CN104711238B - A kind of Rice Drought Resistence albumen OsWS1 and its encoding gene and purposes - Google Patents
A kind of Rice Drought Resistence albumen OsWS1 and its encoding gene and purposes Download PDFInfo
- Publication number
- CN104711238B CN104711238B CN201510144668.8A CN201510144668A CN104711238B CN 104711238 B CN104711238 B CN 104711238B CN 201510144668 A CN201510144668 A CN 201510144668A CN 104711238 B CN104711238 B CN 104711238B
- Authority
- CN
- China
- Prior art keywords
- osws1
- plant
- rice
- genes
- drought
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1025—Acyltransferases (2.3)
- C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
Abstract
The invention discloses a kind of Rice Drought Resistence albumen OsWS1 and its encoding gene and purposes.Present invention firstly discovers that OsWS1 genes are a member in rice over-long chain fatty acid synthetase gene family member (shown in its nucleotide sequence such as SEQ ID NO.1), overexpression OsWS1 genes can improve the content of over-long chain fatty acid in rice leaf, the wax layer thickness for increasing blade surface, to increase the resistance of plant pair arid.Therefore OsWS1 genes can be applied to control plant to drought tolerance, cultivate and applied in plant such as rice drought-enduring variety.
Description
Technical field
The invention belongs to plant genetic engineering fields, and in particular to a kind of Rice Drought Resistence albumen OsWS1 and its encoding gene
And purposes.
Background technology
Rice (Oryza sativa L) is one of most important cereal crops in the world and China, is more than half people of the world
The staple food of mouth, while rice is also the maximum crops of water consumption, rice in China industrial water amount accounts for agricultural water total amount
65% or more [Mayra Rodriguez, Eduardo Canales, Carlos J.Borroto, et
a1.Identification ofgenes induced upon water·deficit stress in a drought-
Tolerant rice cultivar.Journal of Plant Physiology, 2006,163：577-584.Sasaki T,
Burr B.International rice genome sequencing projoct：theefort to completely
Sequence the rice genome.Cur Opin PlantBiol, 2000,3 (2)：138-141.].With global warming
The aggravation of trend, the country relatively deficient as water resource of China, water shortage problem are on the rise.According to statistics, arid causes water
The underproduction of rice can be more than the summation of the underproduction caused by other factors, seriously affect the Chan Lianghepinzhi [ of rice;Mark woods recklessly, Lee's name
Enlightening, Wan Yong wait the China Rice Resistance morning Identification method and index progress Agriculture in Jiangxi journals, 2005, l7 (2)：56-60].
A large amount of true China area climate arids that also disclose are aggravating, and increase warm notable.Grain subtracts caused by water shortage every year for China
Production is up to more than 50 hundred million kilograms, and average annual arid disaster area is up to 26,370,000 hm2, economic loss is up to 120,000,000,000 yuan caused by water shortage.It grinds
Study carefully the drought resisting mechanism of rice, and filters out the rice varieties of drought resisting, not only to ensureing that Rice Production is of great significance, and also it is right
Improving water utilization rate has important directive significance.
Drought stress has generation, damage to grow and seriously restrict crop yield in many areas in the world, and drought impact is made
Object moisture absorption, mineral nutrition transport and metabolism, the distribution of photosynthesis and photosynthate.All plants of nature all by
To drought impact, from industrial crops to field crop, aquatic crops to non-irrigated kind of crop, it is all different from unicellular lower eukaryote to higher organism
Degree by drought impact.Arid can influence all one's life of plant since seed germination.
Rice as important field crop, physiological ecological, blossom and bear fruit, grain quality is all answered by drought stress
Damage.Arid almost influences all vital movements of plant, however plant has evolved a series of drought resisting mechanism, ensures
Under Water Stress Conditions, its drought-resistant ability is improved through a variety of ways.Such as：Dissipating for moisture is reduced by adjusting pore opening
It loses, generates osmotic adjustment and increase root tissue water status absorption, pass through the new old generation that the peroxide in statocyte maintains plant
It thanks, maintains the selection permeability of cell membrane, by reducing cell growth hormone, increasing degeneration-resistant hormone makes its drought-resistant ability increase.Separately
Outside, plant can also generate degeneration-resistant albumen, increase the drought-resistant ability of plant.Plant is generally rung by the form of three interactions
Answer drought stress：One：Cause the change of some gene expressions；Two, generate or reduce the expression of some albumen with directly in response to
Drought stress is to reduce the damage to plant；Three, by the variation of Physiology and biochemistry to enhance the tolerance of plant pair arid.
Currently, the clone of Rice Drought Resistence related gene and transgenosis have won initial success.It is relevant with Rice Drought Resistence earliest
Transfer-gen plant is by (XuD.P.DuanX.L., WangB.Y., eta1.Expression of a late such as Xu
embryogenesis abountant protein gene,HAV from bayler confers tolerance to
water efficient and salt in transgenic rice.PlantPhysiology,1996,l10(1):249-
257.) it obtains, HVAI channel genes rice is obtained a large amount of transfer-gen plants by they.These transgenic lines under dry early stress
System can keep high leaf r elative water content, and increment reduction is small, and HVAI albumen can protect cell membrane to escape injury, and make its life
Long rate is substantially better than wild type control, drought resistance enhancing.
DREB can be combined specifically with DRE cis-acting elements, when plant is by Drought Stress, can activate stress
Inducible gene expression makes plant be resistant to the influence of drought stress.Research has proven in DREB transcription factor families at present
OsDREB1A, OsDREB1B, OsDREB1C, OsDREB1D and OsDREB2A can regulate and control and plant strain growth and light in drought stress
Conjunction ability has the expression of correlation gene, to improve plant drought-resistance ability (Mao Donghai, Chen Caiyan,
Colinearity and Similar.Expression Pattern of Rice DREB1s Reveal Their
Functional Conservation in the Cold-Responsive Pathway.PLoS ONE,2012,7(10):
e47275).SNAcl is then to belong to NAM, ATAF and CUC to be stranded AC) one of family transcription is because of overexpression in rice
SNAcl, can significantly improve setting percentage of the plant under Drought Stress and yield (Honghong Hu, Mingqiu Dai,
Jialing Yao,Benze Xiao,Xianghua Li,Qifa Zhang,Lizhong Xiong.Overexpressing a
NAM,ATAF,and CUC(NAC)transcription factor enhances drought resistance and
salt tolerance in rice.P NAS,2006,103(35):12987-12992.)
