstract

The invention discloses a separated negative regulation drought-resistant grape MYB transcription factor VviMYB30 and application thereof. The application relates to the field of genetic engineering, in particular to the field of drought-resistant breeding of grapes. The VviMYB30 is separated from the non-drought-tolerant European grape 'Cabernet Sauvignon', and the VviMYB30 transcription factor in the 'Cabernet Sauvignon' grape is knocked out by using a CRISPR/Cas9 gene editing technology, so that a drought-resistant gene editing grape plant is obtained, and the drought resistance of the grape is improved.

Description

Separated negative regulation drought-resistant grape MYB transcription factor VviMYB30 and application thereof

Technical Field

The invention belongs to the technical field of plant response adversity gene identification and genetic engineering, in particular to separation and identification of a grape MYB transcription factor responding to drought stress, and more particularly relates to a drought-resistant negative regulation MYB transcription factor VviMYB30 separated from European grape 'Cabernet Sauvignon' and application thereof in drought resistance of grapes.

Background

The drought resistance and the water utilization efficiency of the grape are improved, and the cultivation of new germplasm of the drought-resistant grape has wide development prospect. However, the grape has long growth cycle and complex genetic background, the traditional crossbreeding has limitation on drought-resistant grape variety breeding, modern molecular breeding, especially the birth of gene editing technology, and provides a high-efficiency and feasible means for accurate drought-resistant grape breeding. Therefore, the method for excavating the drought-resistant gene of the grape self-negative regulation and control and accurately editing the gene by utilizing the CRISPR/Cas9 gene editing technology is an important way for fundamentally improving the drought resistance of the grape self-negative regulation and control drought-resistant gene of the grape.

MYB transcription factors are the most numerous and functionally diverse families of transcription factors in plants, widely involved in plant morphogenesis and secondary metabolism, regulating plant responses to biotic and abiotic stresses. The N-terminal of MYB transcription factors all contain a DNA binding domain-MYB domain which is well-structured and highly conserved. In plants, this domain typically consists of 1-4 incompletely repeated amino acid sequences, each of which contains about 52 amino acids, forming 3 alpha helices. Wherein the second and third helices form a helix-turn-helix (HTH) structure. Each MYB region contains 3 conserved tryptophan residues (typically 18 or 19 amino acids apart) that form a hydrophobic core in the three-dimensional HTH structure. The third helix of each repeat is a "recognition helix" which binds tightly to a particular DNA sequence. Unlike N-terminal DNA binding domain, the activation or inhibition domain and disordered sequence in the C-terminal are rich in change, so that the DNA binding domain can bind with other different proteins and play important roles in plant growth and development and different adverse stress response processes.

CRISPR/Cas9 gene editing technology recognizes specific positions in a genome through artificially designed sgRNA and guides Cas9 protein to cut double-stranded DNA sequences of the specific positions, mismatch phenomena of insertion or deletion of bases easily occur in the repair process of broken double-stranded DNA, and the target gene function is lost or changed. Due to the lack of the European grape drought-resistant gene, the CRISPR/Cas9 is used for directionally editing the gene for negative regulation drought resistance, so that the excellent properties of the European grape variety can be maintained, the drought resistance of the grape can be improved, and the drought-resistant breeding process of the grape can be accelerated.

So far, little research is done on the regulation of drought stress by grape MYB transcription factors, and more recent reports on the negative regulation of drought-resistant MYB transcription factors of grapes are available. The MYB transcription factor VviMYB30 significantly induced in PEG (6000) simulated drought treatment was screened from european grape 'cabernet' herein. The CRISPR/Cas9 gene editing system is utilized to knock out the VviMYB30 gene of Cabernet Sauvignon, so that the drought resistance of the grape is remarkably improved, gene resources and molecular markers are provided for the drought resistance precise molecular breeding of the grape, and the method has important theoretical value and practical significance.

Disclosure of Invention

The application separates the MYB transcription factor gene VviMYB30 obtained from the first large brewing grape variety Cabernet Sauvignon', proves that the MYB transcription factor gene plays a negative regulation function in drought resistance of the grape, and also relates to application of the VviMYB30 in drought resistance of the grape.

