CN104328125B - Epidermal hair and cotton fiber specific promoter PLTP and its application - Google Patents

Abstract

The invention belongs to field of plant genetic, is related to epidermal hair and cotton fiber specific promoter PLTP and its application.The technical problem to be solved in the present invention is to provide a kind of new selection for the improvement of cotton variety.The technical scheme is that epidermal hair and cotton fiber specific promoter PLTP, its nucleotide sequence is as shown in SEQ ID No.1.Present invention also offers the expression vector containing the promoter PLTP.Present invention also offers the host containing the carrier.Present invention also offers applications of the described promoter PLTP in genetically modified plants are obtained.The promoter of the present invention can be used for tobacco and the improvement of cotton quality and the improvement of cotton fiber quality.

Description

Epidermal hair and cotton fiber specific promoter PLTP and its application

Technical field

The invention belongs to field of plant genetic, is related to epidermal hair and cotton fiber specific promoter and its answers With.

Background technology

Epidermal hair is distributed widely in terrestrial plant, is to be grown in plant epidermis tissue by plant epidermis cell development A kind of specialised structure.Its form is varied, by a cell or multiple cellularities；Have and produce branch, also have regardless of Branch；Some has body of gland, can secrete alkaloid (such as nicotine, terpenoid), some then Non-gland body (high English etc., Botany Gazettes 2011,46(1):119–127).Epidermal hair, which removes, has increase skin layer thickness, outside the function of reducing heat and moisture loss, also The infringement of insect and pathogen can be protected the plants from and reduce (the Szymanski et such as mechanical damage and ultraviolet light harms al.,2000).In addition, the epidermal hair of Chinese Ferns ciliate desert-grass (Pterisvittata) also there is height to absorb heavy metal The ability of chemical element, this undoubtedly has to improving the Initiative Defense of heavy metal pollution of soil and the utilization of new defensive measure Important enlightenment effect (Li et al., 2005).

From phytological angle, cotton fiber is also a kind of epidermal hair being grown on kind of skin.Cotton fiber is important Textile industry raw material, China are wollen fabrics consumption and big export country, and therefore, Cotton Production occupies weight in Chinese national economy The status wanted, while be also the important source of finance of peasant.The fiber quality of Cotton in China kind can be improved rapidly, directly closed It is the existence to industries such as the processing of the ups and downs and textile production, Weaving device manufacture, foreign export of Cotton in China industry and hair Exhibition.Although once achieving very big success in cotton variety improvement using traditional breeding method, in the past 20 years, world cotton Flower variety has reached a plateau in yield, is difficult to increase substantially again using existing genetic resources and breeding technique Output of cotton (Meredith W.R.Better Crops 200084 (4):6~9).It is fine by conventional breeding improvement cotton merely It is extremely difficult to tie up quality.Because：1) there is negative connect in the quality trait gene such as cotton fiber strength, fineness and lint yield Lock, conventional breeding methods are difficult to break this negative correlation genetically；2) cotton cultivar in China is mainly upland cotton, and Fine fiber Quality Gene be mostly derived from the plucked instrument Bai Shi cottons (fibre strength) of diploid, Gossypium anomalum (fibre strength and fineness) and Sea island cotton (fibre strength and fineness) of tetraploid etc., the utilizations of these merit genes is in conventional breeding by many limits System.Plucked instrument Bai Shi cottons and Gossypium anomalum are wild diploid species, after hybridizing with Tetraploid G. hirsutum, the agronomy that distant hybridization is brought be present The problems such as character is poor, offspring is difficult to stabilization, the cycle is oversize；Even it is all sea × land hybridization of tetraploid, equally exists offspring The problems such as separation is strong, and yield-quality bears linkage relationship still difficulty is broken (Beijing of 1998 cotton breeding of Pan family coltfoal 99~104：In Agricultural publishing house of state).Jeffrey Chen it is even contemplated that：- on the premise of yield is not influenceed to improve cotton fiber quality several It is impossible ‖ (Nature Biotechnology, 2011,29 (5):407-409).