In stress during drought stress, the transcription factors such as controlling gene coding DREB, MYB/MYC, bZIP albumen are its corresponding
The cis-acting elements in responses of drought stress target gene promoters region combines, the expression of activated gene, to adjust thousand drought of plant pair
The adaptation of adverse circumstance.The gene that is functionally correlated include LEA protein (embryonic development late period Abundant protein) gene, channel protein gene,
Osmotic adjustment (such as proline, trehalose, glycine betaine, polyamines) catalyzing enzyme etc..
Invention content
The first purpose of the invention is to provide it is a kind of can be used for improve plant drought O- acyltransferases OsWS1 and its
Encoding gene-anti-drought gene OsWS1.
Patent of the present invention builds OsWS1 genes using a new fats acid synthase gene OsWS1 of rice as research object
Overexpression vector OsWS1-OE, the genetic transforming method mediated using Agrobacterium EHA105, normal round-grained rice is imported by overexpression vector
11 are spent in rice varieties, finally obtain OsWS1 genes overexpression 42 plants of tissue-cultured seedling, as a contrast by normal japonica rice variety flower
16 plants of the tissue-cultured seedling of 11 callus differentiation, is all planted in experimental plot.During obtained T2, T3 are relatively compareed for OsWS1 gene transgenics plant
Spend 11, the content of over-long chain fatty acid increases in blade, and the wax thickness on exocuticle surface increases, and verruca becomes more, thickens,
Chlorophyll mobility and rate-of-loss of coolant reduce, and the resistance of plant pair arid dramatically increases, and illustrate OsWS1 genes by influencing wax
Content and structure of improve the function of plant drought resisting.OsWS1 gene interference expression vectors are built by RNAi technology
PTCK303-OsWS1-RNAi, the genetic transforming method mediated using Agrobacterium EHA105, by interference vector pTCK303-
OsWS1-RNAi is imported in normal japonica rice variety and is spent 11, finally obtains the tissue-cultured seedling 24 containing OsWS1 gene interference expression vectors
Strain, it is transgenic line that PCR, which identifies 11 strains,.The expression quantity that OsWS1 genes are detected on transcriptional level, finds T2, T3
Expression for OsWS1 genes in the RNAi plant in transfer-gen plant is remarkably decreased.And the overlength in rotaring gene plant blade
Chain fatty acid content reduces, and the wax on exocuticle surface is thinning, and verruca becomes smaller, and tails off, chlorophyll mobility and dehydration speed
Rate increases, and the resistance of plant pair arid significantly reduces.
The O- acyltransferases OsWS1 of the present invention, which is characterized in that its amino acid sequence is as shown in SEQ ID NO.2.
Second object of the present invention is to provide a kind of anti-drought gene OsWS1, which is characterized in that its nucleotide sequence is such as
Shown in SEQ ID NO.1.
Expression vector containing above-mentioned anti-drought gene OsWS1.
Engineering bacteria containing above-mentioned expression vector.
The engineering bacteria is preferably Escherichia coli or Agrobacterium.
Third object of the present invention is to provide above-mentioned anti-drought gene OsWS1 in control plant to answering in drought tolerance
With.
It is preferred that applications of the above-mentioned anti-drought gene OsWS1 in cultivating drought tolerance in plants kind.
It is preferred that the plant includes monocotyledon and dicotyledon.
Further preferably, the plant is rice, wheat, corn, cucumber, tomato, willow, turfgrass or clover.
Fourth object of the present invention is to provide the interference segment for anti-drought gene OsWS1, which is characterized in that its nucleosides
Acid sequence is as follows：5'-TGATGTTCTACTACATCACGCTGCGGCCGCCGACGGGGGAGGCGACCGCGTTCTTCACGCTGC
ACGGGGCGCTCGCCGTGGCGGAGGGGTGGTGGGCGGCGCGCGAGGGGTGGCCGCGGCCGCCGCGCCCCGTCGCGACC
GCGCTGACGCTGGCGCTCGTCATGTCCACGGGGT-3’。
Fifth object of the present invention is to provide above-mentioned interference segment answering in the expression of regulation and control anti-drought gene OsWS1
With.
Present invention firstly discovers that OsWS1 genes are a member in rice over-long chain fatty acid synthetase gene family member,
Overexpression OsWS1 genes can improve the content of over-long chain fatty acid in rice leaf, increase the wax layer thickness of blade surface,
To increase the resistance of plant pair arid.Therefore OsWS1 genes can be applied to control plant to drought tolerance, cultivate and plant
It is applied in object such as rice drought-enduring variety.
Description of the drawings
Fig. 1 is the overexpression vector OsWS1-OE carrier figures of structure.
Fig. 2 is that the cDNA of gene OsWS1 is connected into the result figure that EcoRI digestions are used after pGEM T-easy carriers, and M is
Marker, 1 is the pGEM T-easy containing gene OsWS1.
Fig. 3 is result figures of the overexpression vector OsWS1-OE after HindIII and BamHI double digestions, and M Marker, 1 is
Overexpression vector OsWS1-OE after digestion.
Fig. 4 is the PCR qualification result figures of overexpression vector OsWS1-OE Agrobacteriums.M：marker；1,2,3,4 respectively represent
It is a different clone.