In one embodiment, the isolated negative drought-resistant grape MYB transcription factor gene VviMYB30 of the present application has the nucleotide sequence as set forth in SEQ ID NO: 1:

one aspect of the present patent application relates to an isolated drought-resistant negative-control MYB transcription factor encoded by an isolated drought-resistant negative-control MYB transcription factor VviMYB30 described herein, said VviMYB30 having the amino acid sequence shown in SEQ ID NO. 15.

One aspect of the patent application relates to the application of the separated negative regulation drought-resistant grape MYB transcription factor gene VviMYB30 in creating drought-resistant gene editing grape varieties.

One aspect of the present patent application relates to a method for producing drought-resistant gene-editing grape plants, which is characterized in that the isolated negative drought-resistant-control grape MYB transcription factor VviMYB30 gene is edited and stably knocked out or knocked down in grape.

Accordingly, one aspect of the present patent application also relates to a method for improving drought resistance of grape plants, which is characterized in that the isolated negative drought-resistant regulation grape MYB transcription factor VviMYB30 gene is knocked out in grape.

The invention provides a real-time fluorescence quantitative PCR detection primer of a grape MYB transcription factor VviMYB30 of Cabernet sauvignon and a primer of an internal reference gene VviActin7, wherein the primer sequences are as follows:

VviMYB30-qF：5’GCCTTCATGGACACACAGTGGATCA3’(SEQ ID NO:2)

VviMYB30-qR：5’ATCATCGCCAAGGTAAGGCATCCC 3’(SEQ ID NO:3)

VviActin7-qF：5’CTATCCTTCGTCTTGACCTTGCTG 3’(SEQ ID NO:4)

VviActin7-qR：5’AGTGGTGAACATGTAACCCCTCTC 3’(SEQ ID NO:5)

and (3) respectively detecting the expression condition of the VviMYB30 gene on different tissue parts of the grape of Cabernet Sauvignon, and simulating drought treatment by using PEG (6000). The result shows that the expression amount of the VviMYB30 gene is highest in roots, and the VviMYB30 gene is induced to express by PEG (6000) treatment.

The invention constructs a 35S VviMYB30-GFP plant expression vector for the first time, and introduces the vector into tobacco mesophyll cells by an agrobacterium-mediated transformation method to study the subcellular localization of the VviMYB30 protein. The results indicate that GFP-tagged VviMYB30 full-length protein can co-localize with mCherry-tagged nuclear retention protein AtHY 5.

The invention creates a Cabernet Sauvignon MYB transcription factor VviMYB30 gene editing strain. Through PCR detection and sange sequencing, the VviMYB30 gene is confirmed to be stably edited, so that translation is terminated in advance. After the gene-edited grape strain and the non-gene-edited grape strain of the same age are transplanted to a phytotron for 3 months, drought treatment is carried out on the grape strain, and the plant growth vigor is observed to find that the VviMYB30 gene-edited plant shows a drought-resistant phenotype compared with a wild type, and leaves wither less slowly. The content of Malondialdehyde (MDA) and Peroxidase (POD) which are metabolic products of grape leaf cell membrane damage are measured, and the fact that the content of malondialdehyde is obviously reduced under drought stress in a VviMYB30 gene editing plant compared with a wild type is found, and the POD enzyme activity is obviously increased is shown that after the VviMYB30 gene is knocked out, damage of grape cell membranes caused by drought is slowed down, peroxide decomposition is accelerated, and the grape has stronger tolerance to drought.

The invention has the beneficial effects that:

(1) The invention obtains the isolated negative regulation drought-resistant grape MYB transcription factor VviMYB30 from European grape 'Cabernet Sauvignon' through cloning technology. The CRISPR/Cas9 is utilized to edit the VviMYB30 in European grape 'Cabernet Sauvignon', and the responses of the VviMYB30 edited plant and a control grape plant (wild 'Cabernet Sauvignon') to drought stress are compared, and the physiological index detection proves that the VviMYB30 gene edited plant has higher tolerance to the drought stress, the MDA content of the VviMYB30 gene is reduced under the drought stress, and the POD enzyme activity is increased, so that the VviMYB30 gene is a negative regulation factor for drought resistance of the grape, and the drought resistance of the cultivated grape can be improved by knocking out the VviMYB30 gene.

(2) The drought-resistant negative regulation transcription factor VviMYB30 gene can improve the drought-resistant genetic character of the grape and improve the tolerance of the cultivated grape variety to drought stress.

