CN117025627A

CN117025627A - Tobacco chloride channel protein NtCLC13, and coding gene and application thereof

Info

Publication number: CN117025627A
Application number: CN202310785468.5A
Authority: CN
Inventors: 张慧; 徐国云; 刘萍萍; 翟妞; 郑庆霞; 金立锋; 周会娜
Original assignee: Zhengzhou Tobacco Research Institute of CNTC
Current assignee: Zhengzhou Tobacco Research Institute of CNTC
Priority date: 2023-06-29
Filing date: 2023-06-29
Publication date: 2023-11-10

Abstract

The invention discloses tobacco chloride channel protein NtCLC13, and a coding gene and application thereof, and belongs to the technical field of plant genetic engineering. The coding gene NtCLC13 of the tobacco chloride channel protein NtCLC13 is obtained through cloning, and subcellular localization analysis is utilized to find that the tobacco chloride channel protein NtCLC13 is localized in cytoplasm. And transferring the constructed gene editing vector into a tobacco plant by using a CRISPR/Cas9 technology through an agrobacterium transformation method, and successfully constructing the NtCLC13 gene knockout tobacco plant. The chloridion content of the leaves of the knocked-out plant is obviously reduced, which makes it possible to cultivate new varieties of low-chlorine tobacco, and provides a new direction for improving the condition of higher chloridion content of flue-cured tobacco in partial tobacco areas in China. Meanwhile, the gene network for regulating and controlling chloride ions in tobacco is enriched, and the method has important significance for regulating and controlling the content of the chloride ions in the tobacco and further understanding the molecular regulation and control of chloride ion transport.

Description

Tobacco chloride channel protein NtCLC13, and coding gene and application thereof

Technical Field

The invention relates to tobacco chloride channel protein NtCLC13, and a coding gene and application thereof, and belongs to the technical field of plant genetic engineering.

Background

The existing researches generally show that the chloride ion content in the tobacco leaves is preferably 0.3-0.8, the smoldering fire-holding performance can be influenced when the content reaches 1%, and the black ash flameout phenomenon can occur when the content is higher than 1%; on the other hand, when the content of chloride ions in tobacco leaves is too high, the starch is accumulated more, the leaves are thick and brittle, and the moisture absorption is high, so that the color is easy to deepen during storage, and bad smell is generated. In summary, the chloride ion content in tobacco has a relatively important direct impact on the quality of tobacco. At present, the content of chloride ions in tobacco leaves in partial tobacco areas such as Henan and Yunnan is higher, the quality and the yield of the tobacco leaves are reduced, and the problems which need to be solved by growers and researchers are solved.

The traditional improvement method starts from a cultivation technology, and the quality of tobacco leaves is stabilized and improved by optimizing field management measures and perfecting a modulation fermentation technology. However, in general, these measures have not fundamentally changed the situation that the quality of the tobacco leaves is low and the industrial applicability is not strong.

With the rapid development of genomics, especially gene editing technology, the relationship between chloride ion accumulation in tobacco leaves and related genes is becoming more and more well known. Based on the prior studies it is already known that: for the Chloride Channel protein (CLC) family, 7 members of arabidopsis have been studied to show that AtCLCa plays a key role in driving nitrate into vacuoles, whereas AtCLCb does not; other AtCLCs are distributed in other cell intervals, and AtCLCd and AtCLCf can play an acidification role in transferring the Golgi vesicle network; atCLCe may be involved in the anion permeability of thylakoid membranes; atCLCg is consistent with AtCLCc in function and participates in plant salt stress. An Anne Marmagne et al, when studying Arabidopsis CLCf found (Two members of the Arabidopsis CLC (chloride channel) family, atCLCe and AtCLCf, are associated with thylakoid and Golgi membranes, resectively, journal of Experimental Botany,2007, 58 (12): 3385-3393), that AtCLCf was localized on the Golgi membrane and functionally complemented with a mutant of yeast gef1 disrupted in the single CLC gene encoding a Golgi-related protein. However, in general, CLC family proteins function are not completely identical in different species due to their diversity. For tobacco variety improvement only, the in-depth research on the function of CLC family proteins in tobacco can lay a theoretical basis and an application basis for tobacco variety improvement and even other plant improvement. Therefore, the CLC family protein members and related functions thereof in the tobacco are excavated, and the method has important significance for regulating and controlling the content of chloride ions in the tobacco and further understanding the molecular regulation and control of chloride ion transport.