It can break the genetic block between species using the method for genetic engineering, realize the orientation transfer of target gene, together When there is offspring to be easy to stable, the advantages that breeding cycle is short.Therefore, on the basis of clear and definite cotton fiber development molecule mechanism, Separation promotes the related gene of cotton fiber development, and then cotton fiber yield and quality is carried out using the means of genetic engineering Orderly improvement, it is always the focus in research both at home and abroad in recent years.

Promoter is the section of DNA molecule that RNA polymerase is capable of specific recognition, that is, the position for starting transcription. In the regulation and control of gene expression, transcription is the first step of gene expression, and the step of key one (Lewi, 2005 genes of expression regulation VIII 669~705, Beijing：Science Press).With the development of genetic engineering, it is often necessary to which structure is a kind of can high-level table Up to the expression vector of heterologous protein, promoter expressive site of the foreign gene in biology and expression are influenceed it is very big, It is the critical elements of gene engineering expression carrier.In the genetic engineering improvement of cotton fiber quality, foreign gene is generally required Specifically expressed in fibrocyte, so as to reduce influence of the foreign gene to cotton normal growth.Sent out in relevant cotton fiber In the gene regulation study mechanism educated, the means of generally use transgenosis, by target gene overexpression or expression silencing, so that Speculate its function.Therefore, when verifying its function by transgenic approach, the normal growth of meeting interference of transgene cotton, nothing is produced The result that method is expected, influence the accuracy and experiment progress of experimental result.If, can be with using cotton fiber specific promoter The expression of target gene is set to control during Fibre Development.Therefore, cotton fiber or plant skin specific promoter clone and its Expression analysis, the genetic engineering improvement of gene functional research and fiber quality to cotton fiber development, all with particularly significant Value.

Forefathers attempt to improve the quality of cotton fiber by biotechnology, such as by using fiber specific promoter By poly butyric synthetase series, specifically expressing improves the thermal property of cotton fiber in cotton fiber.The U.S. in 1996 The investigative test of the Agracetus companies cotton fiber of reporter engineering improvement first.Contain in cotton fiber through genetic transformation A kind of natural aliphatic polyester compound --- the poly-hydroxybutyric acids of D- (-) -3 (PHB).PHB polyester is a kind of natural Degradable thermal plastic (thermoplastic), its physicochemical property are similar to polypropylene.PHB is often deposited in the form of inclusion body It is to be used as carbon source inside some bacteriums.PHB biosynthesis is related to 3 kinds of enzymes：Beta-Ketothiolase, acetyl-CoA reductase and PHB synzyme.(John M E, Keller the G.Metabolic ProcNatlAcadSci, USA 1996,93 such as John： 12768-12773) acetyl-CoA reductase gene (phaB) and PHB synthase genes (phaC) are opened with fiber-specific respectively Mover E6 connects with FbL2A, plant expression vector is built, with gene gun technology, by phaB and phaC genes cotransformation to land In ground cotton cultigen DP50, successfully obtain while express the transgene cotton of phaB and phaC genes.Gus gene expression, Northern hybridization equimolecular testing result proves：PhaB and phaC are expressed in transgenosis cotton plant fiber.Fluorescence microscopy Mirror is consistent with transmission electron microscope observation to be shown：Contain PHB particles in transgenic cotton fibre cell.Transgenic cotton fibre is carried GC-MC analysis shows of thing are taken, are had in fiber and bacterium PHB mass spectrum identical materials, it was demonstrated that are synthesized in transgenic cotton fibre PHB macromolecular substances.HPLC analysis results show：Every gram of fiber dry weight g containing about 30-3440 μ PHB, PHB synthesis start from out Spend rear 10d, PHB contents do not reduce after fiber maturation.Using the acetyl-CoA synthetic macromolecule PHB of itself in plant, not Have and any influence is brought on cotton fiber quality such as length, intensity and mic value, but PHB presence improves fiber really Thermal insulation properties.But because in fiber PHB contents it is still relatively low, insulating properties improve amplitude it is still limited.