Drawings

FIG. 1 is a pattern of expression of VviMYB30 in different tissues of grape. The growth condition of grape roots, stems and leaves of Cabernet Sauvignon is shown on the left side; the right panel is the relative expression levels of VviMYB30 in different tissue sites. The analysis uses VviActin7 as an internal reference gene. The mean and standard deviation were from three biological replicates and three technical replicates. * Represents a very significant difference compared to the wild type (Student's t-test, < P0.01)

FIG. 2 is a pattern of expression of the VviMYB30 gene under conditions of PEG (6000) simulated drought treatment. PEG (6000) treatment concentrations and various sampling time points are noted. The analysis uses VviActin7 as an internal reference gene. The mean and standard deviation were from three biological replicates and three technical replicates. * Represents a very significant difference compared to the wild type (Student's t-test, < P0.01)

FIG. 3 is subcellular localization of the full-length protein of VviMYB30 in tobacco mesophyll cells. AtHY5 labeled by mCherry belongs to nuclear resident proteins.

FIG. 4 is the sange sequencing result and translated protein of the VviMYB30 gene editing grape line. (a) Grape transgene positive detection, P represents positive control with pKSE401 vector as template. (b) The VviMYB30 gene edit detection sequencing peak map, arrow indicates edit site. (c) editing the plant growth phenotype. (d) Nucleotide translation protein results after editing of the VviMYB30 gene.

FIG. 5 is an analysis of drought resistance of a VviMYB30 gene editing grape strain. (a) Wild Type (WT) and gene editing grape line growth after normal watering and drought treatment for 0d,14d and 21 d. (b) Malondialdehyde content of plant leaves after conventional watering and drought treatment. (c) POD enzyme activity of plant leaves after conventional watering and drought treatment. * Represents a very significant difference (Student's t-test, < 0.01) compared to the wild type.

Detailed Description

The invention is described in further detail below with reference to examples and figures:

example 1: cloning and expression analysis of grape MYB transcription factor VviMYB30 of' Cabernet Sauvignon

Extracting total RNA of roots, stems and leaves of grape of Cabernet Sauvignon' respectively by adopting a OMEGA Plant RNA Kit kit according to the specification of the kit. Using Northey Corp

1st Strand cDNA Synthesis Kit reverse transcription kit RNA reverse transcription was performed to synthesize first strand cDNA, with reference to kit instructions. Downloading cDNA sequence of MYB transcription factor XM_002274170 identified in NCBI published in the genome of Nibinuo grape, designing specific primer and upstream primer by using Vector NTI software: vviMYB30-F:5'ATGCCACAAGCTATGCAGTTCGG 3' (SEQ ID NO: 6), downstream primer: vviMYB30-R:5'CTAAGAAGAGCTTCCAACACCAAGAAC 3' (SEQ ID NO: 7) with cDNA of the 'Cabernet Sauvignon' root as template, with high-fidelity DNA polymerase from Noruzan Corp->

The PCR amplification is carried out by Max Super-Fidelity DNA Polymerase, and the specific amplification system is as follows: 1. Mu.L of DNA Polymerase, 25. Mu.L of 2X Phanta Max buffer, 1.0. Mu.L of dNTP, 1.0. Mu.L of cDNA template, 1.5. Mu.L of LVvMYB 30-F, 1.5. Mu.L of VviMYB30-R, 19. Mu.L of ddH ₂ O. The PCR amplification procedure was: the pre-denaturation at 95℃for 3min, the cycle parameters were 15s denaturation at 95 ℃, 15s annealing at 57℃and 1min extension at 72℃for 30s, 34 cycles were performed and the extension at 72℃was sufficient for 10min. The PCR reaction products were electrophoretically detected in 1% agarose gel. Cutting a single target band, recovering the single target band by using an OMEGA gel recovery kit, connecting the single target band to a cloning vector pMD19-T, constructing a pMD19T-VviMYB30 plasmid, transforming competent cells of escherichia coli, identifying the PCR as positive cloning, and carrying out Beijing qingke sequencing verification, wherein the nucleotide sequence and the deduced amino acid sequence are shown in a sequence table. Analyzing the cloned VviMYB30 gene sequence, wherein the full length 951bp of the gene coding sequence codes 316 amino acids.

The inventor adopts a real-time fluorescence quantitative PCR technology to detect the expression condition of the VviMYB30 gene after simulating drought treatment of different tissues of Cabernet Sauvignon' and PEG (6000) with different concentrations.