Disclosure of Invention

To solve the above problems, a first object of the present invention is to provide a tobacco chloride channel protein coding gene NtCLC13, which can code for tobacco chloride channel protein NtCLC13, thereby regulating and controlling chloride transport in tobacco.

The invention provides a tobacco chloride channel protein NtCLC13, and experiments prove that the NtCLC13 protein participates in absorption and transportation of chloride ions in tobacco, and the content of the chloride ions in the tobacco can be regulated and controlled by regulating and controlling the expression of the protein.

The third purpose of the invention is to provide the application of the tobacco chloride channel protein coding gene NtCLC13 gene in regulating and controlling the transport of tobacco chloride ions, and experiments prove that regulating and controlling the expression of the NtCLC13 gene can influence the content of the chloride ions in the tobacco, and enrich a gene network for regulating and controlling the chloride ions in the tobacco.

The fourth object of the invention is to provide the application of the tobacco chloridion channel protein coding gene NtCLC13 gene in obtaining low-chlorine tobacco varieties, and the CRISPR/Cas9 gene editing technology is used for knocking out the NtCLC13 gene in tobacco plants, so that the chloridion content in leaves of the knocked-out plant is obviously reduced, and the low-chlorine tobacco varieties are obtained.

In order to achieve the above purpose, the tobacco chloride channel protein coding gene NtCLC13 adopts the following technical scheme:

a tobacco chloride channel protein coding gene NtCLC13 gene, characterized in that: the nucleotide sequence is as follows:

(1) A nucleotide sequence shown as SEQ ID NO. 1;

(2) The nucleotide sequence shown in SEQ ID NO.1 is substituted and/or deleted and/or added with one or more nucleotides and expresses the nucleotide sequence of the same functional protein.

The beneficial effects of the technical scheme are that: according to the invention, a specific primer is designed, and the coding gene NtCLC13 of the tobacco chloridion channel protein is obtained through cloning, and the transfer of chloridion to the overground part is reduced by inhibiting the expression of the coding gene NtCLC13 in tobacco, so that the process of regulating and controlling the chloridion transfer in tobacco is shown by the NtCLC13 gene.

In order to achieve the above purpose, the technical scheme adopted by the tobacco chloride channel protein NtCLC13 is as follows:

a tobacco chloride channel protein NtCLC13, having the amino acid sequence:

(1) An amino acid sequence shown in SEQ ID NO. 2;

(2) The amino acid sequence shown in SEQ ID NO.2 is a derivative protein with identical functions and with one or more amino acid residues replaced and/or deleted and/or added.

The beneficial effects of the technical scheme are that: the NtCLC13 protein is encoded and expressed by the NtCLC13 gene, and the experiments prove that the tobacco chloride ion channel protein NtCLC13 is closely related to absorption and transportation of chloride ions in tobacco, the expression of the tobacco chloride ion channel protein NtCLC13 is inhibited, the capacity of transporting the chloride ions from roots to overground parts is reduced, and the content of the chloride ions in tobacco leaves is obviously reduced.

In order to achieve the above purpose, the technical scheme adopted by the application of the tobacco chloride channel protein coding gene NtCLC13 gene in regulating and controlling tobacco chloride transport is as follows:

the application of the tobacco chloride channel protein coding gene NtCLC13 in regulating and controlling the transport of tobacco chloride ions.

