CN101831428A - Separation clone and expression mode identification of promotor region of rice endosperm special expression gene - Google Patents

Abstract

The invention belongs to the field of plant genetic engineering. Seven promotors with different lengths (EnP2, EnP2-967, EnP2-771, EnP2-591, EnP2-281, EnP2-186 and EnP2-155) at the upstream of the same endosperm special expression gene (GeneBank has an accession number gb: AK107215.1) are cloned in a rice gene bank, and nucleotide sequences thereof are shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO: 6 and SEQ ID NO: 7. The promotors are expressed in endosperm of a transferred plant, and the expression is reduced with the growth of the endosperm; and the promotors are not expressed in other tissues, such as leaves, leaf sheaths, stems and straws, roots, flowers, glumes and endosperms. The invention also discloses a preparation method of the seven promotors and corresponding expression vectors, and application thereof guided into rice by using a transgenosis method mediated by bacillus.

Description

The separating clone of the promoter region of a rice endosperm specific expression gene and expression pattern are identified

Technical field

The invention belongs to the plant gene engineering technology field, the separating clone and the expression pattern that are specifically related to the different lengths promoter region of same endosperm specificity expression gene in the paddy rice are identified.

Background technology

Growing of higher organism is that different genes is expressed and synergistic process on time and space in order.The unlatching of genetic expression in this process, close, the height of expressive site, expression amount etc. all will be subjected to meticulous regulation and control.Expression of gene regulation and control are multi-level complex processes, are subjected to different adjusting controlling factors, also realize in the multistage level, promptly transcribe preceding, transcribe, transcribe back, translation, back five levels of translation.Although genetic expression is multistage regulator control system in higher organism, the regulation and control on the transcriptional level are links of most critical.Because the initial and occurrence frequency of transcribing is a step the most basic in the genetic expression link.Promotor is as important controlling element on the transcriptional level, it is the final action target of numerous transcription factors and RNA polymerase, therefore the structures, function, binding mode etc. of furtheing investigate promotor are for the basic theories problem in the molecular biology answered be significant (Gershon et al., 2008; Gershon et al., 2006; West and Fraser, 2005; Hochheimer and Tjian, 2003; Wray et al., 2003; Zhang, 2003; Courey and Jia, 2001; Smale, 2001; Tansey, 2001; Zhang and Reinberg, 2001).

Go research and improvement crop in agriculture production, to have good application prospects by molecular biology and engineered means.(Zambryski et al. since nineteen eighty-three obtains the first strain transgene tobacco, 1983), in 20 years, the research of plant genetic engineering has obtained the progress of advancing by leaps and bounds, and has become in modern biology and the thremmatology important method and technology.How to allow foreign gene efficient, stable design original intention in plant materials express and can be described as the starting point and standpoint that plant genetic engineering is studied according to people.Therefore, people more and more pay attention to reaching corresponding conversion purpose by the spatial and temporal expression of control goal gene in some new transformation technologies of exploitation (as organoid conversion, directed conversion etc.).Just because of this, the research status of promotor in plant genetic engineering is also more and more outstanding.

Summarize, promotor commonly used in the plant genetic engineering is broadly divided into three classes by its mode of action and function: constitutive promoter, inducible promoter and histoorgan Idiotype promotor.This classification has reflected their characteristics separately substantially, but in some cases, one type promotor often has the characteristic of other type promotor concurrently.So-called organizing specific type promotor is meant except that the structure with general promotor to also have the general characteristic of enhanser and silencer usually.Under organizing specific type promoter regulation, expression of gene usually only occurs in some specific organ or tissue position, and usually shows the characteristic of growing adjusting.The regulation and control of these promotors often are subjected to inducing of materials such as histocyte physiological status and chemical physics signal, also are subjected to the regulation and control of etap, and its expression is the result of multiple factor interaction.

Fruit and seed are the reproductive organ of plant, also are the main storage site of nutritive substance.Utilize organ specific promoters regulate gene expressions such as fruits and seeds, not only can improve the expression amount of gene at these positions, biological energy consumption is dropped to minimum, be beneficial to the separation of expression product, and can on purpose improve the nutrition of transgenic plant fruits and seeds or improve its quality.Sandhu etc. utilize E8 promotor (promotor of ethylene response gene in the mature fruit) to drive the respiratory syncystial virus F antigen gene and successfully transform tomato plant, with fruit specific expression antigen feeding mice, but inducing mouse produces special mucosal immunoreaction, serology antibody response and TH1 type cell immune response (Sandhu et al., 2000).Paddy rice endosperm-specific glutenin gene promoters driven soybean ferritin gene such as Vasconcelos, the content of iron and zinc all increases to some extent in the render transgenic rice grain, and ferritin mainly is accumulated in the endosperm, can in food processing process, not lose (Vasconcelos et al., 2003).The researchist has also separated the cis-acting elements of some endosperm specific expressions in some monocotyledonous seed storage proteins, it is necessary (Wu et al., 1998) that foremost GCN4 element is considered to keeping the endosperm specific expression activity.But reported in literature is also arranged, and the GCN4 element only is to play the effect that strengthens the expression intensity of promotor in endosperm, and it can not determine the characteristic (Vickers et al., 2006) of promotor endosperm specific expression.In addition, the promotor of specifically expressing such as PsGNS2 promotor (Buchner et al., 2002), FAE1 (Rossak et al., 2001) promotor etc. also have relevant report in some seeds.

Paddy rice is one of most important food crop in the world, is the model plant of gramineous crop functional genomics research.Promotor is accuracy controlling genetic expression " switch ".Therefore to the separating clone and the further investigation of rice tissue organ specific expression promoter, not only help to illustrate basic theories such as phytomorph, growth, pathways metabolism, can also instruct transgenic breeding, create huge economic benefit and social benefit, better be human productive life service.The present invention utilizes relevant molecular biology method exactly, from paddy rice " bright extensive 63 " genome separating clone the promoter region of same endosperm specific expression gene upstream different lengths, the promotor of different lengths is merged reporter gene GUS to import in the paddy rice " in spend 11 ", verify its expression pattern, and then identify control expression amount and expression pattern section.

Summary of the invention

The objective of the invention is to overcome the existing deficiency that can be used for the organizing specific expression promotor number of paddy gene engineering research, from paddy rice " bright extensive 63 " (the good rice restorer of China's widespread use) genome, separate and identify promotor, be expected to these promotors are used for the genetically engineered improvement of paddy rice with endosperm specific expression.For the ease of research and utilization, we have created EnP2, EnP2-967, EnP2-771, EnP2-591, EnP2-281, EnP2-186, EnP2-155 and the EnP2-98 promotor of totally 8 different lengthss.These promotors are merged reporter gene beta-Glucuronidase genes (hereinafter to be referred as gus gene) to import in paddy rice " in spend 11 " (crop investigations institute of Chinese Academy of Agricultural Sciences business management kind), verify its expression pattern, and carry out the mensuration of expression amount, lay a good foundation for utilize this promotor in the future.

The present invention realizes (technological line is seen Fig. 1) like this:

Utilize the rice at whole growth periods chip of expression spectrum database CREP of crop genetic improvement National Key Laboratory of Hua Zhong Agriculture University (http://crep.ncpgr.cn) (Wang et al., 2010) and reverse transcription PCR methods such as (hereinafter to be referred as RT-PCR), from paddy rice " bright extensive 63 " (the good rice restorer of China's wide popularization and application) genome, separate and identify promotor with endosperm specificity expression.The applicant is with its called after EnP2, EnP2-967, EnP2-771, EnP2-591, EnP2-281, EnP2-186, EnP2-155 and EnP2-98.Described promotor EnP2 sequence, it is the sequence shown in the sequence table SEQ ID NO:1.Find by analyzing the expression pattern of this promoters driven gus reporter gene in transgenic paddy rice: this promotor is only expressed at the endosperm of transformed plant, and along with constantly the carrying out of endosperm development stage, expression amount presents downtrending; In its hetero-organization such as blade, leaf sheath, cane, root, flower, clever shell and embryo, all detect less than expression.Described promotor EnP2-967, EnP2-771, EnP2-591, EnP2-281, EnP2-186, EnP2-155 sequence, be respectively the sequence shown in sequence table SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, the SEQ ID NO:7, they are respectively the sequences by core area 967bp, the 771bp of promotor EnP2 brachymemma, 591bp, 281bp, 186bp, 155bp.These six fragments all have the independently function of promotor gene expression, and the expression pattern in transformed plant is identical with EnP2, promptly only express at endosperm, but expression amount is respectively had any different.Described promotor EnP2-98 sequence, it is the sequence shown in the sequence table SEQ ID NO:8, it is sequence by the 98bp of the further brachymemma of EnP2-155, analyze it and drive gus reporter gene expression discovery in transgenic paddy rice, this section no longer has the independently function of promotor gene expression.