Fig. 5 is interference carrier experiment pTCK303 carrier figures used, a：PTCK303 maternal carrier schematic diagrames；b：
OsWS1RNAi interferes segment to be inserted into schematic diagram.
Fig. 6 is to use SpeI and SacI digestion qualification result figures after the reversed segment of interference carrier is inserted into, and M marker, 1 is sample
Product.
Fig. 7 is that the whole carrier of interference carrier uses SpeI and SacI (1) and BamHI and KpnI (2) digestion qualification result respectively
Figure.
Fig. 8 is interference carrier Agrobacterium PCR qualification results.M：marker；1,2,3,4 respectively represent four different Dan Ke
It is grand.
Fig. 9 is the relative quantification expression schematic diagram of OsWS1 in T2 transfer-gen plants, WT：11 are spent in control；OsWS1-ox：
OsWS1 genes overexpress plant；OsWS1-RNAi：OsWS1 interference expression plant, 4-1,6-4,8-4,11-7,14-4,1-1,4-
14,7-7,8-1,11-2 represent different transgenic lines.It can be seen that from this result and turn in overexpression OsWS1 genes
The expression of OsWS1 genes significantly improves in gene plant, and in OsWS1RNAi transfer-gen plants, the expression of OsWS1 genes is notable
Decline.
Figure 10 is OsWS1:The common location result figure of EGFP fusion proteins, EGFP：Control；ER-rk：ER labelled proteins,
EGFP：EGFP fluorescence；OsWS1:EGFP：OsWS1 merges EGFP carriers；merged：The two merges；It can be seen that from this result
For OsWS1 localization of gene expression in endoplasmic reticulum, the wax synzyme synthesized by it is synthesized in endoplasmic reticulum,.
Figure 11 is the relative quantification expression of results of OsWS1 genes during ABA and Osmotic treatment.As can be seen from the results
OsWS1 genes by ABA and arid induced expression, and OsWS1 genes after drought-induced rehydration its relative expression again gradually
It is restored to normal level.A：The relative expression of OsWS1 genes after various concentration ABA processing different times；B：Arid and rehydration mistake
The relative expression of OsWS1 genes in journey.
Figure 12 is wax component total content, aliphatic acid and long chain fatty acids in different transfer-gen plants and adjoining tree blade
The comparison of content.A：The comparison of wax total content.Total wax content in OsWS1 overexpression plant is increased slightly than control, and
Total wax content in interference expression plant is declined slightly compared with control.B：The comparison of long chain fatty acids.To C20 to C34 in blade
Long-chain measure discovery with GC-MS methods, the long-chain fatty acid content overexpressed in OsWS1 transfer-gen plants is significantly higher than
Control, and interfere the long-chain fatty acid content in expression OsWS1 transfer-gen plants to be substantially less than and compare.C：It is fatty in plant leaf blade
Acid content comparison result.From result find out the content of C16 and C18 aliphatic acid be remarkably decreased in OsWS1 overexpresses plant and
It is dramatically increased in RNAi transfer-gen plants.The long-chain fatty acid content of C20-C34 is then on the contrary, in the transgenosis for overexpressing OsWS1
Content in plant dramatically increases, and the content in RNAi plant significantly reduces.WT：11 are spent in control；OsWS1-ox：
OsWS1 genes overexpress plant；OsWS1-RNAi：OsWS1 interference expression plant.
Figure 13 is the GC-MS measurement results of n-alkane substance and aldehyde material in different plants.A：N-alkanes hydro carbons
Substance GC-MS results.Test result finds that content of the n-alkane substance content of C23 to C32 in transfer-gen plant does not have
It changes.B：Aldehyde material GC-MS results.Test finds the content of C26 to the C34 aldehyde materials extracted in transfer-gen plant
It is not significantly different in control.The result shows that OsWS1 genes only take part in the extension of long chain fatty acids.WT：Flower in control
11；OsWS1-ox：OsWS1 genes overexpress plant；OsWS1-RNAi：OsWS1 interference expression plant.
Figure 14 is plant leaf and stem surface wax structural scan Electronic Speculum observation result.WT：11 are spent in control；OsWS1-
ox：OsWS1 genes overexpress plant；OsWS1-RNAi：OsWS1 interference expression plant；Leaf：Leaf；Stem：Stem.It can from result
To find out.OsWS1 overexpresses rotaring gene plant blade and the granular wax protrusion of wart on stem surface obviously relatively compares the increasing of big and density
Add (shown in white arrow), and RNAi plant leafs and the granular wax protrusion of the wart on stem surface obviously relatively compare less, and it is small.
Figure 15 is the Transmission electron microscopy result of plant leaf epicuticle, mesophyll cell and exposore surface.
Adaxial surface：Epicuticle；Mesophyll cell：Mesophyll cell；Pollen：Pollen, CW：Cell wall (cell
Wall), WT：11 are spent in control；OsWS1-ox：OsWS1 genes overexpress plant；OsWS1-RNAi：OsWS1 interference expression is planted
Strain.From result of study we can see that：The wax coat of overexpression OsWS1 rotaring gene plant blade upper table outer cortexes relatively compares thickness
And it is fine and close (shown in black triangle), the thickness of mesophyll cell and pollen cell wall hands over control thin, also contains very on cell wall
The grease not being fully used mostly (white star position) on wall.The thickness of cell wall is thinning in RNAi transfer-gen plants,
Quality is loose, and exposore and inner wall have many discontinuous tiny tomographies (shown in the black triangle of unfilled corner).
Figure 16 is that OsWS1 overexpresses transfer-gen plant compared with the leaf green extract content and rate-of-loss of coolant of control.A：Ye Lv
Plain extract content.The extract content of OsWS1 overexpressions rotaring gene plant blade Determination of Chlorophyll obviously relatively compares slow as can be seen from the results,
And in RNAi plant then in contrast.It proves：The expression of OsWS1 genes is distributed shadow by influencing the wax of plant cell wall surface
Foliage green mobility in cell is rung.B：Rate-of-loss of coolant compares.OsWS1 transfer-gen plant leaves are overexpressed as can be seen from the results
The rate-of-loss of coolant of piece obviously relatively compares slowly, and in RNAi plant then in contrast.It proves：The expression of OsWS1 genes passes through influence
The wax distribution of plant cell wall surface affects rate-of-loss of coolant.