Another focus rather of concern is Auburn universities of the U.S. in terms of genetic engineering improves cotton fiber Daniell research work.Daniell (Henry Daniell, Beltwide Cotton Conferences, 1998,595 ~598) attempt that the albumen aggressiveness (protein-based of the repeat unit containing Val-Pro-Gly-Val-Gly will be encoded Polymers, PBPs) gene genetic converting cotton, cotton cells specifically expressing is gone out PBPs albumen.PBPs albumen is deposited extensively In nature, such as the elastin laminin in mammalian connective tissue, intramolecular contains the repetition being made up of multiple amino acid Sequentially, PBPs molecules often show stronger elasticity (10.6~10.9Pa of coefficient of elasticity).Daniell (Henry Daniell, Beltwide Cotton Conferences, 1998,595~598) think PHBs introducing cotton fiber, on the one hand it is expected to improve The elasticity and intensity of fiber, the raising of protein content in another aspect fiber, the enhancing of fibrous absorbent ability is affine with dyestuff Power also accordingly strengthens, and this is that current conventional breeding methods are not accomplished.

Above-mentioned case explanation utilizes technique for gene engineering, under fiber specific promoter control, specifically expressing target gene Can be with improving cotton fiber quality.Importance of the specific promoter in cotton gene Engineering Breeding, in Zhang et al. work Middle performance it is more prominent (Zhang, et al Nature Biotechnology, 2011,29:453-458).Forefathers pass through outer Source is applied, it is found that auxin has facilitation to Fibre Development, then John (1999) is by auxin IAA biosynthetic enzyme bases Because be placed in fiber specific promoter E6 control under, to by increase the auxin in fibrocyte improve output of cotton or Quality.As a result find, although IAA contents dramatically increase in transgene cotton fibrocyte, transgenic fibre cell is simultaneously It is not significantly improved.John it follows that：Overexpression auxin is grand to the length, intensity and mark of cotton fiber Value is without influence (John, M.E.1999).Zhang etc. carries out cellular localization using monoclonal antibody hybridization in situ technique to IAA, It was found that cotton fiber initiator cell middle and high concentration accumulation of the IAA on the day of blooming；And without Mutants of Fiber then without obvious IAA Signal, show that startings of the IAA to cotton fiber cell has a very important role.Cotton fiber cell is by ovule external integument Cells of superficial layer is formed through differentiation projection, elongation.Research shows that the epidermal cell of the only Post flowering inner process of 5 days (accounts for 10% or so) long fibre with spinning value can be budded into.They are according to-auxin in cotton fiber protrusion cell Middle this discovery of polarity distribution ‖, analyze the reason for forefathers are using auxin improvement cotton fiber failure.Thinking must be growth The characteristics of polarity distribution of element is developed with cotton fiber cell combines, using specific promoter to auxin synthase gene Accuracy controlling on progress privileged site, time and intensity, the purpose of improvement fiber production and quality can be reached.Then they Petunia and expression activity area will be come from ovule exocuticle, control the time of gene expression to arrive Post flowering 8 within 2 days before flowering It FBP7 promoters, merge and import in cotton with auxin biosynthesis gene iaaM.Transgene cotton phenotypic analysis knot Fruit shows that not only the increase of ovule surface fiber number, ginning outturn are improved, and fibre fineness is also improved, i.e. transgenosis The yield and quality of cotton fiber obtains synchronous improvement.With the promoter E6 used in John mainly in the Post flowering fiber of 5-24 days Expression is compared in cell, and the experiment has selected another to have the promoter of following features：1. the time expressed is to bloom First 2 days between Post flowering 5 days；2. the position expressed is not in the fibrocyte being differentiated to form, but ovule exocuticle Cell, it is fibrocyte to promote more ovule exocuticle differentiation and developments, and then improves the yield and quality of cotton；③ The intensity of expression is different, and the especially regulation and control to hormonal readiness should all the time, and otherwise growth and development of plants is abnormal, also results in the underproduction Or quality decline.Therefore, Pioneer Electronic Corp.'s division vice president Michael Lassner think, the research-clearly demonstrate that and open The selection of mover on character improvement importance ‖ (《Faculty of 1000》, on September 14th, 2011).The research-show The bright outlook ‖ of genetically modified crops of new generation (Jeffrey Chen, Nature Biotechnology, 2011,29 (5): 407-409)。

The huge potential value of cotton ovule epidermis or fiber specific promoter in the improvement of cotton gene engineering, makes This kind of specific promoter of cotton is cloned, but the promoter that can be used for cotton gene improvement at present is still very limited, because This, obtains more cotton fiber specific promoters, to the genetic engineering improvement of cotton fiber from now on and Fibre Development gene function Research is respectively provided with important value.

The content of the invention

The technical problem to be solved in the present invention is to provide a kind of new selection for the improvement of cotton variety.

The technical scheme is that epidermal hair and cotton fiber specific promoter PLTP, its nucleotide sequence such as SEQ ID Shown in No.1.

Present invention also offers the expression vector containing the promoter PLTP.

Specifically, described expression vector is plant expression vector.

Present invention also offers the host containing the carrier.

Specifically, described host is Agrobacterium tumefaciems.

Present invention also offers applications of the described promoter PLTP in genetically modified plants are obtained.

Present invention also offers applications of the described promoter PLTP in transgene cotton or transgene tobacco is obtained.

Present invention also offers application of the described expression vector in genetically modified plants are obtained.

Present invention also offers application of the described expression vector in transgene cotton or transgene tobacco is obtained.

Present invention also offers applications of the promoter PLTP in cotton fiber quality is improved.

Present invention also offers the preparation method of the genetically modified plants containing the promoter, comprise the steps：

(1) promoter of epidermal hair and cotton fiber specific is operably inserted in expression vector, structure plant expression Carrier；

(2) host is converted with the plant expression vector, obtains transformant；

(3) transformant is converted into plant, obtains genetically modified plants.

The epidermal tobacco wool and cotton flower fiber specific promoter subsequence of the present invention, it is at least containing shown in SEQ ID NO.1 Nucleotide sequence, the sequence be according to cotton GhLTP gene orders design primer, using PCR method, obtained length is 2467bp PLTP promoter sequences.Comprising the SKn-1 that multiple seed endosperms are relevant in the sequence, combined with myb transcription factor Site relevant MRE and MBS, relevant ABRE and TCA corresponding to the hormone such as ABA, SA are related to the induction such as adverse circumstance, anaerobism The TC enrichment regions MSA-like and cricadian related to circadian rhythm to ARE, cell cycle, multiple CAAT-box, A-box, A large amount of cis-regulating elements such as G-box, AAGAA-motif and the core sequence TATAA combined with TFII.By in transgenosis cigarette GUS histochemical stains detect in grass and transgene cotton, it was demonstrated that the promoter drives gus gene in transgene tobacco epidermal hair In and upland cotton fiber cell in specifically express.

In the present invention, using gene engineering method, PLTP promoters are inserted into suitable expression vector to obtain The plant expression vector containing promoter PLTP of the present invention.

Above-mentioned plant expression vector is converted suitable host by the present invention can obtain the transformant of the present invention.Specifically, The plant expression vector containing PLTP promoters is transformed into agrobacterium tumefaciens lba4404 using electric shocking method and obtains transformant.

By the PLTP promoters of the present invention and reporter gene structure plant expression vector, the plant expression vector is converted Host obtains the transformant of the promoter containing PLTP, and obtains genetically modified plants with transformant conversion plant.It is described to turn base Because plant is preferably tobacco or upland cotton.

Beneficial effects of the present invention：Present invention obtains the promoter PLTP of cotton fiber specific gene, the promoter exists There is epidermal hair specific expression activity in tobacco, there is fiber predominant expression specificity in upland cotton, improved for genetic engineering Tobacco, cotton variety provide new selection and effective approach.

Brief description of the drawings

Expression quantity (Relative Expression) of Fig. 1 GhLTP genes in upland cotton different tissues

With upland cotton root (root), stem (stem), leaf (leaves), corolla (petal), hypocotyl (hypocotyl), son Leaf (cotyledon), bloom same day ovule (0-O＆F), Post flowering 11d fiber (11-F) and Post flowering 11d ovule (11- O the cDNA in) is template, the result expanded through real-time quantitative PCR；The gene is hardly expressed in root, the embryo on the same day of blooming Expression quantity is also very low in pearl；Expression quantity is relatively low in hypocotyl, cotyledon, blade, stem, petal and Post flowering 11d ovules, and is opening Spend high expression in rear 11d fibers.

Expression quantity (Relative Expression) of Fig. 2 GhLTP genes in upland cotton fiber different development stage

Bloom same day ovule (0-O＆F), the Post flowering ovule of 3 days (3-O＆F), the Post flowering ovule of 7 days (7-O), bloom The ovule (9-O) of 9 days, the Post flowering ovule of 11 days (11-O), the Post flowering ovule of 13 days (13-O), the Post flowering embryo of 19 days afterwards Pearl (19-O), the Post flowering ovule of 26 days (26-O), Post flowering 7d fiber (7-F), Post flowering 9d fiber (9-F), bloom 11d fiber (11-F) and Post flowering 13d fiber (13-F) afterwards.

Fig. 3 represents the nucleotide sequence figure of PLTP promoters, and what is marked on figure is the position of some cis-acting elements, point The not SKn-1 relevant with multiple seed endosperms (GTCAT), the MRE relevant with myb transcription factor binding site (AACCTAA) and MBS (CGGTCA), relevant ABRE (GACACGTGGC) and TCA (CCATCTTTTT) corresponding to the hormone such as ABA, SA, with adverse circumstance, The related TC enrichment regions (GTTTTCTTAC) of the induction such as anaerobism and ARE (TGGTTT), cell cycle are related to circadian rhythm MSA-like (TCAAACGGT) and cricadian (CAANNNNATC).

Fig. 4 represents that PLTP promoters are cloned into the plasmid map on pEASY-Blunt carriers.

Wherein carrier main element indicates, pUC origin Plasmid replication origins；Ampicillin resistance ORF：Ampicillin resistance gene；Kanamycin resistance ORF：Kalamycin resistance gene；Remaining is restricted Restriction enzyme site.

The structure flow chart of Fig. 5 upland cotton PLTP promoter expression vectors；

Fig. 6 PLTP promoter expression vectors pBI101-PLTP structure chart.

Carrier main element indicates in Fig. 5 and Fig. 6, rep origin Plasmid replication origins；NPTII：Neomycin phosphoric acid turns Move enzyme gene；GUS：β-gluconic acid glycoside enzyme gene；NOS terminato and NOS：Terminator；NOS Promoter：NOS groups Constitutive promoter；LB、RB：T-DNA inserts left and right border.

Fig. 7 represents to turn the PCR the results of PLTP ∷ GUS fusion tobaccos.18th, 19,38 be standard molecular weight DNA (Mark2000), 1-17,20~37 are different transgenic lines.As a result show 1,2,6,8,12-17,20,23,24,31~ 36 be transgene negative strain, and remaining strain is transgenic positive strain.

Fig. 8 represents to turn GUS coloration results in PLTP ∷ GUS fusion tobaccos, GUS transgenic tobacco leaf, stem, Predominant expression on the epidermal hair of carpopodium and flower.Wherein, A：The seedling of 5 days after sprouting；B：True leaf；C：Young stem is crosscutting；D：Petiole is horizontal Cut；E：The amplification of young stem in C；F：The amplification of petiole in D；G：Ovary on the day of blooming；H：Corolla on the day of blooming.

Fig. 9 represents to turn the PCR the results of PLTP ∷ GUS fusion cottons.1st, 18,19,36 be standard molecular weight DNA, 2-17,20-35 are different transgenic lines, the results showed that transgenic line is positive strain.

Figure 10 represents to turn the GUS coloration results of PLTP ∷ GUS fusion upland cotton；Wherein A：Root；B：Stem；C：Leaf；D： Petiole；E：Flower；F：Corolla；G：Ovule on the day of blooming；H：The Post flowering ovule of 3 days；I：The Post flowering ovule of 7 days；J：Bloom The ovule of 12 days afterwards；K：The Post flowering ovule of 15 days；L：The Post flowering ovule of 18 days.

Embodiment

The present invention is described in further detail below in conjunction with accompanying drawing, but following explanation is not limited the present invention It is fixed, any deformation and change to the present invention, without departing from the spirit of the present invention, appended claims of the present invention all should be belonged to Defined scope.

Reagent chemicals in present example do not do illustrate be it is common commercially available, MATERIALS METHODS does not illustrate Refer to《Molecular Cloning:A Laboratory guide》(Sambrook and Russell, 2001).

The each tissue RNA of the upland cotton of embodiment 1 extraction and quantitative PCR analysis

Utilize the RNA of EASYspin plant RNA rapid extraction kits (Aidlab) the extraction each tissue of cotton.Reference RevertAid First Strand cDNA Synthesis Kit (MBI) specification carries out the reverse transcription of the chains of cDNA mono-, is used as Quantitative RT PCR analysis template.Using the relative of iQ SYBR Green Supermix (BIO-RAD) reagent analysis target gene Expression quantity.Internal standard gene selects the Ghhis3 genes (AF024716) of upland cotton, and primer is Ghhis1 (5 '-GAA GCC TCA TCG ATA CCG TC-3 ') and Ghhis2 (5 '-CTA CCA CTA CCA TCA TGG C-3 '), respectively such as SEQ ID NO.8 Shown in SEQ ID NO.9；GhLTP gene quantification PCR primers are Ltp-1 (5 ' CGCCCAAACAACACCAGAC3 ') and Ltp- 2 (5 ' CTTTTGCAGTCAGTGCTAGG 3 '), respectively as shown in SEQ ID NO.2 and SEQ ID NO.3.Amplification condition is：95 DEG C pre-degeneration 3min；95 DEG C of denaturation 20s, 56 DEG C of annealing 20s, 72 DEG C of extension 30s, 40 circulate.

Target gene and interior target ratio in each material are calculated, relative table of the target gene in different organ and tissue can be obtained Up to amount.As shown in figure 1, the gene is hardly expressed in root, expression quantity is also very low in the ovule on the same day of blooming；Hypocotyl, Expression quantity is relatively low in cotyledon, blade, stem, petal and Post flowering 11d ovules, and the high expression in Post flowering 11d fibers.Further The cotton fiber and cotton ovule of different developmental phases are detected, as a result as shown in Fig. 2 fibre of the gene at 7 days to 11 days Express higher in dimension, the expression quantity accordingly in ovule is relatively low.

The clone of the upland cotton PLTP promoters of embodiment 2

Using Ai Delai biotech firms plant genes group DNA rapid extraction kits, method to specifications carries The genomic DNA of upland cotton Ji cotton 14 is taken, with special primer PLTP-up and the PLTP-dn (SEQ of the promoter of design synthesis ID NO.4 and 5), using above-mentioned DNA as template, expand the promoter sequence.Amplification system is as follows：10×PCR buffer The μ L of 5 μ L, 25mmolMgSO45 μ L, 2mmol/L dNTPs of for KOD Plus 2, primer PLTP-up (5 μm of ol/L) 2 μ L, draw μ L, KOD Plus polymerase 1U/ μ L, upland cotton the DNA about 60ng of thing PLTP-dn (5 μm of ol/L) 2, distilled water complement to 50 μ L.Expand Increasing program is：94 DEG C, 2min；94 DEG C, 15sec, 53 DEG C, 30sec, 68 DEG C, 2min, 35 circulations.After the completion of amplification, agarose Electrophoresis simultaneously reclaims corresponding DNA bands, and method to specifications is cloned on pEASY_Blunt blunt vectors, and positive colony is posted To the handsome company's sequence verification in Shanghai, obtain pEASY-PLTP1131 carriers (see Fig. 4).As a result the PLTP promoters of acquisition are shown Sequence is as shown in SEQ ID NO.1.Utilize analysis software (Plant CARE, http://intra.psb.ugent.be:8080/ PlantCARE/), promoter regulation component analysis is carried out to the sequence from plant promoter database, therefrom found substantial amounts of Cis-regulating element (see Fig. 3), these cis-regulating elements include the relevant SKn-1 (GTCAT) of multiple seed endosperms, with MYB The relevant MRE of Binding site for transcription factor (AACCTAA) and MBS (CGGTCA), with the hormone phase such as abscisic acid ABA, salicylic acid SA ABRE (GACACGTGGC) and TCA (CCATCTTTTT) that should be relevant, the TC enrichment region related to the induction such as adverse circumstance, anaerobism (GTTTTCTTAC) MSA-like (TCAAACGGT) related to circadian rhythm to ARE (TGGTTT), cell cycle and cricadian(CAANNNNATC)。

The recovery of embodiment 3DNA fragments, expression vector establishment and Escherichia coli conversion

Under uviol lamp, the Ago-Gel block containing purpose fragment is cut with the blade of cleaning, (Roche is public according to kit Department) method reclaim corresponding DNA fragmentation, be building up to.The idiographic flow of vector construction is shown in Fig. 5, first gram from the promoter Promoter fragment is cut out using restriction enzyme Sal I and Sma I in grand carrier pEASY-PLTP1131, is then cloned into Gus reporter gene upstream is placed in expression vector pBI101 (being purchased from CLONTECH companies) Sal I and the sites of Sma I, from And build pPLTP-GUS positive expression vector (Fig. 6).All restriction enzymes are purchased from Roche companies, are said according to using Bright book operation.

The fragment of recovery and the linked system of carrier segments are:10 × T4DNA connections buffer solution 1 μ L, the μ of vector DNA fragment 1 L, the μ L of 1 μ L, T4DNA ligase of external source connection product DNA fragmentation 1, volume is supplied to 10 μ L with distilled water.Wherein, carrier DNA piece Section is 1 ︰, 3,16 DEG C of connection 12h with external source connection product DNA fragmentation mol ratio.Connection product is converted to Escherichia coli afterwards In DH5 α.

The Agrobacterium of embodiment 4 and the genetic transformation of tobacco and cotton

The plant expression carrier plasmid of structure is imported into Agrobacterium LBA4404 with electrization.

The step of according to OMEGA companies plasmid extraction kit (D6943-01) specification, extract PLTP：：GUS plant tables Up to vector plasmid, with reference to Bio-RADMicroPulser instruction manual books, the plasmid is transferred to by Agrobacterium by Electroporation conversion In LBA4404.

The genetic transformation of tobacco：Using agriculture bacillus mediated leaf disc transformation method (Horsch, et al., 1985), to tobacco Genetic transformation is carried out, the transgenic tobacco plant of acquisition is screened by the PCR methods expanded, it is public using Ai Delai biologies Plant genes group DNA rapid extraction kits are taken charge of, the DNA of method extraction transgene tobacco to specifications, then will The plant that PCR is positive is planted in greenhouse, Routine Management.

The genetic transformation of upland cotton：Using agriculture bacillus mediated method to cotton carry out genetic transformation (Luo et al., 2007), the transgenic cotton plant of acquisition is screened by the PCR methods expanded, it is new using Ai Delai biotech firms Plant genome DNA rapid extraction kit, the DNA of method extraction transgene cotton to specifications, then enters performing PCR expansion Increase identification, by the positive seedling be placed in clear water, 22 DEG C culture 1 week after transplanting into greenhouse, carry out normal management.

The PCR checkings of the transfer-gen plant of embodiment 5

Using Ai Delai biotech firms plant genes group DNA rapid extraction kits, method to specifications carries Take transgene tobacco and the DNA of cotton.According to the sequences Design special primer GUS-1 of gus reporter gene: AGCGTAATGCTCTACACCACG (SEQ ID NO.6) and GUS-2:GTAATGCGAGGTACGGTAGG (SEQ ID NO.7) is used In specific PCR amplification.Transfer-gen plant DNA enters the condition of performing PCR amplification in vitro checking：Reaction cumulative volume is 25 μ L, including 10 μ L of × LA Taq buffer 2.5,100 μm of ol/L of every kind of dNTP, 1.5mmol/L MgCl2, template DNA 10ng, upstream and downstream Each 400nmol/L of primer, 1 unit LA Taq archaeal dna polymerases (TaKaRa companies).

Amplification condition：94 DEG C denaturation 4min, after with 94 DEG C denaturation 30s, 55 DEG C annealing 30s, 72 DEG C extension 1min, totally 35 Circulation, last 72 DEG C of extensions 10min.

Amplified production on 1% Ago-Gel containing ethidium bromide with 5V/cm electrophoresis after, under uviol lamp observe shine Picture.

The PCR the results of transgene tobacco are shown in Fig. 7, the results showed that 1,2,6,8,12-17,20,23,24,31-36 for turn Gene negative strain, remaining strain are transgenic positive strain.

The PCR the results of transgene cotton are shown in Fig. 9, the results showed that transgenic line is positive strain.

Embodiment 6GUS histochemical stain and observation

Fresh transgene tobacco, land cotton material are taken, is cut into small pieces in rearmounted 1.5mL centrifuge tubes, adds GUS dyeing liquors (10mmol/LEDTA, 100mmol/L sodium phosphate buffer pH7.0,0.1mol/L K₃[Fe(CN)₆], 0.1mol/LK₄[Fe (CN)₆], 0.1% (V/V) Triton X-100,5mg/ml X-Glue).By the centrifuge tube containing vegetable material and GUS dye liquors, It is put into 37.0 DEG C of constant temperature incubators, dyes 3h.It is most backward to remove dyeing liquor, after 70% ethanol decolorization, observation photograph.

The GUS coloration results turned in PLTP ∷ gus gene tobaccos are shown in Fig. 8, as a result show GUS transgenic tobacco leaf, Predominant expression on the epidermal hair of stem, carpopodium and flower, and do not expressed in non-epidermal hair tissue, i.e., the promoter has epidermal tobacco Hair expression specificity.

The GUS coloration results for turning PLTP ∷ gus gene upland cotton are shown in Figure 10, as a result find in root, blade, young stem not It was observed that GUS blue signal；With the presence of GUS positive signals in flower, the epidermal hair of corolla and stamen, flower pesticide；And from opening The cotton ovule surface that the flower same day starts starts the blue signal for GUS occur, especially the rapid elongation phase in Fibre Development, fiber With the presence of strong GUS positive signals in specific cell, show that the promoter has floral organ epidermal hair specific in upland cotton Property and fibrocyte specificity, fibrocyte genetic engineering improvement in, can be used for drive target gene in fiber finer Specifically expressing in born of the same parents, there is important application value.

Above-described embodiment shows, the PLTP promoters length of nucleotides that the present invention clones be 2467bp, when the promoter and After reporter gene fusion, reporter gene can be instructed to be expressed in epidermal hair in tobacco；Reporter gene can be instructed in upland cotton Expressed in fibrocyte.

Above detailed description of the present invention is not intended to limit the present invention, and those skilled in the art can do according to the present invention Go out various modifications and change, without departing from the spirit of the present invention, model defined in appended claims of the present invention all should be belonged to Enclose.

Claims (10)

1. epidermal hair and cotton fiber specific promoter PLTP, it is characterised in that its nucleotide sequence such as SEQ ID No.1 Shown, the promoter has epidermal hair specific expression activity in tobacco, has fiber predominant expression specificity in upland cotton.

2. the expression vector containing promoter PLTP described in claim 1.

3. the expression vector as described in claim 2, it is characterised in that：Described expression vector is plant expression vector.

4. the host containing the carrier of claim 2 or 3.

5. the host as described in claim 4, it is characterised in that：Described host is Agrobacterium tumefaciems.

6. applications of the promoter PLTP in genetically modified plants are obtained described in claim 1.

7. applications of the promoter PLTP in transgene cotton or transgene tobacco is obtained described in claim 1.

8. application of the expression vector in transgene cotton or transgene tobacco is obtained described in claim 2 or 3.

9. applications of the promoter PLTP described in claim 1 in cotton fiber quality is improved.

10. the preparation method containing promoter PLTP genetically modified plants described in claim 1, comprises the steps：

（1）The promoter of epidermal hair and cotton fiber specific is operably inserted in expression vector, structure plant expression carries Body；

（2）Host is converted with the plant expression vector, obtains transformant；

（3）The transformant is converted into plant, obtains genetically modified plants.