Tissue specific expression sampling is shown in figure 1, after transplanting 'Cabernet Sauvignon' tissue culture seedlings into Hogeland nutrient solution for water culture for 30d, collecting roots, stems, leaves and liquid nitrogen, and rapidly freezing and extracting RNA.

PEG (6000) simulates drought treatment: transplanting Cabernet Sauvignon tissue culture seedlings into Hogeland nutrient solution, performing water culture for 45d, adding 15% and 20% PEG (6000) into the nutrient solution to simulate drought, collecting roots and leaves of the treated plants after 0, 3, 6, 9, 12, 24 and 36h, and rapidly freezing with liquid nitrogen to extract RNA.

The following real-time fluorescent quantitative PCR detection primers are designed according to the VviMYB30 gene sequence:

VviMYB30-qF：5’GCCTTCATGGACACACAGTGGATCA3’(SEQ ID NO:2)

VviMYB30-qR：5’ATCATCGCCAAGGTAAGGCATCCC 3’(SEQ ID NO:3)

VviActin7-qF：5’CTATCCTTCGTCTTGACCTTGCTG 3’(SEQ ID NO:4)

VviActin7-qR：5’AGTGGTGAACATGTAACCCCTCTC 3’(SEQ ID NO:5)

and (3) performing RT-qPCR test on a Bio-Rad IQ5 real-time fluorescent quantitative PCR instrument by using a Dining real-time fluorescent quantitative PCR kit. The reaction system is as follows: 2X Fast Qpcr Master Mixture. Mu.L, cDNA template 0.4. Mu.L, forward-primer 0.4. Mu.L, reverse-primer 0.4. Mu.L, ddH ₂ O8.8. Mu.L. PCR amplification procedure: pre-denaturation at 94℃for 2min,40 cycles (94℃for 15s,58℃for 30 s). After the PCR cycle, the temperature was kept at 50℃for 1min, and then the melting curve analysis was performed at a gradual increase of 0.5℃every 10 seconds. The relative expression levels of the genes were analyzed using IQ5 software standardized expression methods. Each treatment was performed in 3 biological replicates and 3 technical replicates, respectively.

The result shows that the VviMYB30 gene is highly expressed in roots, then the stem is the stem, and the expression level is lower in leaves. After 24 and 36h of PEG (6000) treatment, vviMYB30 strongly induced up-regulated expression in grape roots. However, there was no apparent trend in leaf, and these results indicate that VviMYB30 might be involved in grape root response to drought stress.

Example 2: subcellular localization analysis of the 'Cabernet Sauvignon' grape MYB transcription factor VviMYB30

Gene specific primers with XbaI and KpnI cleavage sites were designed, the upstream primer: vviMYB30-2300-F:5' ACGGGGGACGAGCTCGGTACCATGCCACAAGCTATGCAGTTCGG 3' (SEQ ID NO: 8), downstream primer: vviMYB30-2300-R:5' CACCATGGTGTCGACTCTAGAAGAAGAGCTTCCAACACCAAGA3' (SEQ ID NO: 9) (underlined font indicates the cleavage site), and the coding sequence of VviMYB30 was amplified using pMD19T-VviMYB30 plasmid as template, and a one-step directed cloning kit (seamless cloning) of Norfirazan (ClonExpress II One Step Cloning Kit) was used to construct a fusion over-expression vector 35S: vviMYB30-GFP by ligating it to a plant over-expression vector pCAMBIA2300 containing a GFP tag at an appropriate molar ratio by homologous recombination reaction. The constructed vector is transformed into escherichia coli competence, and then the extracted plasmid is transferred into agrobacterium GV3101 competence through a freeze thawing method. Strains that detected positive were grown in LB liquid medium at 28 ℃ to od600=0.8-1.0. Then, the bacterial liquid 5500Centrifuging at rpm/min for 10min, precipitating, removing supernatant, and adding 2% MgCl containing 100 μm acetosyringone ₂ Resuspension the bacterial liquid, standing for 3h, and adjusting the OD600 of the bacterial liquid to 0.6-0.8. The bacterial liquid is injected into transgenic tobacco leaves of AtHY5-mCherry for stable transformation 35S by an injection infiltration method, wherein AtHY5 is nuclear resident protein. Laser confocal microscopy (LEICATCS SP, germany) was used to observe whether GFP-tagged VviMYB30 co-localized with mCherry-tagged ath 5 nuclear resident protein. The results indicate that VviMYB30 is localized to the nucleus (fig. 3).