Figure 17 is transfer-gen plant and the drought tolerance comparative experiments that compares.Seed takes growing way several consistent after sprouting
Seedling normal growth is in Culture basin, and (A) stops watering 2 weeks (B) rehydration afterwards after 4 weeks, and (C) counts depositing for plant after rehydration 3 days
Motility rate (D).Three controls are done every time, have carried out 2 repetitions altogether.From statistical result it can be seen that overexpression OsWS1 plant tables
Reveal and the tolerance of arid is shown higher than control, and the tolerance of RNAi plant pair arids relatively compares and declines now, WT：Control
In spend 11；OsWS1-ox：OsWS1 genes overexpress plant；OsWS1-RNAi：OsWS1 interference expression plant.
Specific implementation mode
The following examples are further illustrations of the invention, rather than limiting the invention.
Specific experimental method is not specified in following Examples, can conventionally carry out.Such as J. Pehanorm Brookers
《Molecular Cloning:A Laboratory guide》, F. Ao Sibai etc.《Fine works molecular biology experiment guide》Described in condition, or according to production used
The operation instruction of manufacturer quotient.
Embodiment 1：The functional verification and application of OsWS1 genes
One, the structure of genetic transformation carrier
Overexpression vector used carrier is the OsWS1-OE of this laboratory structure.OsWS1-OE is commonly to plant in the world
Object genetic transformation carrier pCAMBIA3301 (Sun et al.Xa26, a gene conferring resistance to
Xanthomonas oryzae pv.oryzae in rice,encoding a LRR receptor kinase-like
Protein.Plant Journal.2004,37:It reconstructs, carries special with composing type and overexpression on the basis of 517-527)
The Agrobacterium-mediated genetic transformation carrier (Fig. 1) of the corn Ubiquitin promoters of sign.The purchase of pCAMBIA3301 carriers is certainly
The Australian laboratories CAMBIA (center for the Application of Molecular Biology to
International Agriculture), after replacing 35S promoter with corn ubiquitin promoters, it is named as
PXU3301, the technology for replacing promoter belong to Conventional wisdom, and those skilled in the art can realize according to Conventional wisdom.
11 RNA is spent in extraction rice, reverse transcription is at cDNA, with the primer (481900-cDNA3/F of enzyme enzyme site：
AAGCTTATGGCCGGCGGCGACCT, HindIII；481900-cDNA3/R：AGATCTCAAAGAAGACTCAAAGCCGAGTG,
BglII) amplification anti-drought gene OsWS1 (nucleotide sequence as shown in SEQ ID NO.1, the amino acid sequence of the albumen of coding
Row are as shown in SEQ ID NO.2), it then clones through TA and is connect with pGEMT-easy carriers, connection reaction：5 μ l of PCR product are carried
0.5 1 μ l of μ l, 2U T4ligase, 10 × buffer of body, total 10 μ l volumes, 16 DEG C of connection 3h.10 μ l connection products are taken, chlorine is used
Change calcium freeze-thaw method and go to Escherichia coli top10, adds 800ml LB, ammonia is applied to after recovery 1h, 6000rpm 5min centrifugal enrichment bacterium
The LB tablets of benzyl antibiotic, 37 DEG C overnight.Monoclonal is chosen, culture extracting plasmid, digestion identification, restriction enzyme digestion and electrophoresis figure such as Fig. 2 are expanded
It is shown.Then it is sequenced, is found through sequencing, anti-drought gene OsWS1 (nucleotide sequence as shown in SEQ ID NO.1) is inserted into
Into pGEMT-easy carriers.After sequencing is correct, connecting after HindIII the and BglII double digestions of the carrier after structure
It is connected in the good large fragment of pXu3301 digestions (using HindIII and BamHI double digestions), connection product is transformed into Agrobacterium sense
By state EHA105, plasmid is extracted, digestion (restriction enzyme digestion and electrophoresis figure is as shown in Figure 3) and PCR verify (PCR product electrophoretogram such as Fig. 4 institutes
Show), it is then sequenced, is found through sequencing, anti-drought gene OsWS1 is inserted into carrier pXu3301, is thus built
Carrier is named as OsWS1-OE, and the Agrobacterium bacterium solution of 700 μ l good vectors containing structure is taken to add 300 μ l, 50% glycerine mixings, -70 DEG C
It preserves.