Concrete steps of the present invention are:

At first at the rice at whole growth periods chip of expression spectrum database CREP of crop genetic improvement National Key Laboratory of Hua Zhong Agriculture University (http://crep.ncpgr.cn) (Wang et al., 2010) found on that one may be the candidate gene of endosperm specific expression, go up the sequence that obtains this gene at the state-run biological study website NCBI of institute of the U.S. (http://www.ncbi.nlm.nih.gov/), shown in SEQ ID NO:9, be total to 718bp, further determine its express spectra thereby do the RT-PCR reaction with the sequences Design primer of this 718bp, RT-PCR result shows: this gene is only expressed in endosperm.Use Auele Specific Primer from paddy rice " bright extensive 63 " genome, to increase on this basis and obtain a promotor candidate segment that is named as EnP2 with the method for PCR, this promotor candidate segment EnP2 and reporter gene GUS encoding sequence are built into fusion gene and are loaded on the double base Ti carrier DX2181 (information such as carrier figure and multiple clone site are seen Fig. 3), be assembled into EnP2-GUS carrier (see figure 4), again by agriculture bacillus mediated genetic transforming method, the EnP2-GUS carrier is changed in the paddy rice acceptor " in spend 11 ", transform empty carrier DX2181 simultaneously as negative control, transform the cauliflower mosaic virus 35S promoter and drive GUS (CaMV35S-GUS) as positive control.Obtain to analyze by histochemical stain and GUS active level behind the transfer-gen plant, investigate this promotor in the endosperm development expression variation in each period, and then verify and clone this promotor.Detected result shows: this promotor is only expressed at the endosperm of transformed plant, and along with constantly the carrying out of endosperm development stage, expression amount presents downtrending; In its hetero-organization such as blade, leaf sheath, cane, root, flower, clever shell and embryo, all detect less than expression.Adopt the method for fragment deletion, we have made up 7 expression vectors that derive from 5 ' the end deletion fragment connection GUS of EnP2, it is changed in the paddy rice acceptor " in spend 11 " equally by agriculture bacillus mediated genetic transforming method, analyze this 7 segmental expression patterns, the result shows: six section (EnP2-967 that derive from this promotor, EnP2-771, EnP2-591, EnP2-281, EnP2-186 and EnP2-155) all have a function that promotor gene is independently expressed, and the expression pattern in transformed plant is identical with EnP2, promptly only express, but expression amount is respectively had any different at endosperm; EnP2-98 section by the further brachymemma of EnP2-155 then no longer has the independently function of promotor gene expression.

The invention has the advantages that:

(1) the present invention has identified the promotor EnP2 of endosperm specific expression and has controlled the nucleus of its expression amount and expression pattern, and the promotor resource of new specifically expressing is provided for genetically engineered and molecular breeding.

(2) the present invention can directly apply to the evaluation and the clone of the promotor of rice endosperm specific expression.

Description of drawings

Sequence table SEQ ID NO:1, disclose the present invention clone the nucleotide sequence of rice endosperm specific expression promotor EnP2, length is 1176bp.

Sequence table SEQ ID NO:2 is the nucleotide sequence that another promotor of conduct EnP2-967 that the clone from described SEQ ID NO:1 nucleotide sequence obtains uses, and length is 967bp.

Sequence table SEQ ID NO:3 is the nucleotide sequence that another promotor of conduct EnP2-771 that the clone from described SEQ ID NO:1 nucleotide sequence obtains uses, and length is 771bp.

Sequence table SEQ ID NO:4 is the nucleotide sequence that another promotor of conduct EnP2-591 that the clone from described SEQ ID NO:1 nucleotide sequence obtains uses, and length is 591bp.

Sequence table SEQ ID NO:5 is the nucleotide sequence that another promotor of conduct EnP2-281 that the clone from described SEQ ID NO:1 nucleotide sequence obtains uses, and length is 281bp.

Sequence table SEQ ID NO:6 is the nucleotide sequence that another promotor of conduct EnP2-186 that the clone from described SEQ ID NO:1 nucleotide sequence obtains uses, and length is 186bp.

Sequence table SEQ ID NO:7 is the nucleotide sequence that another promotor of conduct EnP2-155 that the clone from described SEQ ID NO:1 nucleotide sequence obtains uses, and length is 155bp.

Sequence table SEQ ID NO:8 is the nucleotide sequence of another promotor of conduct EnP2-98 research of obtaining of the clone from described SEQ ID NO:1 nucleotide sequence, and length is 98bp.

Sequence table SEQ ID NO:9 is that (the Genebank accession number is the gene that driven in genome of rice endosperm specific expression promotor EnP2 that the present invention clones Gb:AK107215.1) nucleotide sequence, length is 718bp.

Sequence table SEQ ID NO:10 is that (the Genebank accession number is the gene that driven in genome of rice endosperm specific expression promotor EnP2 that the present invention clones Gb:AK107215.1) amino acid sequence coded, length is 160 amino acid.

Fig. 1: realize technological line figure of the present invention.

Fig. 2: utilize the method for RT-PCR to analyze the expression pattern of the gene (gb:AK107215.1) that EnP2 driven in genome.What go up following expression respectively is confidential reference items paddy rice Actin1 gene and the expression of goal gene (gb:AK107215.1) in each tissue.

Fig. 3: expression binary vector DX2181 structural representation.This carrier is to transform on the basis of pCAMBIA1380, sentences opposite direction in multiple clone site and has made up a gus gene and EGFP gene respectively.

Fig. 4: what build is the expression vector sketch of skeleton with DX2181.Among the figure: the negative contrast of a, i.e. DX2181 empty carrier, no promoters driven gus gene is expressed; The positive contrast of b promptly drives gus gene with the CaMV35S promotor and expresses; C is that EnP2 and serial deletion fragment thereof drive the gus gene expression.LB, RB are respectively left margin and the right margin of T-DNA among the DX2181; Hyg is the hygromycin resistance screening-gene; GusA is reporter gene GUS (β-Pu Taotanggansuanmei); Egfp is reporter gene EGFP (an enhanced green fluorescent protein); MCS represents multiple clone site; 35sP represents CaMV35S promotor (cauliflower mosaic virus 35S promoter); EnP2-X represents EnP2 and serial deletion fragment thereof; The direction of arrow is represented the direction of gene or promoter expression.

Fig. 5: drive the histochemical stain of each tissue of the transformed plant of gus gene by EnP2.Among the figure: a is a blade; B is a leaf sheath; C is a cane; D is seed (containing embryo and endosperm); E is a root; F is flower.

Fig. 6: drive the histochemical stain of mature seed of the transformed plant of gus gene by EnP2 and serial deletion fragment thereof.What P2, P2-7, P2-6, P2-5, P2-4, P2-3, P2-2, P2-1 represented respectively among the figure is the expression of promoter fragment EnP2, EnP2-967, EnP2-771, EnP2-591, EnP2-281, EnP2-186, EnP2-155 and EnP2-98; Red small arrow only plays suggesting effect.

Fig. 7: the seed that is driven the transformed plant of gus gene by EnP2 and serial deletion fragment thereof detects at the GUS of different development stage active level.Fate (days after flowering) after DAF in the legend represents to bloom; DX2181 represents negative control.

Embodiment

Embodiment 1: the endosperm specific expression candidate gene ( Gb:AK107215.1) express spectra checking

Material is prepared: material therefor of the present invention is bright extensive 63 (the good rice restorers of China's widespread use) of rice variety (Oryza sativa ssp.indica), and planting method for planting is water planting.Nutrient composition is as follows: 1.44mM NH ₄NO ₃, 0.3mM NaH ₂PO ₄, 0.5mM K ₂SO ₄, 1.0mMCaCl ₂, 1.6mM MgSO ₄, 0.17mM NaSiO ₃, 50 μ m Fe-EDTA, 0.06 μ M (NH ₄) ₆Mo ₇O ₂₄, 15 μ M H ₃BO ₃, 8 μ MMnCl ₂, 0.12 μ M CuSO ₄, 0.12 μ M ZnSO ₄, 29 μ M FeCl ₃, 40.5 μ M Citric acid, pH5.5 (Yoshida et al., 1976).Get blade, leaf sheath, cane, root, fringe in boot stage, be fertilized and get endosperm after 14 days.RNA extracts Trizol Reagent (Invitrogen, Carisbad, CA, USA) method of adopting.Total RNA detects and concentration determination confirms that up-to-standard (the clear nothing of two master tapes of 18S, 28S is trailed, and can carry out follow-up test after OD260/OD280=1.8-2.0) through 1.4% agarose gel electrophoresis.The RNA reverse transcription of each tissue is become cDNA, place-20 ℃ of refrigerators to preserve.The test kit that reverse transcription is used is the M-MLV of Promega company, gets final product according to the product description operation.