The beneficial effects of the technical scheme are that: according to the tobacco plant with the NtCLC13 gene knocked-out obtained by the CRISPR/Cas9 technology, the difference between the NtCLC13 gene knocked-out plant in a normal culture medium and a control group is small, after salt stress is added, the growth of the NtCLC13 gene knocked-out plant is obviously inhibited compared with the control group, the root length is shortened, and the fact that the NtCLC13 gene participates in tobacco salt stress response is shown.

As a further improvement, the expression of the NtCLC13 gene was inhibited, and the content of chloride ions in tobacco leaves was significantly reduced.

The beneficial effects of the technical scheme are that: further detection shows that the content of chloride ions in the leaves of the NtCLC13 gene knockout strain is remarkably reduced, which indicates that the capacity of inhibiting the expression of the NtCLC13 gene and transporting chloride ions from roots to aerial parts is reduced.

In order to achieve the above purpose, the technical scheme adopted by the application of the tobacco chloride channel protein coding gene NtCLC13 gene in obtaining low-chlorine tobacco varieties is as follows:

the application of the tobacco chloride channel protein coding gene NtCLC13 gene in obtaining low-chlorine tobacco varieties is that the expression of the NtCLC13 gene is inhibited, so that chloride ions in tobacco leaves are reduced, and the low-chlorine tobacco varieties are obtained.

The beneficial effects of the technical scheme are that: according to the invention, the NtCLC13 gene is knocked out in tobacco through a CRISPR/Cas9 technology, the expression of the NtCLC13 gene is inhibited, a tobacco plant with the NtCLC13 gene knocked out is obtained, and the detection shows that the chloride ion content in the leaf of the obtained NtCLC13 gene knocked out plant is obviously reduced, so that a good foundation can be laid for cultivating new varieties of tobacco with low chloride content, and meanwhile, a technical support is provided for the stability of tobacco quality and the improvement of cigarette quality.

As a further improvement, the expression of the NtCLC13 gene is inhibited by constructing a gene editing vector and knocking out the NtCLC13 gene of the tobacco chloride channel protein coding gene.

The beneficial effects of the technical scheme are that: compared with traditional gene interference and the like, the CRISPR/Cas9 technology has the advantages of high knockout efficiency and simple and convenient operation.

As a further improvement, the gene editing vector is obtained by the following method: and (3) connecting the double-stranded DNA of the target site to a gene editing empty vector, and sequencing and identifying.

As a further improvement, the target site double-stranded DNA corresponds to the sgRNA sequence: TCTCGGCGATAGTGCTCCAC.

The beneficial effects of the technical scheme are that: the sgRNA can be used for effectively knocking out the NtCLC13 gene in tobacco, so that a tobacco plant with the NtCLC13 gene knocked out is successfully constructed, and a foundation is laid for researching the function of the NtCLC13 gene.

As a further improvement, the low-chlorine tobacco variety is obtained by the following method: and (3) transforming agrobacterium tumefaciens serving as an invader solution by using the gene editing vector, transforming tobacco, and screening and identifying to obtain a tobacco variety with obviously reduced leaf chloride ion content.

Drawings

FIG. 1 is a subcellular localization of tobacco NtCLC13 protein in example 3 according to the present invention;

FIG. 2 is a schematic representation of target site selection for NtCLC13 gene knockout in example 3 of the present invention;

FIG. 3 shows the NtCLC13 gene T in example 3 of the present invention ₀ Sequencing result diagram of target site knocked out by the generation gene editing plant;

FIG. 4 shows the phenotype of the NtCLC13 gene-edited plant under salt stress in example 3 of the present invention;

fig. 5 is a graph of leaf chloride ion content of NtCLC13 gene-edited plants in example 3 of the present invention (representing p < 0.01).

Detailed Description

The present invention will be described in further detail with reference to specific examples. The equipment and reagents used in the examples, experimental examples and comparative examples were all commercially available, except for the specific descriptions.