Interference vector used carrier is the pTCK303-R1R2 of this laboratory structure.PTCK303-R1R2 is normal in the world
Genetic Transformation in Higher Plants carrier pTCK303 (ZHEN WANG et al.A Practical Vector for Efficient
Knock down of Gene Expression in Rice.Plant Molecular Biology Reporter.2004,
22:It is reconstructed on the basis of 409-417), carries the agriculture bacillus mediated of the Ubi promoters with composing type and overexpression feature
Genetic transformation carrier (Fig. 5).PTCK303 carriers are by Chinese Academy of Sciences's plant institute's molecule and Developmental Biology research center (Research
Center for M olecular and Developmental Biology) it give, which can also be from examination
Agent company buys, and belongs to the carrier of routine in the prior art.Select the anti-drought gene OsWS1 (cores as shown in SEQ ID NO.1
Nucleotide sequence) cDNA interference segment section, use 481900-RNAi/F
(GGGGTACCACTAGTCACTACATCACGCTGCGGC, KpnI and SpeI) and 481900-RNAi/R
(PCR reaction systems after (GGATCCGAGCTCACCCCGTGGACATGACGAG, BamHI and SacI) primer amplification：1 μ l of cDNA,
10mM dNTPs 2μl；481900-RNAi/F 2.0μl；481900-RNAi/R 2.0μl；10x E-Taq buffer 5.0μ
l；E-Taq 5U；Total 50 μ l volumes；PCR amplification program：94 DEG C of 3min, 94 DEG C 30 ', 56 DEG C 30 ', 72 DEG C 90 ', 35cycles,
72 DEG C of 10min), by the cDNA segments (OsWS1 RNAi cDNA) of acquisition (GGGGTACCACTAGTC
TGATGTTCTACTACATCACGCTGCGGCCGCCGACGGGGGAGGCGACCGCGTTCTTCACGCTGCACGGGGCGCTCGCC
GTGGCGGAGGGGTGGTGGGCGGCGCGCGAGGGGTGGCCGCGGCCGCCGCGCCCCGTCGCGACCGCGCTGACGCTGGC
GCTCGTCATGTCCACGGGGTTCTGGCTCTTCT) connection pGEM T-easy carriers, connection reaction：5 μ l of PCR product, carrier
0.5 μ l, 2U T4ligase, 10x buffer, 1 μ l, total 10 μ l volumes, 16 DEG C of connection 3h.10 μ l connection products are taken, chlorination is used
Calcium freeze-thaw method goes to Escherichia coli top 10, adds 800ml LB, ammonia benzyl is applied to after recovery 1h, 6000rpm 5min centrifugal enrichment bacterium
The LB tablets of antibiotic, 37 DEG C overnight.Monoclonal is chosen, culture extracting plasmid, sequencing identification are expanded.After sequencing is correct,
SpeI and SacI double digestions are used first, and first good cDNA segment of digestion is connected in the pTCK303 cut with SpeI and SacI
In carrier large fragment, Escherichia coli are converted, extract plasmid, (restriction enzyme digestion and electrophoresis figure is as shown in Figure 6) is identified in digestion.Select correct matter
Larger vector that grain is obtained with BamHI and KpnI double digestions and the OsWS1RNAi cDNA for being connected into pGEM T-easy (while being used
BamHI and KpnI double digestions) segment, connection, and Escherichia coli are converted, extraction plasmid enzyme restriction identification.Correct plasmid is converted
Agrobacterium competence EHA105, upgrading grain, digestion (its restriction enzyme digestion and electrophoresis figure is as shown in Figure 7) and PCR verify (PCR product electrophoretogram
As shown in Figure 8), the interference vector built, is named as：OsWS1-RNAi.Take the Agrobacterium of 700 μ l good vectors containing structure
Bacterium solution such as adds at 300 μ l, 50% glycerine mixings, -70 DEG C of preservations.
Two, genetic transformation
Genetic transforming method (Hiei etc., Efficient the transformation of mediated using Agrobacterium EHA105
rice(Oryza sativa L.)mediated by Agrobacterium and sequence analysis of the
boundaries of the T-DNA.Plant Journal,1994,6：271-282) by overexpression vector OsWS1-OE and dry
It relates to during carrier OsWS1-RNAi is directed respectively into normally and spends 11 rice varieties.Steps are as follows for Agrobacterium-mediated genetic transformation：
1, callus induces：Ripe rice paddy seed decladding, then successively with 70% alcohol treatment 1min, 5% secondary chlorine
Acid sodium solution sterilizes 50min；Sterilizing washing seed 4-5 times；Seed is placed on inducing culture；It is placed at dark and cultivates 5 weeks,
25-27 DEG C of temperature.
2, callus subculture：The embryo callus subculture for selecting glassy yellow, consolidation and relatively dry is put on subculture medium under dark
Culture 2 weeks, 25-27 DEG C of temperature.
3, preculture：The embryo callus subculture for selecting consolidation and relatively dry is put on pre-culture medium dark lower culture 4d, temperature
25-27℃。
4, Agrobacterium is cultivated：Preculture good vector containing structure on the YEB culture mediums with kanamycins and streptomysin
Agrobacterium EHA1052d, 28 DEG C of temperature；Agrobacterium is transferred in suspension medium, 2-4h is cultivated on 28 DEG C of shaking tables.
5, Agrobacterium is infected：The callus of preculture is transferred in the bottle to have sterilized；Adjust Agrobacterium suspension to
OD600=0.8-1.0；Callus is impregnated into 20min in agrobacterium suspension；It is blotted in transfer callus to the filter paper to have sterilized；So
After be placed on co-culture base on cultivate 3d, 19-20 DEG C of temperature.
6, callus washing and selection culture：The water washing callus that sterilizes is to invisible Agrobacterium；It is immersed in and contains head containing 400mg/L
30min in the aqua sterilisa of p0-357；It is blotted in transfer callus to the filter paper to have sterilized；It is selected in transfer callus to Selective agar medium
2-3 times, every time 2 weeks.
7, break up and take root：Kanamycin-resistant callus tissue is transferred on pre- differential medium and cultivates 5-7d at dark；The pre- differentiation of transfer
It in the callus to differential medium of culture, is cultivated under illumination (2000lx), 26 DEG C, 5-7 weeks of temperature.
8, it transplants：After after callus seedling differentiation and taking root, the remaining medium on root is washed off, by the children with good root system
Seedling is transferred to greenhouse, while moisture moistening was kept at initial several days.