Example 3: obtaining and identifying of 'Cabernet Sauvignon' MYB transcription factor VviMYB30 gene editing strain

Target position CCCATCATCGCTGCTACCGCCGG of NGG-containing VviMYB30 was designed using CRISPR-GE software, target primer containing Bsa i cleavage site was designed from target sequence, upstream primer: vviMYB30-CRISPR-F:5'ATTGCCCATCATCGCTGCTACCGC 3' (SEQ ID NO: 10), downstream primer: vviMYB 30-CRISPR-R5'AAACGCGGTAGCAGCGATGATGGG 3' (SEQ ID NO: 11). The primers were diluted to 100. Mu.M, 10. Mu.L of each was mixed, annealed at 65℃for 5min, and after two minutes at 25℃3. Mu.L of the annealed product was ligated with T4 ligase to the BsaI digested pKSE401 vector. The correctly sequenced plasmids were transformed into Agrobacterium and PCR-positive Agrobacterium was cultured for 14-16h at 28℃with 50ml LB liquid medium. Centrifuging at 5500rpm/min for 5min, removing supernatant in a super clean bench, adding equal volume of 1/2MS solution containing 100 μm acetosyringone for resuspension, culturing at 180rpm/min at 28deg.C for 1-2 hr, and diluting to OD in the super clean bench ₆₀₀ =0.6-0.8. Placing the receptor material 'Cabernet Sauvignon' primordium into a centrifuge tube filled with an aggressive dye liquor, and lightly shaking the centrifuge tube to enable the bacterial liquor to be fully contacted with the primordium. The infected primordial mass tissue is placed on sterile filter paper to suck out excess agrobacterium. Then, the mixture was placed in a sterile glass dish containing two layers of filter paper (moistened with 1/2MS liquid medium supplemented with 100. Mu.M AS) and co-cultured at 25℃under dark conditions for 48 hours. After 3 times of rinsing the co-cultured proembryogenic mass with sterile water, the proembryogenic mass was degerminated with MS medium added with 200mg/L of cephalosporin (Cef) and 200mg/L of carbenicillin (Carb) for 15min, and finally rinsed with sterile water for 5 times. The degerming primordium is placed on sterile filter paper to suck the superfluousAfter 3 weeks of delayed selection culture of the proembryogenic mass on KCC medium (KBN+200 mg/L Carb+200mg/L Cef), embryogenic calli were transferred to X3KCC medium (X3+200 mg/L Carb+200mg/L Cef+75mg/L Kan) and cultured in the dark at 26℃for resistance selection, once every 4 weeks until resistant somatic embryos develop. After the resistant embryo grows to the later stage of cotyledon, inoculating the resistant embryo on a GM culture medium (MS+15 g/L sucrose+1 g/L active carbon+3 g/L plant gel), culturing under light until true leaves grow out, and inoculating the resistant embryo on a rooting culture medium (MS+1 mg/L IBA+30g/L sucrose+7 g/L agar) to form seedlings. After the resistant plants are semi-lignified, the hardening seedlings are transplanted into sterile nutrient soil.

To examine whether the lines of the seedlings after resistance screening were transgenic positive lines, genomic DNA of the resistant plants was extracted by CTAB method: taking 0.05g of blade, grinding with liquid nitrogen, adding 300 mu L of CTAB buffer solution, placing in a 65 ℃ oven for 30min, shaking and mixing uniformly every 10min, taking out, placing to room temperature, adding 300 mu L of nucleic acid extracting solution (chloroform: isoamyl alcohol=24:1), centrifuging at 12000rpm/min for 10min after fully mixing uniformly, absorbing about 200 mu L of supernatant, adding diploid precooled absolute ethyl alcohol, precipitating at-20 ℃ for 30min, centrifuging at 12000rpm/min for 10min, pouring out absolute ethyl alcohol, and naturally drying. Add 20. Mu.L distilled water to dissolve. The universal primer (upstream U6-26-F:5'TGTCCCAGGATTAGAATGATTAGGC 3' (SEQ ID NO: 12) and downstream U6-26-R:5'CCCCAGAAATTGAACGCCGAAGAAC 3' (SEQ ID NO: 13)) was designed using the nucleotide sequence on the pKSE401 vector sequence for positive identification of transgenes against the plants. All of the 3 Kan-resistant strains obtained as shown in FIG. 4 (a) can amplify the target band.