Biological material:

tobacco variety: k326 and medium smoke 100, the seeds used were all supplied by the national tobacco gene research center.

And (3) a carrier: pCS1300 was given to wuhan-tian biotechnology limited; the CRISPR/Cas9 vector is provided by the national emphasis laboratory of silkworm genome biology at southwest university.

Strains: trans5 alpha chemically competent cells, purchased from Beijing full gold biotechnology Co., ltd; GV3101 Agrobacterium competent cells, purchased from Shanghai Biotechnology, inc.; primer synthesis and DNA sequencing were performed by Beijing Liuhua macrogene technologies Inc.

Experimental reagent: RNA extraction kit (RNAprep Pure polysaccharide polyphenol plant total RNA extraction kit), genome extraction kit (polysaccharide polyphenol plant genome DNA extraction kit) were purchased from the company of the root biochemistry science and technology (beijing); fluorescent quantification kit, reverse transcription kit (Transcriptor First Strand cDNA Synthesis Kit) were purchased from Roche, switzerland; DNA amplification enzymes purchased from beijing full gold biotechnology limited; restriction enzyme BsaI, plasmid extraction kit and DNA gel recovery kit were purchased from Takara Bio Inc.

Experimental facilities: PCR instrument Tprofessional Thermocycler, biomera company; quantitative PCR instrument LightCycler96, roche company.

Example 1 tobacco chloride channel protein encoding Gene NtCLC13 Gene

The nucleotide sequence of the tobacco chloride channel protein coding gene NtCLC13 gene in the embodiment is as follows:

(1) A nucleotide sequence shown as SEQ ID NO. 1;

Example 2 tobacco chloride channel protein NtCLC13

The amino acid sequence of tobacco chloride channel protein NtCLC13 in this example is:

(1) An amino acid sequence shown in SEQ ID NO. 2;

Example 3 application of tobacco chloride channel protein coding gene NtCLC13 gene in obtaining low-chlorine tobacco variety

In the embodiment, the NtCLC13 gene is successfully cloned through PCR, subcellular localization discovers that the tobacco NtCLC13 protein is localized in cytoplasm, and in order to further dig the functions of the tobacco, a gene editing vector of the NtCLC13 gene is constructed, the gene editing vector is transformed into a tobacco plant by using an agrobacterium transformation method, and the tobacco plant with the NtCLC13 gene knocked out is successfully constructed. Salt stress experiments show that the NtCLC13 gene participates in tobacco salt stress response and is used for knocking out the strain T ₁ The generation is cultivated, and the detection shows that the chloride ion content in the leaves of the NtCLC13 gene knockout strain is obviously reduced. The specific implementation operation is as follows:

1. cloning and subcellular localization of chloride channel protein coding gene NtCLC13

1) Cloning of the NtCLC13 Gene

Cloning and obtaining procedures of the NtCLC13 gene are as follows:

(1) Extracting RNA and reverse transcribing cDNA

And (3) inoculating the K326 seeds to an MS culture medium for germination after disinfecting, transplanting seedlings into a pot after two weeks of germination, culturing in a plant culture room with a culture temperature of 23-26 ℃, transferring the seedlings to a 1/2MS liquid culture medium for continuous culture when the tobacco seedlings grow to six leaves and one heart, selecting roots for sampling after two weeks, quick-freezing with liquid nitrogen for later use, and extracting total RNA of tobacco roots by using a plant RNA extraction kit. During RNA extraction, the method is carried out by referring to the instruction of the kit, and then reverse transcription is carried out to obtain cDNA for standby.

(2) Designing primer for PCR amplification

The PCR amplification primer sequences were as follows:

NtCLC13-F:5'-ATGACGGGAGGCGAGTAC-3' (SEQ ID NO. 3);

NtCLC13-R:5'-CTACATTGAAAAGATGC-3' (SEQ ID NO. 4).