9, the molecular Biological Detection of transfer-gen plant：After transfer-gen plant is grown up, clip leaf carries DNA, and designs
Primer carries out PCR detections to it first, finally obtains 42 plants of the tissue-cultured seedling of overexpression, and single plant sowing is simultaneously planted, until T2 generation inspections
Homozygous plants are measured, OsWS1 overexpression transfer-gen plants (OsWS1-OX) are thus obtained.Equally, design primer interferes OsWS1
Express transgenic plant (OsWS1-RNAi) carries out PCR detections, finally obtains OsWS1 interference express transgenic plant (OsWS1-
RNAi) 24 plants.The primer that OsWS1 overexpresses transfer-gen plant detection is bar-t/F：CACCATCGTCAACCACTAC；bar-t/
R：GCTGCCAGAAACCCAC, PCR product fragment length 431bp.OsWS1 interference express transgenic plant detection primer be
hpt-t/F：GATGTTGGCGACCTCGTATT；hpt-t/R：TCGTTATGTTTATCGGCACTTT, PCR product fragment length
517bp.Single plant sowing is simultaneously planted, after obtaining homozygous T2 and T3 for plant, with quantitative PCR technique in transfer-gen plant
The relative expression of OsWS1 genes analyzes.Quantification PCR primer is reference gene eEF-1a, primer sequence eEF-1a
qRT/F：GCACGCTCTTCTTGCTTTC；eEF-1a qRT/R：AGGGAATCTTGTCAGGGTTG, PCR product fragment length are
164bp；The primer sequence of OsWS1 is 40590-qRT/F：TCTGGGGACGGAGGTGGAA；40590-qRT/R：
AACATCAGCTCGTGCATGACG, PCR product fragment length 154bp.It is found by the quantitative PCR interpretation of result of two generation plant,
Expression stabilizations of the OsWS1 in OsWS1 genes overexpress transfer-gen plant dramatically increases, and (OsWS1 interferes table in RNAi plant
Up to transfer-gen plant (OsWS1-RNAi)) in stabilization be remarkably decreased expression (Fig. 9).
Three, wax synthesis related experiment verification in OsWS1 transfer-gen plants
Find that OsWS1 and EGFP is fixed altogether using EGFP expressing fusion protein combination laser co-focusing observation experiment analyses first
Position is in endoplasmic reticulum, it was demonstrated that the long-chain fat acid enzyme of OsWS1 synthesis is synthesized (Figure 10) in endoplasmic reticulum.With 0.5 μM and 5 μM
ABA handle 4 weeks sizes rice seedling after after 1,2,4,8,12,24 hours with quantitative PCR technique analysis OsWS1 genes table
It reaches, analysis finds induced expressions (Figure 11-A) of the OsWS1 by ABA.Grown under normal conditions 4 weeks in water-culturing rice nutrient solution
Seedling taking-up blotting paper suck dry moisture after sampled as in blotting paper, and in 0,0.5,1,2,4 hour, then again will be young
Seedling was sampled as in water planting liquid in 0.5,1,2,4,8,12 hour, and responses of the OsWS1 to arid, hair are analyzed with quantitative PCR technique
Existing OsWS1 is induced by arid, and it is horizontal (Figure 11-B) to be gradually restored to normal growth by its relative expression after rehydration.
According on the net to OsWS1 homologous genes analysis shows, it is a long-chain fat acid enzyme related gene.For
The function of verification OsWS1 genes, with GC-MS methods analyzes the various wax components in four leaf stage rice leaf.
It was found that total wax content in OsWS1 genes overexpression transfer-gen plant material slightly above compares, and OsWS1 interference expression turns base
Because total wax content in plant slightly below compares (Figure 12-A).The total content of long chain fatty acids (>=C20) is super in OsWS1 genes
It expresses in plant then now above control, control (Figure 12-B) is less than on the contrary in OsWS1 interferes express transgenic plant.It is right
The long-chain fatty acid content of C16-C34 is compared discovery, and the content of non-over-long chain fatty acid C16 and C18 is in overexpression OsWS1
Content in the transgenic line of gene relatively compares low, and the content of over-long chain fatty acid more than C18 turns base in OsWS1 genes
Because the content in material is all remarkably higher than control.OsWS1 interferes in express transgenic plant then on the contrary, the content of C16 and C18 is high
In control, it is more than the content of C18 over-long chain fatty acids less than control (Figure 12-C).C23 to C32 n-alkanes substance in blade
And the no difference of expression of the content of C26 to C34 aldehyde materials in OsWS1 transgenic lines.(Figure 13-A, B) is from GC-MS's
As a result it can be seen that OsWS1 is mainly the extension for affecting over-long chain fatty acid in plant, n-alkane and aldehydes are not involved in
The extension of the carbochain of substance.
Participate in participating in the extension of over-long chain fatty acid in plant to cell wall constituent to further verify OsWS1 genes
With the influence of structure, we are with transmission electron microscopy (TEM) and scanning electron microscopy (SEM) to blade, stem and flower
The wax on powder surface is observed.As a result, it has been found that overexpression OsWS1 genes lead to the excipuliform that plant leaf blade and stem surface cover
Wax protrusion increases, and becomes larger, and thicken (Figure 14), the cell wall thickening of mesophyll cell, on the cell wall of cortex and mesophyll cell
There are not extra lipid granule (Figure 15, shown in white star), the cell wall thickening (Figure 15) of pollen and mesophyll cell.And RNAi
Interfere the excipuliform wax protrusion on OsWS1 expression plant leafs and stem surface to reduce, becomes smaller, cell wall is loose, thinning.Exposore
There is discontinuous tiny slight crack (Figure 14,15) with inner wall.By plant physiology experiment to the leaf green mobility in material
Compare discovery with rate-of-loss of coolant, overexpress OsWS1 genes transgenic line chlorophyll mobility and rate-of-loss of coolant compared with
Control is significantly slow, and the chlorophyll mobility and rate-of-loss of coolant in OsWS1 interference express transgenic plant relatively compare significantly fast (figure
16A,B)。
The above experiment proves that OsWS1 genes are an over-long chain fatty acid synthetase related genes, it can influence plant
The extension of internal over-long chain fatty acid.To affect the structure and ingredient of plant cell wall and cortex wax component, pass through shadow
The wax structure for ringing epidermis affects the leaf green mobility and rate-of-loss of coolant of plant.