At first at the rice at whole growth periods chip of expression spectrum database CREP of crop genetic improvement National Key Laboratory of Hua Zhong Agriculture University (http://crep.ncpgr.cn) (Wang et al., 2010) found in that one may be the candidate gene of endosperm specific expression, pairing probe number is Os.8224.1.S1_at, chip is presented at the equal a large amounts in 7,14,21 days of endosperm development and expresses, its hetero-organization do not have express or expression amount very low.The accession number of the gene that this probe characterized on TIGR is LOC_Os07g11330, and the gene on NCBI number is Gb:AK107215.1, the gene function note is " possible allergen protein (putative allergenic protein) ".The gene size is 718bp, and the mRNA size is 718bp, 160 amino acid (seeing sequence table SEQ ID NO:10) of encoding.Can the increase RT-PCR primer (YRJTZ2F:GTGTTGCTCCCGGTAGTTGT of part mRNA of design, YRJTZ2R:GCGTTTCATGTCGCCTCT, the amplification size is 351bp), RNA reverse transcription product with the blade of paddy rice " bright extensive 63 ", leaf sheath, cane, root, fringe, endosperm is a template, with paddy rice Actin1 is that (amplimer is actin1F:GCCACACTGTCCCCATCTAT to confidential reference items, actin1R:GCGACCACCTTGATCTTCAT).PCR reaction conditions: 94 ℃ of 5min, 94 ℃ of 30sec, 55.5 ℃ of 30sec, 72 ℃ of 50sec, 30 circulations, 72 ℃ of 7min.The PCR product detects through 0.8% agarose gel electrophoresis.Detected result is seen accompanying drawing 2.The result shows, candidate gene Gb:AK107215.1In endosperm, express, do not express at its hetero-organization.

Embodiment 2: the acquisition of endosperm specific expression promoter EnP2 candidate segment and corresponding deletion fragment (corresponding molecular biology routine operation is with reference to " molecular cloning experiment guide (second edition) " (J. Sa nurse Brooker etc., 1996))

The extracting of bright extensive 63 genomic dnas: get fresh blade and be used for its genomic dna of extracting in bright extensive 63 Sheng phases of tillering, concrete grammar is the CTAB method (Murray and Thompson.1980) of Murray report, and the DNA that extracting goes out dissolves fully and is placed on-20 ℃ of refrigerators preservations.

Go up the extraction candidate gene at information biology website NCBI (http://www.ncbi.nlm.nih.gov/) Gb:AK107215.1Upstream sequence, (transcripting start point is+1) the interval 1176bp of amounting to that specifically is-1085 to+91 is as the promotor candidate segment.With its called after EnP2.Utilizing the PCR method, is template with extractive bright extensive 63 genomic dnas, by the design special primer (EnP2F:

AAGCTTGTAACTAGATGACGTTATTTGA; EnP2R:

GGATCCTCTCAATCCTCAATGAGTGGT) EnP2 that increases, for the convenience of subsequent builds carrier, left and right sides primer adds HindIII, BamHI restriction enzyme site (partly representing with underscore) and corresponding protection base (representing with the shadow zone) respectively.PCR reaction conditions: 94 ℃ of 5min, 94 ℃ of 1min, 62 ℃ of 40sec, 72 ℃ of 2min, 30 circulations, 72 ℃ of 7min.

The PCR product of getting EnP2 detects with 0.8% agarose electrophoresis.Remaining PCR product is used to be the TA clone.The test kit that uses is the T-Vctor system of Promega company.Reaction system is 5.0 μ l, and is specific as follows: EnP2 PCR product 1.9 μ l, T-Vctor 0.3 μ l, 2 times of damping fluids (below be abbreviated as buffer) 2.5 μ l, T ₄Ligase 0.3 μ l.

Connect product in 16 ℃ of low temperature water-bath 10h, electricity transforms (1800 volts then, electric shock 2-3 second) goes into bacillus coli DH 5 alpha (this bacterial strain is business-like coli strain), 37 ℃ of recovery 40min, be coated with the flat board that contains ammonia benzyl mycin (Amp), isopropyl-(IPTG), 5-bromo-4-chloro-3-indoles-β-D-galactoside (X-gal), 37 ℃ of overnight incubation are selected hickie and are come enlarged culturing with the LB substratum that contains Amp.The plasmid of bacterium that extracting is shaken comes screening positive clone with HindIII and BamHI double digestion.The enzyme system of cutting is 20.0 μ l, and is specific as follows: plasmid 3.0 μ l, 10 * K buffer2.0 μ l, HindIII0.1 μ l, BamHI0.1 μ l, ddH ₂O14.8 μ l, 37 ℃ of reaction 4h, enzyme is cut product and is detected with 0.8% agarose electrophoresis.Selecting positive colony checks order with ABI3730.Sequencing result shows that deriving from bright extensive 63 genomic EnP2 sequences reports upward that with NCBI the fine sequence 100% of Japan is identical.

75 ' deletion fragments and the shared same right primer of total length promotor (EnP2R:

GGATCCTCTCAATCCTCAATGAGTGGT), left primer according to their final amplified fragments sizes respectively called after EnP2F-967 (

AAGCTTTATCTTCGCAGGCGGAAGTT), EnP2F-771 (

AAG CTTGCTTGCGATAATGCTTTTCC), EnP2F-591 (

AAGCTTGCCTCTCAAGAT TGCAGTACA), EnP2F-281 (

AAGCTTGCCTTCCATAACTATGTGTC), EnP2F-186 (

AAGCTTTATGAATCCACTTTAGCCAAC), EnP2F-155 (

AAGCTTCCAGATGATGCCTAGATTAGC) and EnP2F-98 (CCC AAGCTTGCTAATCACTCATGCTAAAAG).All introduce HindIII restriction enzyme site (partly representing) and corresponding protection base (representing) at every left primer 5 ' end with the shadow zone with underscore.Pcr template is the correct TA-EnP2 plasmid of order-checking.Obtain after the amplified production, subsequent operations is carried out according to the method that makes up TA-EnP2.

Embodiment 3: the conversion carrier of endosperm specific expression promoter EnP2 candidate segment and corresponding deletion fragment makes up (corresponding molecular biology routine operation is with reference to " molecular cloning experiment guide (second edition) " (J. Sa nurse Brooker etc., 1996))

(1) enzyme is cut carrier DX2181.The DX2181 carrier is that (this carrier is Australian CAMBIA (Center forthe Application of Molecular Biology to International Agriculture at pCAMBIA1380, CAMBIA) laboratory openly exchanges the carrier of use in the whole world) the basis on transform, sentence opposite direction in multiple clone site and made up a gus gene and EGFP gene respectively, information such as carrier figure and multiple clone site are seen Fig. 3.With HindIII, BamHI double digestion DX2181, enzyme is cut product and is reclaimed test kit (Shanghai Sangon Biological Engineering Technology And Service Co., Ltd's production) recovery with UNIQ-10 pillar DNA glue, and its enzyme of electrophoresis detection is cut integrity, places-20 ℃ of refrigerators to preserve.

(2) enzyme is cut the TA cloned plasmids of EnP2 and corresponding deletion fragment.Be the correct EnP2 and the TA cloned plasmids of corresponding deletion fragment with HindIII, BamHI double digestion through order-checking, enzyme is cut product and is separated with 0.8% agarose electrophoresis, object tape reclaims test kit (Shanghai Sangon Biological Engineering Technology And Service Co., Ltd's production) recovery with UNIQ-10 pillar DNA glue then, its enzyme of electrophoresis detection is cut integrity, places-20 ℃ of refrigerators to preserve.