In order to test whether the VviMYB30 gene in the PCR positive strain is edited or not, a detection primer is designed around 200bp before and after a VviMYB30 target point: vviMYB30-F:5'ATGCCACAAGCTATGCAGTTCGG 3' (SEQ ID NO: 6), vviMYB30-T-Rseq:5'GGGTTTGTGTTGGAGTCATTAGGAT 3' (SEQ ID NO: 14), fragments containing the target site were amplified from transgenic positive line leaf DNA using a Noruzan high fidelity enzyme, followed by sequencing in the Beijing engine sequencing department and translation of the sequencing result into amino acid sequences. The results showed that all of the 3 Kan-resistant strain VviMYB30 genes were edited, resulting in premature termination of amino acid translation after editing of the VviMYB30 strain (fig. 4). Under conventional management, the growth condition of the VviMYB30 gene editing plant is consistent with that of a wild type, and the growth and development of a grape plant are not affected after the surface VviMYB30 is knocked out.

Example 4: drought resistance identification of grape VviMYB30 gene editing plant of Cabernet Sauvignon

After the VviMYB30 gene edited grape strain and the same-age 'Cabernet Sauvignon' grape strain are transplanted to a phytotron for 3 months, drought treatment is carried out on the grape strain and the plant wilting condition is observed in treatments of 0d,14d and 21d respectively. And sampling and detecting POD activity and MDA content. As a result, it was found that after 21d drought treatment, wild-type plants significantly dehydrate wilting, whereas the VviMYB30 gene-edited strain did not have significant wilting. The MDA content and POD enzyme activity of the metabolic product of damaged grape leaf cell membranes are measured, the content of malondialdehyde in the VviMYB30 gene editing plant under drought stress is found to be obviously reduced compared with that of a wild type, and the POD enzyme activity is obviously increased, so that after the VviMYB30 gene is knocked out, damage of grape cell membranes caused by drought is slowed down, peroxide decomposition is accelerated, and the grape has stronger tolerance to drought.

Reference to the literature

Wan,D.Y.,Guo,Y.,Cheng,Y.,Hu,Y.,Xiao,S.,Wang,Y.,Wen,Y.Q.(2020).CRISPR/Cas9-mediated

mutagenesis of VvMLO3 results in enhanced resistance to powdery mildew in grapevine(Vitis

vinifera).Horticulture research,7,116.

Dubos,C.,Stracke,R.,Grotewold,E.,Weisshaar,B.,Martin,C.,Lepiniec,L.(2010).MYB transcriptionfactors in Arabidopsis.Trends in Plant Science,15,573-581.

Xie,X.R.,Ma,X.L.,Zhu,Q.L.,Zeng,D.C.,Li,G.S.,Liu,Y.G.(2017).CRISPR-GE:a convenient

software toolkit for CRISPR-based genome editing.Molecular Plant,9,1246-1249.

Xing,H.L.,Dong,L.,Wang,Z.P.,Zhang,H.Y.,Han,C.Y.,Liu,B.,Wang,X.C.,Chen,Q.J.(2014).A

CRISPR/Cas9 toolkit for multiplex genome editing in plants.BMC Plant Biology,14,327.

Claims (5)

1. The isolated negative regulation drought-resistant grape MYB transcription factor gene VviMYB30 has a nucleotide sequence shown in SEQ ID NO. 1.

A MYB transcription factor encoded by the isolated negative drought-resistant grape MYB transcription factor gene VviMYB30 of claim 1, said MYB transcription factor having the amino acid sequence shown in SEQ ID No. 13.

3. The use of the isolated negative control drought-resistant grape MYB transcription factor gene VviMYB30 of claim 1 in creating drought-resistant grape varieties.

4. A method of producing a drought-resistant grape plant characterized by stably knocking out the isolated negative drought-resistant regulated grape MYB transcription factor gene VviMYB30 of claim 1 in a grape plant.

5. A method for improving drought resistance of grape plants, which is characterized in that the isolated negative drought-resistant regulation grape MYB transcription factor gene VviMYB30 of claim 1 is knocked out in grape plants.

Images