Further plant is planted and has carried out drought tolerance experiment to material in test in basin by we, this experiment have altogether into
2 secondary pollutants of having gone repeat to test, and experiment every time has 3 repetitions, concrete outcome as shown in figure 17.From experimental result, we send out
Existing, overexpression OsWS1 genes can significantly improve the tolerance of plant pair arid, and RNAi interference OsWS1 gene expressions are then notable
Reduce its tolerance to arid.Survival rate after Drying and rewatering is control ZH11:54%；OsWS1-OE:86%；OsWS1-
RNAi:29%.
Attached Agrobacterium-mediated genetic transformation reagent and formula
Reagent and solution abbreviation
6-BA (6-BenzylaminoPurine, 6-benzyladenine)；KT (Kinetin, kinetin)；NAA
(Napthaleneacetic acid, methyl α-naphthyl acetate)；IAA (Indole-3-acetic acid, heteroauxin)；2,4-D(2,4-
Dichlorophenoxyacetic acid, 2,4 dichlorophenoxyacetic acid)；AS (Acetosringone, acetosyringone)；CH
(Casein Enzymatic Hydrolysate, caseinhydrolysate)；HN (Hygromycin B, hygromycin)；DMSO
(Dimethyl Sulfoxide, dimethyl sulfoxide (DMSO))；N6 a great number of elements；N6 trace elements；MS a great number of elements；MS trace elements
The solution formula of tissue cultures
1) a large amount of Mu Ye [ of N6;10 times of concentrate (10 ×) ]
It dissolves one by one, is then settled to 1000ml at 20-25 DEG C.
2) N6 trace elements Mu Ye [100 times of concentrate (100 ×) ]
It is dissolved at 20-25 DEG C and is settled to 1000ml.
3)Fe2EDTA storing liquids (100 ×)
300ml distilled water and ferric sulfate (FeSO are added in one big conical flask4·7H2O)2.78g
300ml distilled water is added in another big conical flask and is heated to 70 DEG C, ethylenediamine tetra-acetic acid is then added
Disodium (Na2EDTA·2H2O)3.73g
It is mixed after they are all dissolved, 2h is kept in 70 DEG C of water-baths, be settled to 1000ml, 4 DEG C save backup.
4) vitamin storing liquid (100 ×)
Water is added to be settled to 1000ml, 4 DEG C save backup.
5) MS a great number of elements mother liquor (10 ×)
It is dissolved at 20-25 DEG C and is settled to 1000ml.
6) MS trace elements mother liquor (100 ×)
It is dissolved at 20-25 DEG C and is settled to 1000ml.
7) 2,4-D storing liquids (1mg/ml)
2,4-D 100mg
1ml 1N potassium hydroxide dissolves 5 minutes, 100ml is settled to after then adding 10ml distillation water dissolutions complete, in 20-25
It is preserved at DEG C.
8) 6-BA storing liquids (1mg/ml)
6-BA 100mg
1ml 1N potassium hydroxide dissolves 5 minutes, 100ml is settled to after then adding 10ml distillation water dissolutions complete, in 20-25
It is preserved at DEG C.
9) NAA storing liquids (1mg/ml)
NAA 100mg
1ml 1N potassium hydroxide dissolves 5 minutes, 100ml is settled to after then adding 10ml distillation water dissolutions complete, at 4 DEG C
It saves backup.
10) IAA storing liquids (1mg/ml)
IAA 100mg
1ml 1N potassium hydroxide dissolves 5 minutes, 100ml is settled to after then adding 10ml distillation water dissolutions complete, at 4 DEG C
It saves backup.
11) glucose stock liquid (0.5mg/ml)
Glucose 125g
Distillation water dissolution is settled to 250ml, is saved backup for 4 DEG C after sterilizing.
12) AS storing liquids
AS 0.392g
DMSO 10ml
In packing to 1.5ml centrifuge tubes, 4 DEG C save backup.
13) 1N potassium hydroxide storing liquid
Potassium hydroxide 5.6g
Distillation water dissolution is settled to 100ml, is saved backup at 20-25 DEG C.
14) KT storing liquids (1mg/ml)
KT 100mg
1ml 1N potassium hydroxide dissolves 5 minutes, 100ml is settled to after then adding 10ml distillation water dissolutions complete, in 20-25
It is preserved at DEG C.
Culture medium prescription
1) inducing culture
Add distilled water to 900ml, 1N potassium hydroxide adjusts pH value to 5.8, boils (100 DEG C) and is settled to 1000ml, point
It is attached to 50ml triangular flasks (25ml/ bottles), sealing sterilizing.
2) pre-culture medium
Add distilled water to 250ml, 1N potassium hydroxide adjusts pH value to 5.8, and sealing sterilizes.
Using preceding heating for dissolving culture medium and 5ml glucose stocks liquid and 250 μ l AS storing liquids is added, training is poured into packing
It supports in ware (25ml/ wares)
3) suspension medium
Add distilled water to 100ml, adjusts pH value to 5.4, be dispensed into the triangular flask of two 100ml, sealing sterilizing.
Use preceding addition 1ml glucose stocks liquid and 100ul AS storing liquids.
4) Selective agar medium
Add distilled water to 250ml, adjusts pH value to 6.0, sealing sterilizes.
Using preceding dissolving culture medium, the hygromycin and 500mg/L cephalosporins of 250 μ l 50mg/ml is added, pours into respectively
In culture dish (25ml/ wares).
5) pre- differential medium
Add distilled water to 250ml, 1N potassium hydroxide adjusts pH value to 5.9, and sealing sterilizes.
Using preceding dissolving culture medium, hygromycin and 500mg/L cephalosporins, packing that 250 μ l 50mg/ml are added pour into
In culture dish (25ml/ wares).
6) differential medium
Add distilled water to 900ml, 1N potassium hydroxide adjusts pH value to 6.0, and sealing sterilizes.