(3) EnP2 that enzyme is cut back to close and corresponding deletion fragment are building up to carrier DX2181 and go up (seeing accompanying drawing 4), and electricity is transformed into bacillus coli DH 5 alpha.After enzyme is cut detection and checked order the carrier that builds is imported the agrobacterium tumefaciens EHA105 bacterial strain (this bacterial strain is business-like agrobacterium strains) of agropine type, constitute the engineering strain that can be used for transforming.Then by agriculture bacillus mediated genetic transformation method (woods is supported the army etc., 2002) rice transformation kind " in spend 11 ".

Embodiment 4: agriculture bacillus mediated genetic transformation

Method (woods is supported the army etc., 2002) shown in " agriculture bacillus mediated genetic transformation operational manual " that agriculture bacillus mediated genetic transforming method is mainly delivered with reference to crop genetic improvement National Key Laboratory of Hua Zhong Agriculture University.Transformation receptor is the embryo callus of the generation that mature seed is induced of rice varieties " in spend 11 ".Obtain having the callus of hygromycin resistance through cultivating in advance, infect, cultivate altogether, screening, through breaking up, take root, practicing seedling and transplanting, obtain transfer-gen plant again.The method of the key step of genetic transformation of the present invention, substratum and preparation thereof is as described below:

(1) reagent and solution abbreviation

Among the present invention in the substratum process for preparation title and the abbreviation of involved main agents be expressed as follows: 6-BA (6-BenzylaminoPurine, 6-benzyladenine); CN (Carbenicillin, Pyocianil); KT (Kinetin, kinetin); NAA (Napthalene acetic acid, naphthylacetic acid); IAA (Indole-3-acetic acid, indolylacetic acid); 2,4-D (2,4-Dichlorophenoxyacetic acid, 2,4 dichlorophenoxyacetic acid); AS (Acetosringone, Syringylethanone); CH (CaseinEnzymatic Hydrolysate, caseinhydrolysate); HN (Hygromycin B, Totomycin); DMSO (Dimethyl Sulfoxide, dimethyl sulfoxide (DMSO)); N ₆Max (N ₆Macroelement composition solution); N ₆Mix (N ₆Trace element composition solution); MSmax (MS macroelement composition solution); MSmix (MS trace element composition solution)

(2) main solution formula

1) N ₆Substratum macroelement mother liquor (according to 10 times of concentrated solutions (10X) preparation):

Saltpetre (KNO ₃) 28.3g

Potassium primary phosphate (KH ₂PO ₄) 4.0g

Ammonium sulfate ((NH ₄) ₂SO ₄) 4.63g

Sal epsom (MgSO ₄7H ₂O) 1.85g

Calcium chloride (CaCl ₂2H ₂O) 1.66g

Mentioned reagent is dissolved one by one, be settled to 1000ml with distilled water under the room temperature then.

2) N6 substratum trace element mother liquor (prepare according to 100 times of concentrated solutions (100X):

Potassiumiodide (KI) 0.08g

Boric acid (H ₃BO ₃) 0.16g

Manganous sulfate (MnSO ₄4H ₂O) 0.44g

Zinc sulfate (ZnSO ₄7H ₂O) 0.15g

Mentioned reagent is at room temperature dissolved and be settled to 1000ml with distilled water.

3) molysite (Fe _2-EDTA) stock solution (according to the preparation of 100X concentrated solution):

With 3.73 gram disodium ethylene diamine tetraacetate (Na ₂EDTA2H ₂O) and 2.78 the gram FeSO ₄7H ₂O dissolves respectively, mixes and is settled to 1000ml with distilled water, bathes 2 hours to 70 ℃ of temperature, and 4 ℃ of preservations are standby.

4) VITAMIN stock solution (according to the preparation of 100X concentrated solution):

Nicotinic acid (Nicotinic acid) 0.1g

VITMAIN B1 (Thiamine HCl) 0.1g

Vitamin B6 (Pyridoxine HCl) 0.1g

Glycine (Glycine) 0.2g

Inositol (Inositol) 10g

Adding distil water is settled to 1000ml, and 4 ℃ of preservations are standby.

5) MS substratum macroelement mother liquor (according to the preparation of 10X concentrated solution):

Ammonium nitrate (NH ₄NO ₃) 16.5g

Saltpetre (KNO ₃) 19.0g

Potassium primary phosphate (KH ₂PO ₄) 1.7g

Sal epsom (MgSO ₄7H ₂O) 3.7g

Calcium chloride (CaCl ₂2H ₂O) 4.4g

Mentioned reagent is at room temperature dissolved, and be settled to 1000ml with distilled water.

6) MS substratum trace element mother liquor (according to the preparation of 100X concentrated solution):

Manganous sulfate (MnSO ₄4H ₂O) 2.23g

Zinc sulfate (ZnSO ₄7H ₂O) 0.86g

Boric acid (H ₃BO ₃) 0.62g

Potassiumiodide (KI) 0.083g

Sodium orthomolybdate (Na ₂MoO ₄2H ₂O) 0.025g

Copper sulfate (CuSO ₄5H ₂O) 0.0025g

Cobalt chloride (CoCl ₂6H ₂O) 0.0025g

Mentioned reagent is at room temperature dissolved, and be settled to 1000ml with distilled water.

7) 2, the preparation of 4-D stock solution (1mg/ml):

Take by weighing 2,4-D 100mg with 1ml 1N potassium hydroxide dissolving 5 minutes, adds the 10ml dissolved in distilled water then and is settled to 100ml after fully, preserves under room temperature.

8) preparation of 6-BA stock solution (1mg/ml):

Take by weighing 6-BA 100mg,, add the 10ml dissolved in distilled water then and be settled to 100ml, room temperature preservation after fully with 1ml 1N potassium hydroxide dissolving 5 minutes.

9) preparation of naphthylacetic acid (NAA) stock solution (1mg/ml):

Take by weighing NAA 100mg, with 1ml 1N potassium hydroxide dissolving 5 minutes, add the 10ml dissolved in distilled water then and be settled to 100ml after fully, 4 ℃ of preservations are standby.

10) preparation of indolylacetic acid (IAA) stock solution (1mg/ml):

Take by weighing IAA 100mg, with 1ml1N potassium hydroxide dissolving 5 minutes, add the 10ml dissolved in distilled water then and be settled to 100ml after fully, 4 ℃ of preservations are standby.

11) preparation of glucose stock solution (0.5g/ml):

Take by weighing glucose 125g, be settled to 250ml with dissolved in distilled water then, the back 4 ℃ of preservations of sterilizing are standby.

12) preparation of AS stock solution:

Take by weighing AS 0.392g, add DMSO 10ml dissolving, divide to be filled in the 1.5ml centrifuge tube, 4 ℃ of preservations are standby.

13) 1N potassium hydroxide stock solution preparation:

Take by weighing potassium hydroxide 5.6g, be settled to 100ml with dissolved in distilled water, room temperature preservation is standby.

(3) be used for the culture medium prescription that rice genetic transforms

1) inducing culture

N6max mother liquor (getting the 10X concentrated solution that has prepared, down together) 100ml

N6mix mother liquor (getting the 100X concentrated solution that has prepared, down together) 10ml

Fe ²⁺EDTA stock solution (getting the 100X concentrated solution that has prepared, down together) 10ml

VITAMIN stock solution (getting the 100X concentrated solution that has prepared, down together) 10ml

2,4-D stock solution (get above-mentioned prepare) 2.5ml

Proline(Pro) (Proline) 0.3g

CH 0.6g

Sucrose 30g

Phytagel 3g

Adding distil water is to 900ml, 1N potassium hydroxide is regulated pH value to 5.9, boils and is settled to 1000ml, divides to install to 50ml triangular flask (25ml/ bottle), sterilization according to a conventional method after sealing (for example sterilized 25 minutes down for 121 ℃, following medium sterilization method is identical with the sterilising method of basal culture medium).

2) subculture medium

N6max mother liquor (10X) 100ml

N6mix mother liquor (100X) 10ml

Fe ²⁺EDTA stock solution (100X) 10ml

VITAMIN stock solution (100X) 10ml

2,4-D stock solution 2.0ml

Proline(Pro) 0.5g

CH 0.6g

Sucrose 30g

Phytagel 3g

Adding distil water is to 900ml, and 1N potassium hydroxide is regulated pH value to 5.9, boils and is settled to 1000ml, divides to install to 50ml triangular flask (25ml/ bottle), seals, as stated above sterilization.

3) pre-culture medium

N6max mother liquor (10X) 12.5ml

N6mix mother liquor (100X) 1.25ml

Fe ²⁺EDTA stock solution (100X) 2.5ml

VITAMIN stock solution (100X) 2.5ml

2,4-D stock solution 0.75ml

CH 0.15g

Sucrose 5g

Agar powder 1.75g

Adding distil water is to 250ml, and 1N potassium hydroxide is regulated pH value to 5.6, seals, as stated above sterilization.Use preceding heating for dissolving substratum and add 5ml glucose stock solution and 250 microlitre AS stock solutions, (25ml/ ware) in the culture dish poured in packing into.

4) be total to substratum

N6max mother liquor (10X) 12.5ml

N6mix mother liquor (100X) 1.25ml

Fe ²⁺EDTA stock solution (100X) 2.5ml

VITAMIN stock solution (100X) 2.5ml

2,4-D stock solution 0.75ml

CH 0.2g

Sucrose 5g

Agar powder 1.75g

Adding distil water is to 250ml, and 1N potassium hydroxide is regulated pH value to 5.6, seals, as stated above sterilization.Use preceding heating for dissolving substratum and add 5ml glucose stock solution and 250 microlitre AS stock solutions, (the every ware of 25ml/) in the culture dish poured in packing into.

5) suspension culture base

N6max mother liquor (10X) 5ml

N6mix mother liquor (100X) 0.5ml

Fe ²⁺EDTA stock solution (100X) 0.5ml

VITAMIN stock solution (100X) 1ml

2,4-D stock solution 0.2ml

CH 0.08g

Sucrose 2g

Adding distil water is regulated pH value to 5.4 to 100ml, divides to install in the triangular flask of two 100ml, seals, as stated above sterilization.Add aseptic glucose stock solution of 1ml and 100 microlitre AS stock solutions before using.

6) select substratum

N6max mother liquor (10X) 25ml

N6mix mother liquor (100X) 2.5ml

Fe ²⁺EDTA stock solution (100X) 2.5ml

VITAMIN stock solution (100X) 2.5ml

2,4-D stock solution 0.625ml

CH 0.15g

Sucrose 7.5g

Agar powder 1.75g

Adding distil water is regulated pH value to 6.0 to 250ml, seals, as stated above sterilization.

Dissolving substratum before using adds 250 microlitre HN (50mg/ml) and (25ml/ ware) in the culture dish poured in 400 microlitre CN (250mg/ml) packing into.(annotate: selecting substratum Pyocianil concentration for the first time is the 400mg/ liter, and selecting substratum Pyocianil concentration for the second time and later on is 250mg/l).

7) break up substratum in advance

N6max mother liquor (10X) 25ml

N6mix mother liquor (100X) 2.5ml

Fe ²⁺EDTA stock solution (100X) 2.5ml

VITAMIN stock solution (100X) 2.5ml

6-BA stock solution 0.5ml

KT stock solution 0.5ml

NAA stock solution 50 microlitres

IAA stock solution 50 microlitres

CH 0.15g

Sucrose 7.5g

Agar powder 1.75g

Adding distil water is to 250ml, and 1N potassium hydroxide is regulated pH value to 5.9, seals, as stated above sterilization.Dissolving substratum before using, 250 microlitre HN (50mg/ml), 250 microlitre CN (250 milli g/ml), (25ml/ ware) in the culture dish poured in packing into.

8) division culture medium

N6max mother liquor (10X) 100ml

N6mix mother liquor (100X) 10ml

Fe ²⁺EDTA stock solution (100X) 10ml

VITAMIN stock solution (100X) 10ml

6-BA stock solution 2ml

KT stock solution 2ml

NAA stock solution 0.2ml

IAA stock solution 0.2ml

CH 1g

Sucrose 30g

Phytagel 3g

Adding distil water is to 900ml, and 1N potassium hydroxide is regulated pH value to 6.0.

Boil and be settled to 1000ml, divide to install to 50ml triangular flask (50ml/ bottle), seal, as stated above sterilization with distilled water.

9) root media

MSmax mother liquor (10X) 50ml

MSmix mother liquor (100X) 5ml

Fe ²⁺EDTA stock solution (100X) 5ml

VITAMIN stock solution (100X) 5ml

Sucrose 20g

Phytagel 3g

Adding distil water is regulated pH value to 5.8 to 900ml with 1N potassium hydroxide.

Boil and be settled to 1000ml, divide to install to (25ml/ pipe) in the pipe of taking root, seal, sterilize as stated above with distilled water.

(4) agriculture bacillus mediated genetic transformation step

1) callus of induce

A. will spend 11 rice paddy seeds to shell in sophisticated, used 70% Ethanol Treatment then successively 1 minute, 0.15% mercury chloride (HgCl ₂) seed-coat sterilization 15 minutes;

B. wash seed 4-5 time with sterilization;

C. seed is placed on the inducing culture;

D. postvaccinal substratum is placed dark place to cultivate 4 weeks, 25 ± 1 ℃ of temperature.

2) callus subculture

Select the embryo callus subculture of glassy yellow, consolidation and relatively dry, be put in dark 2 weeks, 25 ± 1 ℃ of the temperature of cultivating down on the subculture medium.

3) the pre-cultivation

Select the embryo callus subculture of consolidation and relatively dry, be put in dark 2 weeks, 25 ± 1 ℃ of the temperature of cultivating down on the pre-culture medium.

4) Agrobacterium is cultivated

A. on the LA substratum that has corresponding resistance selection, cultivated Agrobacterium EHA105 (this bacterial strain is available from the business-like agrobacterium strains of CAMBIA company) two days in advance, 28 ℃ of temperature;

B. Agrobacterium is transferred in the suspension culture base, cultivated 2-3 hour on 28 ℃ of shaking tables.

5) Agrobacterium is infected

A. pre-incubated callus is transferred in the bottle of the bacterium of having gone out;

B. the suspension of regulating Agrobacterium is to OD ₆₀₀0.8-1.0;

C. callus was soaked in agrobacterium suspension 30 minutes;

D. shift callus inhale to the good filter paper of sterilization in; Be placed on then on the common substratum and cultivated temperature 19-20 ℃ 3 days.

6) callus washing and selection are cultivated

A. aqua sterilisa washing callus is to cannot see Agrobacterium;

B. be immersed in the aqua sterilisa that contains 400 milligrams/L Pyocianil (CN) 30 minutes;

C. shifting callus blots to the good filter paper of sterilization;

D. shift callus to selecting to select on the substratum cultivation 2-3 time, each 2 weeks.

7) differentiation

A. kanamycin-resistant callus tissue is transferred on the pre-differentiation substratum and cultivated 5-7 days in the dark place;

B. the callus that shifts pre-differentiation cultivation is to division culture medium, and illumination (1500-2000Lux) is cultivated down, 26 ℃ of culture temperature.

8) take root

Cut the root that differentiation phase produces; Then it is transferred to and cultivates 2-3 week, 26 ℃ of culture temperature under the illumination in the root media (1500-2000Lux).

9) transplant

Wash the residual substratum on the root off, the seedling that will have good root system changes the greenhouse over to, divides moistening at initial several Tian Bao water holding simultaneously.

Embodiment 5:PCR method detects the transgenic positive plant

After transforming seedling and moving into the greenhouse, treat that it turns green, divide individual plant to get the 1-2cm young leaflet tablet then, its genomic dna of extracting is a template, detects positive plant with the PCR method.Amplified fragments is the part fragment of reporter gene gus, and size is 699bp.Primer sequence is GUS-F:GGGCGAACAGTTCCTGATTA, GUS-R:AACGTATCCACGCCGTATTC.PCR reaction conditions: 94 ℃ of 5min, 94 ℃ of 50sec, 57 ℃ of 40sec, 72 ℃ of 50sec, 30 circulations, 72 ℃ of 7min.The PCR product detects through 0.8% agarose gel electrophoresis.By this method, can reject negative plant.

The extracting method of a small amount of blade genomic dna: get an amount of young leaflet tablet, add 800 μ l, 1.5 * CTAB and grind, change in the 1.5ml centrifuge tube; 65 ℃ of water-bath 30min; Add 600 μ L chloroform/primary isoamyl alcohol (volume ratio is 24: 1) and turn upside down (about 15min) for several times, lower floor's liquid phase is till the deep green; The centrifugal 10min of 12000r/min under the room temperature; Get 500 μ L supernatants in a new 1.5ml centrifuge tube, add 95% ethanol 1mL of precooling, mixing postposition-20 ℃, 30min; The centrifugal 10min of 12000r/min removes supernatant under the room temperature, embathes precipitation with 75% ethanol, seasoning; Add 100 μ L ddH ₂The O dissolving, standby.

Embodiment 6:GUS tissue staining method is analyzed the expression pattern in EnP2 candidate segment and the various tissues of corresponding deletion fragment

Root, blade, leaf sheath, cane, clever shell, flower, the seed of EnP2-GUS transformed plant (more than 10 strains) that the PCR that learns from else's experience respectively detection (method of reference example 5) is positive is cut into the suitable size of about 0.5CM length, immerse the GUS dye liquor of about 200 μ l, 37 ℃ are spent the night, with the alcohol decolouring of 75% concentration, observe whether blue the appearance is arranged then.The prescription of staining fluid is with reference to reported method such as Jefferson (Jefferson etc., 1987).The result shows: the EnP2 candidate segment is only expressed at the endosperm of transformed plant, all detects in its hetero-organization such as blade, leaf sheath, cane, root, flower, clever shell and embryo less than expressing (seeing accompanying drawing 5).These results confirm that EnP2 is the promotor of an endosperm specific expression.

The expression pattern (see figure 6) of GUS in various tissues under the serial deletion fragment of having analyzed EnP2 with same way drives.The result shows: promotor EnP2-967, EnP2-771, EnP2-591, EnP2-281, EnP2-186, EnP2-155 all have the independently function of promotor gene expression, and the expression pattern in transformed plant is identical with EnP2, promptly only express, but expression amount is respectively had any different at endosperm.Find then no longer have the function that promotor gene is independently expressed simultaneously, in each tissue, all do not detect expression by the EnP2-98 of the further brachymemma of EnP2-155.

Embodiment 7: promotor EnP2 and corresponding deletion fragment endosperm tissue GUS active level detect

Get EnP2 and corresponding deletion fragment through positive (reference example 6) plant of GUS histochemical stain and the T0 that changes empty carrier DX2181 plant for seed, unified sowing.Get endosperm tissue when treating after its chasmogamy 7 days, 14 days, 21 days, its total protein of extracting is measured the active (see figure 7) of its GUS then.Concrete grammar is with reference to reported method such as Bradford and Jefferson (BradfordM, 1976; Jefferson etc., 1987).The result shows: all promoter fragments (except that EnP2-98) are compared with negative control DX2181, and all there were significant differences, and this and histochemical stain result coincide.Than other fragment, the expression amount of total length promotor EnP2 the highest (all is like this at each developmental stage), and along with constantly the carrying out of endosperm development stage, expression amount presents downtrending.To all conversion fragments, GUS activity expression amount of 7 days after chasmogamy all will be higher than 14 days and 21 expression amount; Simultaneously from can find on scheming after the chasmogamy 7 days GUS activity from EnP2 to EnP2-967 and EnP2-281 to EnP2-186 a phenomenon that sharply descends is arranged; The active rapid decline of GUS of 14 days and 21 days then appears at EnP2-771 to EnP2-591 after the chasmogamy.Can infer in view of the above that promotor EnP2 is a specific expression promoter in the expression of endosperm development a large amount in early stage; In the early stage 1176-967 of endosperm development and these two sections of 281-186, may there be the cis-acting elements of controlling its expression amount; In this section of the middle and later periods of endosperm development 771-591, may there be the cis-acting elements of controlling its expression amount.While found that in conjunction with GUS tissue staining and the detection of GUS active level, EnP2-98 by the further brachymemma of EnP2-155 then no longer has the independently function of promotor gene expression, illustrates at the cis-acting elements that may have control promoter expression pattern from EnP2-155 to EnP2-98.

Reference:

1. woods is supported the army etc., the foundation of the agriculture bacillus mediated No. 8 high-efficient transgenic systems in Mudanjiang, Acta Agronomica Sinica, 2002,28 (3): 294-300;

2.J. Sa nurse Brooker, E.F. is the Ritchie not, T. Manny A Disi. molecular cloning experiment guide (second edition). and Science Press, 1996;

3.Bradford?M，A?rapid?and?sensitive?method?for?the?quantitation?of?microgram?quantities?of?protein?utilizing?theprinciple?of?protein-dye?binding.Anal?Biochem，1976，72：248-254；

4.Buchner?et?al.，Characterization?of?a?tissue-specific?and?developmentally?regulated?beta-1，3-glucanase?gene?inpea(Pisum?sativum).Plant?Mol?Biol，2002，49：171-186；

5.Courey?and?Jia，Transcriptional?repression：the?long?and?the?short?of?it.Genes&Dev，2001，15：2786-2796；

6.Gershon?et?al.，Perspectives?on?the?RNA?polymerase?II?core?promoter.Biochem?Soc?Trans，2006，34：1047-1050；

7.Gershon?et?al.，The?RNA?polymerase?II?core?promoter-the?gateway?to?transcription.Curr?Opin?Cell?Biol，2008，20：253-259；

8.Hochheimer?and?Tjian，Diversified?transcription?initiation?complexes?expand?promoter?selectivity?andtissue-specific?gene?expression.Genes&Dev，2003，17：1309-1320；

9.Jefferson?et?al.，GUS?fusions：beta-glucuronidase?as?a?sensitive?and?versatile?gene?fusion?marker?in?higherplants.EMBO?J，1987，6：3901-3907；

10.Murray?and?Thompson.Rapid?isolation?of?high?molecular?weight?plant?DNA.Nucleic?Acids?Res.1980，8：4321-4325；

11.Rossak?et?al.，Expression?of?the?FAE1?gene?and?FAE1?promoter?activity?in?developing?seeds?of?Arabidopsisthaliana.Plant?Mol?Biol，2001，46：717-725；

12.Sandhu?et?al.，Oral?immunization?of?mice?with?transgenic?tomato?fruit?expressing?respiratory?syncytial?virus-Fprotein?induces?a?systemic?immune?response.Transgenic?Res，2000，9：127-135；

13.Smale，Core?promoters：active?contributors?to?combinatorial?gene?regulation.Genes?&?Dev，2001，15：2503-2508；

14.Tansey，Transcriptional?activation：risky?business.Genes&Dev，2001，15：1045-1050；

15.Vasconcelos?et?al.，Enhanced?iron?and?zinc?accumulation?in?transgenic?rice?with?the?ferritin?gene.Plant?Sci，2003，164：371-378；

16.Vickers?et?al.，A?novel?cis-acting?element，ESP，contributes?to?high-level?endosperm-specific?expression?in?anoat?globulin?promoter.Plant?Mol?Biol，2006，62：195-214；

17.Wang?L?et?al.，A?dynamic?gene?expression?atlas?covering?the?entire?life?cycle?of?rice.Plant?J.2010，61：752-766；

18.West?and?Fraser，Remote?control?of?gene?transcription.Hum?Mol?Genet，2005，14：101-111；

19.Wray?et?al.，The?evolution?of?transcriptional?regulation?in?eukaryotes.Mol.Biol.Evol，2003，20：1377-1419；

20.Wu?et?al.，The?GCN4?motif?in?a?rice?glutelin?gene?is?essential?for?endosperm?specific?gene?expression?and?isactivated?by?Opaque-2?in?transgenic?rice?plants.Plant?J，1998，14：673-683；

21.Yoshida?et?al.，Laboratory?Manual?for?Physiological?Studies?of?Rice，3rd?Edn.International?Rice?ResearchInstitute，Manila.1976；

22.Zambryski?et?al.，Ti?plasmid?vector?for?the?introduction?of?DNA?into?plant?cells?without?alteration?of?theirnormal?regeneration?capacity.EMBO?J，1983，2：2143-2150；

23.Zhang，Transcriptional?regulation?by?histone?ubiquitination?and?deubiquitination.Genes?&?Dev，2003，17：2733-2740；

24.Zhang?and?Reinberg，Transcription?regulation?by?histone?methylation：interplay?between?different?covalentmodifications?of?the?core?histone?tails.Genes?&?Dev，2001，15：2343-2360。

Sequence table (SEQUENCE LISTING)

＜110〉Hua Zhong Agriculture University

＜120〉separating clone of the promoter region of a rice endosperm specific expression gene and expression pattern are identified

<130>

<141>2010-04-01

<160>10

<170>PatentIn?version?3.1

 

<210>1

<211>1176

<212>DNA

＜213〉paddy rice (Oryza sativa)

<220>

<221>gene

<222>(1)..(1176)

<223>

<220>

<221>promoter

<222>(1)..(1176)

<223>

<400>1

gtaactagat?gacgttattt?gaagtgacaa?tgtaaaacaa?tattgtaata?tatatatttt 60

ggcaacactt?ttgatttatg?caatataagt?agatttctca?gtaccaaatg?cttgataata 120

ttccaatata?tgtacctgca?agaatttcta?ataaataatt?taaaagtaat?ttacggccaa 180

attatattta?aatttcaata?ttttctacct?atcttcgcag?gcggaagttt?tcttttttgc 240

aagcggacga?ttcctatttt?cgcaggcgga?ccggactagc?caacgtccgt?ctgcgaaaat 300

tatcttcgca?ggcggacggc?ctccccgcct?gcgaagatcg?gcgatcttca?tagtcgttgg 360

cttacaggcg?gacggccgcc?ccgcctgcga?agaccctttt?cggccgcttg?cgataatgct 420

tttcctagta?gtgcaaattg?caacgggaaa?agttatagca?gacaatattt?ctagccttta 480

atttgcaaca?tttttcaaca?aagtgattat?gcgtacgtgc?ttcttatgtc?catataaata 540

taattccgtg?ccttgttaat?atatctctgt?tatccaactg?cctaggcctc?tcaagattgc 600

agtacaacaa?aaaaaaaaag?taggtgaaag?actgaacgtg?cacatcaaag?ctatcttata 660

tatgaatttt?gtttttcaga?aaactccaat?atatgcttga?tcaggcacgt?atatacagag 720

aacgcacacg?ttatttaatt?ttctgaatct?agtgttgccg?ctttctttac?tgcatacttt 780

gtagcttgca?gagcattctt?tttaacaata?tttgttctga?agtatcattt?ttttgtttat 840

caaattggac?cactatacaa?aaagccatgg?aaataaagat?caaaatattt?ttgttgcctt 900

ccataactat?gtgtctgtta?gtagtttatg?catttatttt?cttgcacgga?agaatgaaaa 960

tgggtttaaa?caattaaaga?gtgtggtcca?tatgaatcca?ctttagccaa?cttttttttc 1020

cccagatgat?gcctagatta?gctgtgaatc?acaataaata?tttcattcaa?aaccacaagc 1080

taatcactca?tgctaaaagt?tttgtgtcca?ttcttgaatc?actatcactt?tagtcttagt 1140

agctacatat?ataaaaccac?tcattgagga?ttgaga 1176

 

<210>2

<211>967

<212>DNA

＜213〉paddy rice (Oryza sativa)

<220>

<221>gene

<222>(1)..(967)

<223>

<220>

<221>promoter

<222>(1)..(967)

<223>

<400>2

tatcttcgca?ggcggaagtt?ttcttttttg?caagcggacg?attcctattt?tcgcaggcgg 60

accggactag?ccaacgtccg?tctgcgaaaa?ttatcttcgc?aggcggacgg?cctccccgcc 120

tgcgaagatc?ggcgatcttc?atagtcgttg?gcttacaggc?ggacggccgc?cccgcctgcg 180

aagacccttt?tcggccgctt?gcgataatgc?ttttcctagt?agtgcaaatt?gcaacgggaa 240

aagttatagc?agacaatatt?tctagccttt?aatttgcaac?atttttcaac?aaagtgatta 300

tgcgtacgtg?cttcttatgt?ccatataaat?ataattccgt?gccttgttaa?tatatctctg 360

ttatccaact?gcctaggcct?ctcaagattg?cagtacaaca?aaaaaaaaaa?gtaggtgaaa 420

gactgaacgt?gcacatcaaa?gctatcttat?atatgaattt?tgtttttcag?aaaactccaa 480

tatatgcttg?atcaggcacg?tatatacaga?gaacgcacac?gttatttaat?tttctgaatc 540

tagtgttgcc?gctttcttta?ctgcatactt?tgtagcttgc?agagcattct?ttttaacaat 600

atttgttctg?aagtatcatt?tttttgttta?tcaaattgga?ccactataca?aaaagccatg 660

gaaataaaga?tcaaaatatt?tttgttgcct?tccataacta?tgtgtctgtt?agtagtttat 720

gcatttattt?tcttgcacgg?aagaatgaaa?atgggtttaa?acaattaaag?agtgtggtcc 780

atatgaatcc?actttagcca?actttttttt?ccccagatga?tgcctagatt?agctgtgaat 840

cacaataaat?atttcattca?aaaccacaag?ctaatcactc?atgctaaaag?ttttgtgtcc 900

attcttgaat?cactatcact?ttagtcttag?tagctacata?tataaaacca?ctcattgagg 960

attgaga 967

 

<210>3

<211>771

<212>DNA

＜213〉paddy rice (Oryza sativa)

<220>

<221>gene

<222>(1)..(771)

<223>

<220>

<221>promoter

<222>(1)..(771)

<223>

<400>3

gcttgcgata?atgcttttcc?tagtagtgca?aattgcaacg?ggaaaagtta?tagcagacaa 60

tatttctagc?ctttaatttg?caacattttt?caacaaagtg?attatgcgta?cgtgcttctt 120

atgtccatat?aaatataatt?ccgtgccttg?ttaatatatc?tctgttatcc?aactgcctag 180

gcctctcaag?attgcagtac?aacaaaaaaa?aaaagtaggt?gaaagactga?acgtgcacat 240

caaagctatc?ttatatatga?attttgtttt?tcagaaaact?ccaatatatg?cttgatcagg 300

cacgtatata?cagagaacgc?acacgttatt?taattttctg?aatctagtgt?tgccgctttc 360

tttactgcat?actttgtagc?ttgcagagca?ttctttttaa?caatatttgt?tctgaagtat 420

catttttttg?tttatcaaat?tggaccacta?tacaaaaagc?catggaaata?aagatcaaaa 480

tatttttgtt?gccttccata?actatgtgtc?tgttagtagt?ttatgcattt?attttcttgc 540

acggaagaat?gaaaatgggt?ttaaacaatt?aaagagtgtg?gtccatatga?atccacttta 600

gccaactttt?ttttccccag?atgatgccta?gattagctgt?gaatcacaat?aaatatttca 660

ttcaaaacca?caagctaatc?actcatgcta?aaagttttgt?gtccattctt?gaatcactat 720

cactttagtc?ttagtagcta?catatataaa?accactcatt?gaggattgag?a 771

 

<210>4

<211>591

<212>DNA

＜213〉paddy rice (Oryza sativa)

<220>

<221>gene

<222>(1)..(591)

<223>

<220>

<221>promoter

<222>(1)..(591)

<223>

<400>4

gcctctcaag?attgcagtac?aacaaaaaaa?aaaagtaggt?gaaagactga?acgtgcacat 60

caaagctatc?ttatatatga?attttgtttt?tcagaaaact?ccaatatatg?cttgatcagg 120

cacgtatata?cagagaacgc?acacgttatt?taattttctg?aatctagtgt?tgccgctttc 180

tttactgcat?actttgtagc?ttgcagagca?ttctttttaa?caatatttgt?tctgaagtat 240

catttttttg?tttatcaaat?tggaccacta?tacaaaaagc?catggaaata?aagatcaaaa 300

tatttttgtt?gccttccata?actatgtgtc?tgttagtagt?ttatgcattt?attttcttgc 360

acggaagaat?gaaaatgggt?ttaaacaatt?aaagagtgtg?gtccatatga?atccacttta 420

gccaactttt?ttttccccag?atgatgccta?gattagctgt?gaatcacaat?aaatatttca 480

ttcaaaacca?caagctaatc?actcatgcta?aaagttttgt?gtccattctt?gaatcactat 540

cactttagtc?ttagtagcta?catatataaa?accactcatt?gaggattgag?a 591

 

<210>5

<211>281

<212>DNA

＜213〉paddy rice (Oryza sativa)

<220>

<221>gene

<222>(1)..(281)

<223>

<400>5

gccttccata?actatgtgtc?tgttagtagt?ttatgcattt?attttcttgc?acggaagaat 60

gaaaatgggt?ttaaacaatt?aaagagtgtg?gtccatatga?atccacttta?gccaactttt 120

ttttccccag?atgatgccta?gattagctgt?gaatcacaat?aaatatttca?ttcaaaacca 180

caagctaatc?actcatgcta?aaagttttgt?gtccattctt?gaatcactat?cactttagtc 240

ttagtagcta?catatataaa?accactcatt?gaggattgag?a 281

 

<210>6

<211>186

<212>DNA

＜213〉paddy rice (Oryza sativa)

<220>

<221>gene

<222>(1)..(186)

<223>

<220>

<221>promoter

<222>(1)..(186)

<223>

<400>6

tatgaatcca?ctttagccaa?cttttttttc?cccagatgat?gcctagatta?gctgtgaatc 60

acaataaata?tttcattcaa?aaccacaagc?taatcactca?tgctaaaagt?tttgtgtcca 120

ttcttgaatc?actatcactt?tagtcttagt?agctacatat?ataaaaccac?tcattgagga 180

ttgaga 186

 

<210>7

<211>155

<212>DNA

＜213〉paddy rice (Oryza sativa)

<220>

<221>gene

<222>(1)..(155)

<223>

<220>

<221>promoter

<222>(1)..(155)

<223>

<400>7

ccagatgatg?cctagattag?ctgtgaatca?caataaatat?ttcattcaaa?accacaagct 60

aatcactcat?gctaaaagtt?ttgtgtccat?tcttgaatca?ctatcacttt?agtcttagta 120

gctacatata?taaaaccact?cattgaggat?tgaga 155

 

<210>8

<211>98

<212>DNA

＜213〉paddy rice (Oryza sativa)

<220>

<221>gene

<222>(1)..(98)

<223>

<220>

<221>promoter

<222>(1)..(98)

<223>

<400>8

gctaatcact?catgctaaaa?gttttgtgtc?cattcttgaa?tcactatcac?tttagtctta 60

gtagctacat?atataaaacc?actcattgag?gattgaga 98

 

<210>9

<211>718

<212>DNA

＜213〉paddy rice (Oryza sativa)

<220>

<221>gene

<222>(1)..(718)

<223>

<220>

<221>CDS

<222>(128)..(610)

<223>

<400>9

actcatgcta?aaagttttgt?gtccattctt?gaatcactat?cactttagtc?ttagtagcta 60

catatataaa?accactcatt?gaggattgag?aataattaaa?attttctgca?acaacaatag 120

aaagaaa?atg?gct?ttc?atc?aag?gta?gtg?ttc?tcg?gtg?ttg?ctc?ccg?gta 169

Met?Ala?Phe?Ile?Lys?Val?Val?Phe?Ser?Val?Leu?Leu?Pro?Val

1 5 10

gtt?gtc?tcc?atg?ctc?gtg?gca?acg?acg?aca?atg?gcg?gat?cac?cgt?ggc 217

Val?Val?Ser?Met?Leu?Val?Ala?Thr?Thr?Thr?Met?Ala?Asp?His?Arg?Gly

15 20 25 30

cag?gtg?gtt?tat?acc?ccc?ggg?cag?cta?tgc?gct?gcc?gga?cgg?ggc?tac 265

Gln?Val?Val?Tyr?Thr?Pro?Gly?Gln?Leu?Cys?Ala?Ala?Gly?Arg?Gly?Tyr

35 40 45

ccg?atg?tac?ccg?ctg?ccc?cgc?tgc?cgg?gcg?ctg?gcg?aag?cgc?cag?tgc 313

Pro?Met?Tyr?Pro?Leu?Pro?Arg?Cys?Arg?Ala?Leu?Ala?Lys?Arg?Gln?Cys

50 55 60

gcc?ggc?ggt?gcc?gtg?gac?gag?caa?gtc?cgg?caa?gac?tgc?tgc?cgg?cag 361

Ala?Gly?Gly?Ala?Val?Asp?Glu?Gln?Val?Arg?Gln?Asp?Cys?Cys?Arg?Gln

65 70 75

ctc?gcc?gcc?atc?gac?gac?agc?ttc?tgt?agg?tgc?ccc?gcg?ctg?agc?cac 409

Leu?Ala?Ala?Ile?Asp?Asp?Ser?Phe?Cys?Arg?Cys?Pro?Ala?Leu?Ser?His

80 85 90

atg?ttg?gtt?gga?atg?tac?aag?gag?ctc?ggt?gca?ccc?gct?aaa?ggg?caa 457

Met?Leu?Val?Gly?Met?Tyr?Lys?Glu?Leu?Gly?Ala?Pro?Ala?Lys?Gly?Gln

95 100 105 110

ccc?atg?gac?gag?gtg?ttc?cct?ggc?tgc?cgg?aga?ggc?gac?atg?aaa?cgc 505

Pro?Met?Asp?Glu?Val?Phe?Pro?Gly?Cys?Arg?Arg?Gly?Asp?Met?Lys?Arg

115 120 125

gtg?gcg?gcg?agc?ctc?ccg?gcg?ttt?tgc?aat?gta?gac?att?ccc?att?ggc 553

Val?Ala?Ala?Ser?Leu?Pro?Ala?Phe?Cys?Asn?Val?Asp?Ile?Pro?Ile?Gly

130 135 140

att?ggt?ggt?gtt?tgc?tac?tgg?ctg?agt?tat?cct?atg?aac?ccc?gcg?act 601

Ile?Gly?Gly?Val?Cys?Tyr?Trp?Leu?Ser?Tyr?Pro?Met?Asn?Pro?Ala?Thr

145 150 155

ggc?cac?taa?gaaatagcta?ccttgtgtgt?cttgtgtggt?acctatataa 650

Gly?His

160

ttagtgtttc?cttttgcttg?gaaacatata?tatgtggtga?ataaatgatg?aactctgata 710

gtcttatg 718

 

<210>10

<211>160

<212>PRT

＜213〉paddy rice (Oryza sativa)

<400>10

Met?Ala?Phe?Ile?Lys?Val?Val?Phe?Ser?Val?Leu?Leu?Pro?Val?Val?Val

1 5 10 15

Ser?Met?Leu?Val?Ala?Thr?Thr?Thr?Met?Ala?Asp?His?Arg?Gly?Gln?Val

20 25 30

Val?Tyr?Thr?Pro?Gly?Gln?Leu?Cys?Ala?Ala?Gly?Arg?Gly?Tyr?Pro?Met

35 40 45

Tyr?Pro?Leu?Pro?Arg?Cys?Arg?Ala?Leu?Ala?Lys?Arg?Gln?Cys?Ala?Gly

50 55 60

Gly?Ala?Val?Asp?Glu?Gln?Val?Arg?Gln?Asp?Cys?Cys?Arg?Gln?Leu?Ala

65 70 75 80

Ala?Ile?Asp?Asp?Ser?Phe?Cys?Arg?Cys?Pro?Ala?Leu?Ser?His?Met?Leu

85 90 95

Val?Gly?Met?Tyr?Lys?Glu?Leu?Gly?Ala?Pro?Ala?Lys?Gly?Gln?Pro?Met

100 105 110

Asp?Glu?Val?Phe?Pro?Gly?Cys?Arg?Arg?Gly?Asp?Met?Lys?Arg?Val?Ala

115 120 125

Ala?Ser?Leu?Pro?Ala?Phe?Cys?Asn?Val?Asp?Ile?Pro?Ile?Gly?Ile?Gly

130 135 140

Gly?Val?Cys?Tyr?Trp?Leu?Ser?Tyr?Pro?Met?Asn?Pro?Ala?Thr?Gly?His

145 150 155 160

Claims (8)

1. rice endosperm specific expression promoter EnP2, its nucleotide sequence is shown in sequence table SEQ ID NO:1.

2. rice endosperm specific expression promoter EnP2-967, its nucleotide sequence is shown in sequence table SEQ ID NO:2.

3. rice endosperm specific expression promoter EnP2-771, its nucleotide sequence is shown in sequence table SEQ ID NO:3.

4. rice endosperm specific expression promoter EnP2-591, its nucleotide sequence is shown in sequence table SEQ ID NO:4.

5. rice endosperm specific expression promoter EnP2-281, its nucleotide sequence is shown in sequence table SEQ ID NO:5.

6. rice endosperm specific expression promoter EnP2-186, its nucleotide sequence is shown in sequence table SEQ ID NO:6.

7. rice endosperm specific expression promoter EnP2-155, its nucleotide sequence is shown in sequence table SEQ ID NO:7.

8. the application of each described promotor of claim 1-7 in the rice genetic improvement.

Images