PCR amplification was performed using the cDNA reverse transcribed in step (1) as a template and the above primers.

The PCR amplification system is as follows: 5 XGCL buffer 10. Mu.L, cDNA 2. Mu.L, 1. Mu.L each of the upstream and downstream primers, dNTP 6. Mu.L, GXL DNA Polymerase. Mu.L, and sterilized water to 50. Mu.L.

The PCR amplification conditions were: 98 ℃ for 10sec;55 ℃, 15sec,68 ℃, 2min,30 cycles. The PCR products were subjected to agarose electrophoresis detection and analysis, and the PCR amplified products were purified and recovered by referring to the DNA gel recovery kit instructions.

The purified product was then ligated onto pFF19 vector as follows: DNA amplification product, 6. Mu.L; pFF19 vector, 1. Mu.L; after mixing, the mixture was connected at 25℃for 25min.

The ligation products were transformed into E.coli DH 5. Alpha. Competent cells as follows:

taking out competent cells from a refrigerator at-80 ℃, putting the competent cells on ice to dissolve the competent cells, adding a connection product into 100 mu L DH5 alpha competent cells, flicking and mixing the competent cells uniformly, and carrying out ice bath for 20min; heat shock in a water bath at 42 ℃ for 90s, and immediately placing on ice for 2min; 900. Mu.L of LB (without antibiotics) liquid medium equilibrated to room temperature was added, and cultured with shaking at 37℃for 1h; centrifugation at 4000rpm for 3min, removing part of the supernatant, leaving 100. Mu.L of the pellet, mixing well, spreading evenly on LB solid plates (containing 50. Mu.g/. Mu.L kanamycin), inverting the dishes, and culturing overnight at 37 ℃.

The next day, the monoclonal was picked and sequenced.

Sequencing results and analysis results show that the length of the coding region of the NtCLC13 gene is 2238bp nucleotides; after analysis of the gene, the amino acid sequence of the encoded NtCLC13 protein is shown as SEQ ID NO. 2.

2) Subcellular localization of tobacco NtCLC13 protein

Primers pCS1300S-NtCLC13F and pCS1300S-NtCLC13R were designed, and NtCLC13 was cloned into pCS1300S vector containing GFP tag, the primer sequences were:

pCS1300S-NtCLC13F：5’-GCTTTCGCGAGCTCGGTACCATGACGGGAGGCGAGTAC-3' (SEQ ID NO. 5);

pCS1300S-NtCLC13R：5’-CCCTTGCTCACCATGGATCCCATTGAAAAGATGC-3' (SEQ ID NO. 6).

Note that: the underlined part is the linker sequence.

PCR amplification System and reaction procedure the same as in the cloning of part 1) the NtCLC13 gene. The PCR product obtained was ligated to pCS1300 vector using In-Fusion enzyme In the following manner: 2. Mu.L of DNA amplification product; 2. Mu.L of pCS1300S vector; in-Fusion enzyme 1. Mu.L. After mixing, the mixture was connected at 50℃for 15min. The ligation product was transformed into E.coli DH 5. Alpha. Competence and single colony was picked for sequencing.

The plasmid with correct sequence was extracted from high quality plasmid by plasmid big extraction kit, transformed into Nicotiana benthamiana protoplast, and compared with mitochondrial marker (red), and the result is shown in FIG. 1, wherein NtCLC13 is localized in cytoplasm.

2. Construction of Gene editing vector

In order to further understand the function of the NtCLC13 gene in the absorption and transportation of tobacco chloride ions, a CRISPR/Cas9 expression vector for knocking out the NtCLC13 gene is constructed, and the experimental process is as follows:

firstly, designing a target site according to the recognition characteristic of a CRISPR/Cas9 system, and designing a 20bp sgRNA target sequence in the 1 st exon region of the NtCLC13 gene, wherein the sgRNA sequence is as shown in figure 2: TCTCGGCGATAGTGCTCCAC (SEQ ID NO. 7) the knockout primer sequences NtCLC13-T1_F and NtCLC13-T1_R were designed as follows:

NtCLC13-T1_F: GTGGAGCACTATCGCCGAGAtgcaccagccgggaat (SEQ ID NO. 8);

NtCLC13-T1_R: ttctagctctaaaacGTGGAGCACTATCGCCGAGA (SEQ ID NO. 9).

The reaction system was designed to obtain a DNA double strand (annealing) of the target site, and 20. Mu.L of the reaction system was designed as follows: annealing Buffer for DNA OLigos (5×), 4 μl; upstream and downstream primers (NtCLC 13-T1_ F, ntCLC 13-T1_R), 4. Mu.L each (50. Mu. MoL/. Mu.L); nuclease-free water was supplemented to 20. Mu.L.

The reaction procedure is: 5min at 95 ℃, 0.1 ℃ every 8s, and 25 ℃; the reaction product is stored at 4 ℃ for standby or directly subjected to subsequent reaction.

Connecting the annealing product with a BsaI digested CRISPR/Cas9 vector, and screening to obtain a CRISPR/Cas9 expression vector for knocking out the NtCLC13 gene, wherein a 20 mu L connecting system is designed as follows: annealing product, 6 μl; 3 mu L of enzyme digestion product (BsaI enzyme digested CRISPR/Cas9 vector); 10×T DNA Ligase Buffer, 2. Mu.L; t4 DNA Ligase, 1. Mu.L; sterilized water was added to 20. Mu.L and connected at 37℃for 3 hours.

The connection product is transformed into competent cells of the escherichia coli, positive cloning is selected, amplification culture is carried out, plasmids are extracted, and after the construction success of the vectors is confirmed by PCR, the vectors are preserved at low temperature and used for agrobacterium transformation.

3. Obtaining transgenic plants

The CRISPR/Cas9 expression vector constructed in the steps is transformed into agrobacterium, and then tobacco plants are transformed, and transgenic plants with NtCLC13 gene knocked out are constructed, wherein the experimental process is as follows:

(1) Transformation of Agrobacterium

Taking out competent cells of Agrobacterium GV3101 from a refrigerator at-80 ℃, freezing and thawing on ice, adding 5 mu L of constructed gene editing vector when thawing is about to occur, flicking and mixing uniformly; ice-bath for 30min, freezing in liquid nitrogen for 5min, and immediately placing on ice after water bath at 37 ℃ for 5 min; adding 900 mu L of LB liquid medium without antibiotics, and culturing for 4h at 200rpm with shaking; centrifuging the bacterial liquid at 4500rpm for 3min, discarding half of the volume of supernatant, re-suspending, uniformly coating on LB solid medium containing Rif (100 mug/mL) and Kan (50 mug/mL), and inversely culturing at 28 ℃ for about 2-3 d until single colony is formed; and (3) selecting single bacterial colony, carrying out PCR identification on bacterial liquid after amplification and culture, and identifying the correct positive clone bacterial strain, namely the engineering bacteria with correct transformation.

(2) Transformation of tobacco plants

Taking aseptic seedling leaves of tobacco (medium tobacco 100) growing for about one month, processing the leaves into leaf discs with the diameter of 0.5cm by using a puncher, and pre-culturing the leaf discs after processing on an MS solid culture medium for 3d; culturing the transformed agrobacteria engineering bacteria to OD ₆₀₀ About=0.6, centrifuging at 4000rpm for 5min to collect the thalli, and suspending the thalli with 20mL of MS liquid medium; then placing the pre-cultured leaf discs in bacterial liquid, and infecting for 10min; excess bacterial liquid around the leaf disc after dip-dyeing was blotted with sterile filter paper and darkened on solid medium of MS+6-BA (2 mg/L) +NAA (0.5 mg/L)Culturing for 3d; washing the leaf disc with sterile water containing Cef (400 mg/L), sucking off the excess liquid with sterile filter paper, transferring the leaf disc to MS solid screening medium containing 6-BA (2 mg/L), NAA (0.5 mg/L), cef (200 mg/L) and Kan (50 mg/L), and culturing at 28deg.C under light; when the adventitious bud length reached 0.5cm, the shoots were transferred to MS solid medium containing Cef (200 mg/L) and Kan (50 mg/L) for rooting.

(3) Identification of Gene editing

And after the plant is grown for about one month, a small number of leaves are taken, DNA is extracted by referring to a plant genome extraction kit instruction, and positive transgenic strains and mutant forms are detected by PCR amplification, cloning and sequencing methods. The specific identification method comprises the following steps:

on the NtCLC13 genome, a pair of detection primers is designed, which are located on both sides of the knockout target site, specifically:

NtCLC13-J-F:5'-GGAGTGAGTACGGTGTGCCAGAAGGCGATTTAGAAAGC-3' (SEQ ID NO. 10);

NtCLC13-J-R:5'-GAGTTGGATGCTGGATGGGCTGAAACTAACCCCGC-3' (SEQ ID NO. 11).

By T ₀ And carrying out PCR amplification on the transgenic strain DNA template.

The PCR reaction system is as follows: 10 Xbuffer 2. Mu.L, cDNA 1. Mu.L, upstream and downstream primers 0.5. Mu.L each, dNTP 3. Mu.L, eazyTaq enzyme 1. Mu.L, and sterilized water to 20. Mu.L.

The PCR amplification conditions were: pre-denaturation at 94℃for 4min; denaturation at 94℃for 30s, annealing at 56℃for 30s, extension at 72℃for 40s for 25 cycles; and finally extending at 72 ℃ for 10min. The PCR product was Hi-tom sequenced.

Analytical sequencing results As shown in FIG. 3, at T ₀ In the generation plants, the NtCLC13 gene was detected to have a deletion mutation of a single base at the target site of knockout, whereas the wild-type plants did not detect any mutation in the NtCLC13 gene, which indicates that the gene was deleted at T ₀ The knockout of the NtCLC13 gene has been successfully realized in the generation of plants, and the edited plant is named NtCLC13 ^- 。

4. Phenotype observation of NtCLC13 gene editing plants

(1) Seed disinfection

Will smoke 100 (comparison to normalTobacco plants) and ntclc13 ^- Sterilizing the seeds of the editing material with 75% alcohol for 1-2min, sterilizing with 10% NaClO for 10min, and repeatedly washing with sterilized water for 3-5 times.

(2) Salt stress phenotype observations

The sterilized seeds were sown on 1/2MS solid medium with 200mM NaCl and 1/2MS solid medium without salt was used as a control, and the phenotype of the plants on the plates was observed after 2-3 weeks.

The results are shown in FIG. 4, where ntclc13 was present in the normal medium ^- Plant growth was not significantly different from control, and ntclc13 after salt stress addition ^- Plant growth is obviously inhibited compared with a control, and root length is shortened, which indicates that the NtCLC13 gene participates in tobacco salt stress response.

5. Detection of chloride ion content of leaves of NtCLC13 gene editing plant

(1) Hydroponic test

NtCLC13 Gene editing plant T ₁ The tobacco 100 plants in the generation and the control are planted in a plant culture room of a national tobacco gene research center, and the culture conditions are as follows: the temperature (23+/-1) DEG C, the relative humidity (60% +/-2%), the light culture for 16 hours and the dark culture for 8 hours. And (3) after the tobacco seedlings grow to a six-leaf stage, transferring the tobacco seedlings to Hoagland's nutrient solution for continuous culture, replacing the nutrient solution once after 1 week, culturing for 3 days, and taking the leaves for subsequent determination of chloride ion content. The leaves are quickly frozen by liquid nitrogen and then stored in a refrigerator at-80 ℃. Each strain is provided with 3 independent repeats, and at least 3 tobacco seedlings with consistent growth vigor are selected from each repeat.

(2) Determination of chloride ion content

After freeze-drying the stored leaf samples, grinding the leaf samples to powder by using a mixed vibration grinder, weighing about 0.0500g (accurate to 0.1 mg) of powder, placing the powder in 10mL of 5% (volume fraction) acetic acid, performing vibration extraction at 30 ℃ for 30min, filtering the powder by using qualitative filter paper, diluting the filtrate, and measuring the chloride ion content by using an Alalis MP6500 type desk pH meter in America An Laili.

As a result, as shown in fig. 5, after NtCLC13 gene editing, the chloride ion content in leaf was significantly reduced (representing p < 0.01).

In conclusion, the invention is realized by the method for preparing the tobacco NtCLC13 study of the gene, found that the NtCLC13 protein is localized on the cytoplasm; obtaining NtCLC13 gene knockout strain by gene editing technology, and after salt stress, ntCLC13 ^- The growth of the edited plant is inhibited, and the root length is obviously shortened compared with the control; the chloride ion content in the leaf of the edited plant is obviously reduced, and the tobacco plant with reduced chloride ion content of tobacco leaves is obtained.

The last explanation is: the above embodiments are only for illustrating the technical solution of the present invention, and not for limiting the same; although the invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical scheme described in the foregoing embodiments can be modified or some or all of the technical features thereof can be replaced by equivalents; such modifications and substitutions do not depart from the spirit of the invention.

Claims

1. A tobacco chloride channel protein coding gene NtCLC13 gene, characterized in that: the nucleotide sequence is as follows:

(1) A nucleotide sequence shown as SEQ ID NO. 1;

2. A tobacco chloride channel protein NtCLC13, characterized in that: the amino acid sequence is as follows:

(1) An amino acid sequence shown in SEQ ID NO. 2;

3. Use of the tobacco chloride channel protein coding gene NtCLC13 gene of claim 1 for regulating and controlling tobacco chloride transport.

4. The use of the tobacco chloride channel protein coding gene NtCLC13 gene according to claim 3 for regulating and controlling tobacco chloride transport, characterized in that: inhibiting the expression of the NtCLC13 gene, and remarkably reducing the content of chloride ions in tobacco leaves.

5. Use of the tobacco chloride channel protein coding gene NtCLC13 gene according to claim 1 for obtaining low-chlorine tobacco varieties, characterized in that: the low-chlorine tobacco variety is obtained by inhibiting the expression of the NtCLC13 gene and reducing chloride ions in tobacco leaves.

6. The use of the tobacco chloride channel protein coding gene NtCLC13 gene according to claim 5 for obtaining low-chlorine tobacco varieties, characterized in that: the expression of the NtCLC13 gene is inhibited by constructing a gene editing vector and knocking out the tobacco chloride channel protein coding gene NtCLC13 gene.

7. The use of the tobacco chloride channel protein coding gene NtCLC13 gene according to claim 6 for obtaining low-chlorine tobacco varieties, characterized in that: the gene editing vector is obtained by the following method: and (3) connecting the double-stranded DNA of the target site to a gene editing empty vector, and sequencing and identifying.

8. The use of the tobacco chloride channel protein coding gene NtCLC13 gene according to claim 7 for obtaining low-chlorine tobacco varieties, characterized in that: the sgRNA sequence corresponding to the double-stranded DNA of the target site is as follows: TCTCGGCGATAGTGCTCCAC.

9. The use of the tobacco chloride channel protein coding gene NtCLC13 gene according to any one of claims 5-8 for obtaining low-chlorine tobacco varieties, characterized in that: the low-chlorine tobacco variety is obtained by the following method: and (3) transforming agrobacterium tumefaciens serving as an invader solution by using the gene editing vector, transforming tobacco, and screening and identifying to obtain a tobacco variety with obviously reduced leaf chloride ion content.