Claims (2)
1. anti-drought gene OsWS1 is influencing the application in rice body in the extension of over-long chain fatty acid, the anti-drought gene
Its nucleotide sequence of OsWS1 is as shown in SEQ ID NO.1.
2. segment is interfered to influence the application in rice body in the extension of over-long chain fatty acid, the nucleotide of the interference segment
Sequence is as follows：5'-TGATGTTCTACTACATCACGCTGCGGCCGCCGACGGGGGAGGCGACCGCGTTCTTCACGCTGCAC
GGGGCGCTCGCCGTGGCGGAGGGGTGGTGGGCGGCGCGCGAGGGGTGGCCGCGGCCGCCGCGCCCCGTCGCGACCGC
GCTGACGCTGGCGCTCGTCATGTCCAC。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510144668.8A CN104711238B (en) | 2015-03-30 | 2015-03-30 | A kind of Rice Drought Resistence albumen OsWS1 and its encoding gene and purposes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510144668.8A CN104711238B (en) | 2015-03-30 | 2015-03-30 | A kind of Rice Drought Resistence albumen OsWS1 and its encoding gene and purposes |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104711238A CN104711238A (en) | 2015-06-17 |
| CN104711238B true CN104711238B (en) | 2018-10-23 |
Family
ID=53410957
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510144668.8A Active CN104711238B (en) | 2015-03-30 | 2015-03-30 | A kind of Rice Drought Resistence albumen OsWS1 and its encoding gene and purposes |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104711238B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2352473A1 (en) * | 1998-12-04 | 2000-06-22 | Calgene Llc | Fatty acyl-coa: fatty alcohol acyltransferases |
-
2015
- 2015-03-30 CN CN201510144668.8A patent/CN104711238B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2352473A1 (en) * | 1998-12-04 | 2000-06-22 | Calgene Llc | Fatty acyl-coa: fatty alcohol acyltransferases |
Non-Patent Citations (6)
| Title |
|---|
| A superfamily of membrane-bound O-acyltransferases with implications for Wnt signaling;K. Holfmann;《Trneds in Biochemistry Sciences》;20000808;第25卷(第3期);第111-112页 * |
| Identification of the Wax Ester Synthase/Acyl-Coenzyme A:Diacylglycerol Acyltransferase WSD1 Required for Stem Wax Ester Biosynthesis in Arabidopsis;F. Li等;《Plant Physiology》;20080930;第148卷(第1期);摘要 * |
| Induced accumulation of cuticular waxes enhances drought tolerance in Arabidopsis by changes in development of stomata;J. Yang等;《Plant Physiology and Biochemistry》;20111231;第49卷;摘要 * |
| Purification of a jojoba embryo wax synthase, cloning of its cDNA, and production of high levels of wax in seeds of transgenic Arabidopsis;K. D. Lardizabal等;《Plant Physiology》;20000331;第122卷;摘要 * |
| Rice Genome Pseudomolecules Release 7，Chr4，LOC_Os04g40590;Y. Kawahara等;《Rice Genome Annotation Project》;20111031;序列 * |
| The TIGR Rice Genome Annotation Resource: improvements and new features;S. Ouyang等;《Nucleic Acids Research》;20061201;第35卷;摘要 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104711238A (en) | 2015-06-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zou et al. | OsEXPB2, a β-expansin gene, is involved in rice root system architecture | |
| CN109456982B (en) | Application of rice OsMYB6 gene and encoding protein thereof in drought resistance and salt resistance | |
| CN102124110A (en) | Transcriptional and post-transcription regulation of transcription factor for drought resistance | |
| CN109369789B (en) | ZmDRR206 protein and application of coding gene thereof in regulation and control of plant disease resistance and growth development | |
| CN110872598B (en) | Cotton drought-resistant related gene GhDT1 and application thereof | |
| CN110643618A (en) | Jatropha curcas MYB transcription factor JcMYB16 gene and application thereof in improving drought resistance of plants | |
| CN105198976B (en) | A kind of and plant adversity resistance related protein GsERF6 and its encoding gene and application | |
| Mahesh et al. | Constitutive overexpression of small HSP24. 4 gene in transgenic tomato conferring tolerance to high-temperature stress | |
| US20170022513A1 (en) | Gene implicated in abiotic stress tolerance and growth accelerating and use thereof | |
| CN106591324B (en) | Millet SiASR4 gene and application | |
| WO2016128998A1 (en) | Improved transgenic rice plants | |
| CN102747099A (en) | Application of rice gene OsbZIP46 in heat resistance and cold resistance regulation | |
| CN113929758B (en) | Potassium ion transporter protein HbRSAR1 and application thereof in regulating potassium transport of plants | |
| CN107904238A (en) | Thick boisiana high salt, drought-inducible promoter IpLEA PRO and its application | |
| CN104711238B (en) | A kind of Rice Drought Resistence albumen OsWS1 and its encoding gene and purposes | |
| CN103421788B (en) | Separation and utilization of stress response paddy rice promoter OsSN1P | |
| CN103421784A (en) | Identification and utilization of drought and high-salt induced paddy rice promoter PDS1 | |
| CN101831428B (en) | Separation clone and expression mode identification of promotor region of rice endosperm special expression gene | |
| CN107988222B (en) | Thick boisiana is with high salt, dehydration inducible promoter IpDHN-PRO and its application | |
| CN101831429B (en) | Promoter and expression mode identification of rice endosperm specific expression gene | |
| CN113293161A (en) | Clone and application of gene OsZIP9 for controlling rice zinc absorption | |
| CN116064652B (en) | Application of sugarcane raffinose synthase SsRS1 gene in improvement of drought resistance of plants | |
| CN102586247A (en) | Application of stress inducible promoter on controlling gene in drought induced expression | |
| CN107779471B (en) | Application of methanobacterium thermoautotrophicum MTH1745 gene in improving stress tolerance of plants | |
| US20150033408A1 (en) | Polypeptide involved in morphogenesis and/or environmental stress resistance of plant |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |