CN105018520B - The plant expression vector and application thereof of 4 pairs of cotton DELLA protein gene GhGAIs expression of regulation and control - Google Patents

Abstract

The invention belongs to field of plant genetic, and in particular to the plant expression vector and application thereof of 4 pairs of cotton DELLA genes GhGAIs expression of regulation and control.The technical problem to be solved by the present invention is to provide a kind of new selection to improve output of cotton.The technical scheme is that regulating and controlling expression of 4 couples of cotton DELLA genes GhGAIs in cotton fiber simultaneously using RNAi technology.The present invention also provides the host cells containing the carrier.After carrier of the present invention regulates and controls target gene, the fiber yield and clothing of improvement, which refer to, to be significantly improved, and output of cotton potentiality obviously increase.The method of the present invention is simple and easy to do, significant effect, there is the application prospect for generating great economic benefit.

Description

The plant expression vector of 4 pairs of cotton DELLA protein gene GhGAIs expression of regulation and control and its Purposes

Technical field

The invention belongs to field of plant genetic, and in particular to 4 couples of cotton DELLA protein gene GhGAIs of regulation and control Plant expression vector of expression and application thereof.

Background technology

Cotton is most important natural fiber crop, and China is maximum Chan Mian states and textile exporting country in the world, cotton Flower occupies very important status in Chinese national economy.

Cotton fiber is to be synthesized through starting, elongation, secondary wall by cotton external integument epidermal cell and ripe four periods hair Unicellular fibre made of educating.Plant hormone plays very important regulating and controlling effect to the development of cotton fiber.In cotton fiber With up-regulation gibberellin (GA), auxin (IAA) and brassinosteroid (BR) synthase gene in ovule, improve in ovule and fiber The level of associated hormone can promote starting or growth, the orderly improvement cotton fiber yield and quality characters of cotton fiber, table Bright plant hormone plays very important regulating and controlling effect to the development of cotton fiber.About target plant hormone signal transduction element To which the research for regulating and controlling plant hormone signal transduction in Fibre Development is also seldom at present.

DELLA albumen is a crucial negative regulatory factor in GA signal transduction paths.GA is by inducing DELLA albumen Ubiquitination and degradation release the inhibition of DELLA albumen, promote the expression of GA response genes.In addition, a variety of hormones and environmental signal The degradation of DELLA albumen can directly or indirectly be regulated and controled, and then influence the growth and development of plant and the reaction to environment.It is so far It only yet there are no and improve the report of cotton fiber by regulating and controlling cotton DELLA genes.According to the sequencing of cotton gene group as a result, cotton Middle DELLA albumen is spent to be encoded by 1 gene family, single cotton gene group contains 4 encoding genes, and the land of allotetraploid In ground cotton contain 4 pairs of encoding genes, be respectively designated as GhGAI1A and GhGAI1D, GhGAI2A and GhGAI2D, GhGAI3A and GhGAI3D, GhGAI4A and GhGAI4D (table 1).Each pair of gene is that the direct line in different subgenomes (A and D subgenomes) is same Source gene, identical nucleotide sequence>95%.Forefathers pass through the means analysis such as clone and heterogenous expression part cotton DELLA eggs The function of white gene, but there is presently no the reports of cotton DELLA protein gene function in cotton fiber development, also without logical Cross the report of regulation and control DELLA protein gene improvement cotton fiber yield and quality.

1 cotton DELLA protein gene of table and its coded sequence in the genome being sequenced

Gene	Upland cotton	Lei Mengdeshi cottons	Asiatic cotton
				GhGAI1A	Gh_A07G0717		Cotton_A_30811
GhGAI1D	Gh_D07G0779	Gorai.001G089400
				GhGAI2A	Gh_A01G1242		Cotton_A_41295
GhGAI2D	Gh_D01G1446	Gorai.002G177000
				GhGAI3A	Gh_A06G0504		Cotton_A_20431
GhGAI3D	Gh_D06G0560	Gorai.010G067000
				GhGAI4A	Gh_A05G0135		Cotton_A_11125
GhGAI4D	Gh_D05G0197	Gorai.009G021700

Invention content

The technical problem to be solved by the present invention is to provide a kind of new selection to improve output of cotton.

The technical scheme is that the plant expression of 4 pairs of cotton DELLA genes GhGAIs expression of regulation and control carry and GhGAI3D, GhGAI4A and GhGAI4D.

Specifically, the carrier includes the RNAi elements for targeting 4 pairs of genes of having connected, which has such as Nucleotide sequence shown in SEQ ID No.5.

Specifically, the promoter for regulating and controlling the RNAi elements, which is secondary wall thickening, synthesizes phase specificity promoter.

Preferably, the promoter is cotton FbLate-2 gene promoters (pFbl2), nucleotide sequence such as SEQ Shown in ID No.6.

Specifically, the plant expression vector has the nucleotide sequence as shown in SEQ ID No.7.

The present invention also provides the host cells containing the carrier.

Specifically, the host cell is Agrobacterium tumefaciems.

The present invention also improves the substance of cotton fiber yield, and main active is the plant expression vector, or Host cell containing the plant expression vector.

The present invention also provides purposes of the carrier in improving cotton fiber yield.

The present invention also provides purposes of the host cell in improving cotton fiber yield.

Beneficial effects of the present invention：The present invention passes through research and analysis, it was demonstrated that DELLA albumen is in cotton fiber growth and development In play an important roll.And by synthesizing period comprehensive table for lowering 8 DELLA genes GhGAIs in cotton fiber secondary wall It reaches, obtains ginning outturn (cotton fiber accounts for the percentage of seed weight) and clothing refers to (weight of fiber on hundred cottonseeds) and significantly improves Transgene cotton.Experiment results proved, after carrier of the present invention regulates and controls target gene, the fiber yield and clothing of improvement Finger significantly improves, and fiber production obviously increases.The method of the present invention is simple and easy to do, significant effect, has and generates great economic benefit Potentiality.

Description of the drawings

Fig. 1：The gene structure figure in the areas expression vector T-DNA of GAIsRNAi

CaMV35S-P, cauliflower mosaic virus 35 S promoter；CaMV35S-T, cauliflower mosaic virus 35S terminators； D1-D4, the coded sequence of the DELLA and VHYNP structural domains of Cotton GA I1-4 genes, the D1-D4 series connection sequences of two inverted repeats Row and intervening sequence constitute GAIsRNAi elements；GUS:NPTII, β-glucose neuraminidase and neomycin phosphotransferase merge base Cause；LB, T-DNA left margin；Nos-T, Agrobacterium Opines synthase gene terminator；PFbl2, cotton FbLate-2 genes open Mover；RB, T-DNA right margin.

Fig. 2：P5-pFbl2-GAIRNAi expression vector establishment flows

Specific experiment method is shown in embodiment 2.CaMV35S-P, cauliflower mosaic virus 35 S promoter；CaMV35S-T, flower Cauliflower mosaic virus 35S terminators；GAI-DELLA, the tandem sequence of 4 Cotton GA I segments；GUS:NPTII, β-glucose Neuraminidase and neomycin phosphotransferase fusion；LB, T-DNA left margin；Nos-T, Agrobacterium Opines synthase gene Terminator；PFbl2, cotton FbLate-2 gene promoters；RB, T-DNA right margin；REP origin, plasmid replication origin.Phase It closes restriction enzyme site and position marks on each carrier.

Fig. 3：4 pairs of cotton DELLA protein gene (GhGAI1A and GhGAI1D, GhGAI2A and GhGAI2D, GhGAI3A and GhGAI3D, GhGAI4A and GhGAI4D) expression in 18 days fibers of GAIsRNAi transgene cottons Post flowering

WT represents non-transgenic cotton.FGi is GAIsRNAi transgene cottons, and number thereafter shows different transformants And homozygous lines.

Specific implementation mode

Used routine experiment operation in following embodiments：

The extraction of 1.DNA

Genomic DNA is extracted using plant genome DNA rapid extraction kit (Aidlab), and detailed step is shown in explanation Book.

The extraction of 2.RNA

RNA is extracted using EASYspin plant RNA rapid extraction kits (Aidlab), and detailed step is shown in specification.

The PCR amplification of 3.DNA segments

Amplification system is as follows：10×Ex PCR buffer(Mg²⁺Free) 2.5 μ L, 2.5mmol/L dNTPs, 2 μ L, 25mmol/L MgCl₂2 μ L, primer 1 (5 μm of ol/L) 1 μ L, 1 μ L, Ex Taq archaeal dna polymerase 1U of primer 2 (5 μm of ol/L), gene Group DNA about 60ng, are added ddH₂O to 25 μ L.

Amplification program is：94 DEG C, 5min；94 DEG C, 30sec, 56 DEG C, 30sec, 72 DEG C, 1.5min, 35 cycles；72℃ Extend 10min.

Recycling, connection and the clone of 4.DNA segments

DNA fragmentation is recycled using BioFlux plastic recovery kits.DNA fragmentation connection is carried out using T4 DNA ligase. The segment of recycling establishes following linked system with pUCm-T (Shanghai life work) carrier：10 × T4 DNA connections buffer solution, 1 μ L, carrier 1 μ L of DNA fragmentation, 1 μ L, T4 DNA ligase of external source connection product DNA fragmentation, 1 μ L, volume is supplied to 10 μ L with distilled water.Carrier DNA fragmentation is 1 ︰, 3,16 DEG C of connection 12h with external source connection product DNA fragmentation molar ratio.Connection product is converted into large intestine bar later Bacterium DH5 α.The resistance clone of acquisition is stayed overnight through Liquid Culture, and plasmid, digestion verification are extracted with BioFlux plasmid extraction kits Afterwards, it is sequenced in Invitrogen companies.

5.GUS histochemical stains

Since the expression vector that laboratory uses has gus reporter gene, GUS histochemical stain detecting and trackings are generally used Transgenosis.Specific method：It takes a small amount of transgene cotton blade (having wound) to be placed in 96 orifice plates, GUS dye liquors [0.1mol/L is added K₃Fe(CN)₆, 0.1mol/L K₄Fe(CN)₆, 0.01mol/L Na₂EDTA, 500mg/L X-Gluc, 1%Triton X-100 (v/v), 0.14mol/L sodium phosphate buffers (pH7.0)], 2h or so is placed under 37 DEG C of constant temperatures, is used again after abundant dye liquor 75% ethanol decolorization.The plant that plant leaf can be dyed special blue by GUS dye liquors is transgenic positive.

Embodiment 1 regulates and controls the acquisition of the RNAi elements GAIsRNAi of cotton DELLA genes

DELLA albumen belongs to a big GARS protein family, in addition to containing the shared GARS structural domains of family in C-terminal, There is DELLA the and VHYNP structural domains of peculiar about 100 amino acid of DELLA albumen in N-terminal.As previously mentioned, upland cotton contains 4 To the ortholog of DELLA albumen, very high (the identical nucleotide of nucleotide sequence similarity of pairs of paralogous gene> 95%), and the nucleotide sequence similarity of non-orthologous gene is relatively low.To regulate and control the table of cotton DELLA protein gene comprehensively It reaches, we have chosen DELLA and the VHYNP knot of 4 kinds of DELLA albumen of coding according to the DELLA protein gene of 4 pairs of orthologs The D genome sequences (No.1~4 SEQ ID) in structure domain.4 sequences are connected by PCR method, and are finally expanded into containing interval The inverted repeats of sequence, i.e. GAIsRNAi elements (SEQ ID No.No.5).It, can be with shape after the sequence is transcribed in cotton At the double stranded RNA sequences for targeting 4 pairs of DELLA protein gene, to lower the expression of these genes by RNAi mechanism.Together When, the coded sequence of DELLA and VHYNP structural domains is that DELLA protein gene is distinctive, and the expression of GAIsRNAi elements will not shadow Ring expression and the function of other GRAS albumen.

First, it is DELLA and VHYNP structural domain code sequences that template expands GAI1~4 respectively with upland cotton genomic DNA Row, primer is respectively GAI1i-F/R, GAI2i-F/R, GAI3i-F/R and GAI4i-F/R (table 2), and method is the same as above-mentioned routine test The DNA fragmentation of operation expands.Further with the segments of GAI1~4 of above-mentioned DNA fragmentation recovery method recycling amplification.

2 GAIsRNAi element amplimer sequences of table

Primer	Base sequence (5'--3')	Purposes
			GAI1i-F	GACGAGTTATTAGCTGTTTTGG	GAI1 fragment amplification sense primers
GAI1i-R	AAGCTCATCGTTGAACTCGATCAACAAATTTTG	GAI1 fragment amplification downstream primers
			GAI2i-F	CGAGTTCAACGATGAGCTTTTGGCGGTTTTG	GAI2 fragment amplification sense primers
GAI2i-R	TAGTCCATCGTTAAGTTCAGAGAGCATGC	GAI2 fragment amplification downstream primers
			GAI3i-F	CTGAACTTAACGATGGACTACTCGCCGGT	GAI3 fragment amplification sense primers
GAI3i-R	GAAAACCATCCTCAGCGAACTCAGTTAGC	GAI3 fragment amplification downstream primers
			GAI4i-F	TTCGCTGAGGATGGTTTTCTAGCCGGAG	GAI4 fragment amplification sense primers
GAI4i-R	CTCCTACTTGTCCCTCCGTTAACTGATTATTCAAACT	GAI4 fragment amplification downstream primers

Second, 4 GAI segments of recycling are connected using asymmetric overlapping PCR method.First by GAI1 and GAI2, GAI3 It connects respectively with GAI4.It is as follows to build 4 amplification systems：

(1) GAI1 the segments about 5ng, 2 μ L primers GAI1i-F (5 μm of ol/L), 1 μ L primers GAI1i-R (1 μm of ol/ recycled L)；

(2) GAI2 the segments about 5ng, 1 μ L primers GAI2i-F (1 μm of ol/L), 2 μ L primers GAI2i-R (5 μm of ol/ recycled L)；

(3) GAI3 the segments about 5ng, 2 μ L primers GAI3i-F (5 μm of ol/L), 1 μ L primers GAI3i-R (1 μm of ol/ recycled L)；

(4) GAI4 the segments about 5ng, 1 μ L primers GAI4i-F (1 μm of ol/L), 2 μ L primers GAI4i-R (5 μm of ol/ recycled L)。

Remaining ingredient of amplification system is the same as conventional amplification system.Amplification program is：94 DEG C, 5min；94 DEG C, 30sec, 56 DEG C, 30sec, 72 DEG C, 30sec, 30 cycles；72 DEG C of extension 3min.System 1 and system 2 are mixed respectively, system 3 and system 4 are mixed It closes, 56 DEG C, 1min, 72 DEG C, 3min.Amplified production is after agarose electrophoresis, GAI1+GAI2 and GAI3+GAI4 points of purpose band It does not recycle.

Further with the series connection that GAI1+GAI2 and GAI3+GAI4 are template 4 GAI segments of completion.2 amplification bodies of structure System is as follows：

(5) GAI1+GAI2 the segments about 5ng, 2 μ L primers GAI1i-F (5 μm of ol/L), 1 μ L primers GAI3i-R (1 μ recycled mol/L)；

(6) GAI3+GAI4 the segments about 5ng, 1 μ L primers GAI3i-F (1 μm of ol/L), 2 μ L primers GAI4i-R (5 μ recycled mol/L)。

Remaining ingredient of amplification system is the same as conventional amplification system.Amplification program is：94 DEG C, 5min；94 DEG C, 30sec, 56 DEG C, 30sec, 72 DEG C, 30sec, 30 cycles；72 DEG C of extension 3min.System 5 and system 6 are mixed, 56 DEG C, 1min, 72 DEG C, 3min.Amplified production recycles purpose band GAI1+GAI2+GAI3+GAI4 after agarose electrophoresis.

In design primer, the amplified fragments of GAI4 primers contain DELLA the and VHYNP structural domain code sequences of GhGAI4 Row and structural domain close on sequence.The necessary composition for closing on sequence and being equivalent to RNAi elements --- the interval sequence of the structural domain Row are conducive to two inverted repeats and form double-stranded RNA.

Finally with the method for directly expanding hairpin RNA¹Contained using segment GAI1+GAI2+GAI3+GAI4 as template amplification The inverted repeats of 4 GAI segments of intervening sequence.The GAI1+GAI2+GAI3+GAI4 containing recycling is about in reaction system 5ng, 2 μ L primers GAI1i-F (5 μm of ol/L), 1 μ L primers GAI4i-R (1 μm of ol/L), remaining ingredient is the same as conventional amplification system.Expand Increasing program is：94 DEG C, 5min；94 DEG C, 30sec, 56 DEG C, 30sec, 72 DEG C, 1min, 35 cycles；72 DEG C of extension 3min.Amplification Product recycles the purpose band of about 1800bp after agarose electrophoresis, according to a conventional method recycling, clone and sequence verification, finally Obtain GAIsRNAi elements (Fig. 1).

GAIsRNAi elements include GAI1+GAI2+GAI3+GAI4 (including DELLA and VHYNP structural domain code sequences successively Row and structural domain close on sequence)+GAI4 inverted repeats+GAI3 inverted repeats+GAI2 inverted repeats+ GAI1 inverted repeats.The sequence of GAIsRNAi elements is as follows, and wherein underscore show intervening sequence：

gacgagttattagctgttttgggttacaaagttcggtcatcagatatggcggatgtagctcaaaaattggaaatgtt ggagaaagttatgggtactgctcaagaaaatgggatttcacagcttggtgatactgttcattttaatccttcagatc tatctggttgggttcaaaatttgttgatcgagttcgacgatgagcttttggcggttttgggttacaaggtcaaaact tcagacatggctgaagtggctcgaaagcttgagcggttggaggaggctatgtgtaatgttcaagatgatgggatttc tcaccttgcttctgaaactgttcattataatccttccgatctgtcgacttggctcgagagcatgctctctgaactta acgatggactactcgccggtgctggttataaagtccggtcgtcggagctacgacaaatagctcagcgactggaacga ctcgaaaccgccatgggtaattcgcctgcagatttctctcaacttgcctccgatgccatactctataacccttctga tctggcctgctgggtcgactcgctgctaactgagttcgctgaggatggttttctagccggagctggatacagagtta ggtcatcggagctgcgaaaagtagctcagcgacttgaacgacttgaaaccgccatggttaattctcccgcagatttg tctcaacttgcttccgataccatccactataacccttccgatctagcctcctgggttgactcgctgctgtccaagtt tactcagcctcctacttgtccctccgagttcatcatggatcctgaaaccaatcagacggtggtaagcgacgcatgga ccactgccgaacctcatatgccgcaggtgcaccagaatatttcttaccagcaacaaagtttgaataatcagttaacg gttgataatcagttaacggttgtaacagcaatggaggaagattccggtatacggttggttcatatgttgatgacgtg tgcggagtgcgttcaacgtggagacttctcattggctgagtaagctcggacagcagcgagtcaacccaggaagctag atcggaagggttatagtggatggtatcggaagcaagttgagacaaatctgcgggagaattaaccatggcggtttcaa gtcgttcaagtcgctgagctacttttcgcagctcggatgacctaactctgtatccagctccggctagaaaaccatcc tcagcgaactcagttagcagcgagtcgacccagcaggccagatcagaagggttatagagtatagcatcggaggcaag ttgagagaaatctgcaggcgaattacccatggcggtttcgagtcgttccagtcgttgagctacttgtcgtaactccg acgaccggactttataaccagcaccggcgagtagtccatcgttaagttcagagagcatgctctcgagccaagtcgac agatcggaaggattataatgaacagtttcagaagcaaggtgagaaatcccatcatcttgaacattacacataacctc ctccaactgctcaagctttcgagccacttcagccatgtctgaagttttgaccttgtaacccaaaaccgccaaaagct catcgttgaactcgatcaacaaattttgaacccaaccggatagatctgaaggattaaaatgaacagtatcaccaagc tgtgaaatcccatcttcttgagcagtacccataactttctccaacatttccaatttttgagctacatccgccatatc tgatgaccgaactttgtaacccaaaacagctaataactcgtc

2 secondary wall thickening of embodiment synthesizes the structure of phase special GAIsRNAi expression vectors

The flow that GAIsRNAi elements are built into plant expression vector p5 is shown in Fig. 2.P5 is by traditional plant expression vector One binary plant expression vector of pBI121 transformations.Its T-DNA section (region, Fig. 2 between RB and LB) replace in order to The track fusion of CaMV35S promoters (CaMV35S-P) control report gene GUS and marker gene NptII of composing type Box and another expression cassette controlled by CaMV35S-P.

By aforementioned conventional practices with primer (pFbl2F, 5 '-aagctTGCAGACTTAGGATTGGATG-3 ' and PFbl2R, 5 '-ggatccGGTTAACCGAAATACAAAGCA-3 ') cloning promoter pFbl2 is expanded from cotton gene group, and I site Hind III and BamH is added at promoter both ends.PFbl2 promoters are cut from cloning vector with Hind III and BamH I Under (Hind III be partially digested), be connected to structure p5-pFbl2 carriers on the p5 carriers with I digestion of Hind III and BamH.Into one GAIsRNAi elements are cut (BamH I is partially digested) by step with BamH I and Kpn I from cloning vector, are inserted into p5-pFbl2 In the corresponding site of carrier, that is, obtain final expression vector p5-pFbl2-GAIsRNAi.All restriction enzymes are purchased from Roche companies, operate according to operation instructions.Aforementioned routine operation side is pressed in recycling, connection and the Escherichia coli conversion of DNA fragmentation Method carries out.With reference to Bio-RAD MicroPulser instruction manual books, above-mentioned carrier is imported into Agrobacterium by Electroporation conversion LBA4404。

The genetic transformation of 3 cotton of embodiment

The Cotton Transformation of above-mentioned expression vector, used medium formula are carried out by Agrobacterium tumefaciens mediated method It is shown in Table 3.The specific method is as follows：It shells to wild type upland cotton Ji No. 14 full cotton seeds of cotton, by a small amount of (about 20~40 ) seed after decladding is placed in the 100mL triangular flasks after sterilizing, first with 75% alcohol prewashing seed 1min, fall off wine Essence adds 0.1%HgCl₂Sterilizing about 12min (constantly shakes triangular flask to sterilize), falls off mercuric chloride, sterile water is added Fully rinsing about rinses 10 times, and there are appropriate amounts of sterilized water in last time triangular flask.It is placed on shaking table (30 DEG C, 100rpm), often A sterile water was changed every 8 hours, waits for that radicle grows 1cm or so (about 36~48h), radicle is gently injected in germination medium, 30 DEG C of light cultures are to hypocotyl elongation to 3cm or so (about 48h).Before infecting about 20h, the Agrobacterium of genetic transformation carrier will be carried Single bacterium colony is inoculated in the liquid YEB culture mediums containing 50mg/L Km and 125mg/L Sm, is placed in 28 DEG C of shaking tables (200rpm), OD values (the OD of bacterium solution is measured after culture about 20h₆₀₀), OD₆₀₀In 0.8-1.0 appropriate transformations.The agrobacterium liquid after activation is collected, 8000rpm is abandoned after supernatant from 1min and is pressed 1 with containing co-cultivation fluid nutrient medium (containing 100 μm of o1/L AS, acetosyringone): 1 volume ratio collects re-suspension liquid in 100mL triangular flasks after thalline is resuspended, and is placed in shaking table (30 DEG C, 100rpm) culture about 20min.It will Hypocotyl is cut into the segment for being about 1cm, is placed in re-suspension liquid and infects 50min on shaking table (30 DEG C, 100rpm), abandons liquid again It takes out lower embryo section and is gently put into solidified co-cultivation medium surface, light culture 48h or so.Lower embryo section is transferred to solid screening after light culture Culture (30 DEG C, 16h illumination/8h dark, similarly hereinafter) is transferred to embryo section growth medium under solid again after 15 days in culture medium, every 15d or so subcultures are once obviously formed to callus, and callus is gone on solid callus culture medium and is cultivated.State is good Good embryo callus subculture, which is transferred in liquid suspension culture base, is placed on shaking table (30 DEG C, 100rpm) the culture 10d or so that suspends, and passes through Tiny body embryo is laid in body embryo elongation medium to green body embryo and grows by screen filtration, and green body embryo is chosen to body embryo to extend and is trained It supports and continues culture in base to 1cm or so is about, be inserted into root media until seedling grows.The above operation must be stringent It is completed under aseptic condition.

The regeneration cotton seedling replanting of robust growth to culture pan, in the greenhouse Routine Management to cotton fiber and seed at It is ripe.Harvest T0 continues to plant T1 generations and harvests seed, sowing T1 is for young to the T2 of sprouting generations after seed for transgenic cotton flower seed Seedling carries out GUS tissue stainings (see conventional practices), filter out homozygous transgenosis T2 for strain (all GUS it is positive or GUS feminine genders plant), transplanting T2 for homozygous lines, and detect target gene GhGAIs expression and compare fiber production and Quality trait changes.

The Agrobacterium tumefaciens mediated Cotton Transformation culture medium of table 3

MS:Murashige&Skoog,1962；B5:Gamborg,1986；Gelrite:Sigma, article No.:G1910；SH: Schenk&Hildebrandt,1972。

The detection of 4 cotton GhGAIs gene transcription levels of embodiment

The RNA of extraction control and 18 days fibers of transgene cotton Post flowering, reverse transcription synthesizes mono- chains of cDNA, as template Carry out quantitative PCR detection.Concrete operation step is：A chain of various RNA is synthesized with mono- chain synthetic agent box of cDNA (MBI companies) CDNA, operation are pressed kit specification and are carried out.Quantitative PCR carries out on CFX96 quantitative PCR detection systems (Bio-Rad), The reaction system of 25 μ L includes 12.5 μ 2 × Super of L Mix (Bio-Rad), upstream and downstream primer each 0.2 μm of ol/L and 1 μ L mono- Chain cDNA.Thermal cycler parameters are 95 DEG C of pre-degeneration 2min；95 DEG C, 10sec, 57 DEG C, 20sec, 40 cycle of amplification.Use cotton Actin4 genes make internal standard.The analysis software Bio-Rad CFX Manager 2.0 carried with quantitative PCR apparatus calculate each gene Relative expression quantity.All quantification PCR primer sequences are shown in Table 4.

Such as Fig. 3, the transcription water of GAIsRNAi transgene cottons 4 couples of target gene GhGAIs in 18 days fibers of Post flowering Flat generally to be reduced compared with non-transgenic strain, the GAIsRNAi elements that display pFbl2 starts can successfully inhibit DELLA protein gene Expression.

4 quantification PCR primer sequence of table

Primer	Base sequence (5'---3')	Purposes
			GhGAI1A-F	GGACCACCTCAACCCGATG	GhGAI1A sense primers
GhGAI1A-R	CGATGCGTTCGGCCAATTC	GhGAI1A downstream primers
			GhGAI1D-F	GGACCGCCTCAACCGGATA	GhGAI1D sense primers
GhGAI1D-R	CGATGCGTTCGGCCAATTG	GhGAI1D downstream primers
			GhGAI2A-F	CACCCACCAACGTTAAATCT	GhGAI2A sense primers
GhGAI2A-R	ACCACGGGACGAGTTGAAG	GhGAI2A downstream primers
			GhGAI2D-F	CACCCACCAACGTTAAATCC	GhGAI2D sense primers
GhGAI2D-R	ACCACGGGACGAGTTGAAT	GhGAI2D downstream primers
			GhGAI3A-F	TTCTTTAGAAGCTTGCAGGG	GhGAI3A sense primers
GhGAI3A-R	CCAATGGCTCGTGCCTTTCT	GhGAI3A downstream primers
			GhGAI3D-F	TTCTTTAGAAGCTTGCAGGA	GhGAI3D sense primers
GhGAI3D-R	CAATGGCTCGTGCCTTTCC	GhGAI3D downstream primers
			GhGAI4A-F	GTTCATCATGGATCCTGTAAG	GhGAI4A sense primers
GhGAI4A-R	GAATCTTCCTCCATTGCTGG	GhGAI4A downstream primers
			GhGAI4D-F	GTTCATCATGGATCCTGAAAC	GhGAI4D sense primers
GhGAI4D-R	GAATCTTCCTCCATTGCTGT	GhGAI4D downstream primers
			GhAct4-F	TTGCAGACCGTATGAGCAAG	GhActin4 sense primers
GhAct4-R	ATCCTCCGATCCAGACACTG	GhActin4 downstream primers

The investigation of embodiment 5 GAIsRNAi transgene cottons yield and fiber quality characteristics

It is yield traits that heavy cotton is wanted that ginning outturn and clothing, which refer to,.Ginning outturn refer in unginned cotton fibre weight to unginned cotton weight it Than expressed as a percentage；Namely fibre weight accounts for the ratio of entire seed and total weight of fiber.It is fine on hundred cottonseeds that clothing, which refers to, The weight of dimension.The analysis result such as table 5 that T2 refers to for the ginning outturn and clothing of GAIsRNAi transgene cottons.Transgene cotton single plant with it is right Photograph ratio, ginning outturn improve 4~24%, and clothing refers to raising 20~80%, and display GAIsRNAi transgene cottons have very high volume increase Potentiality.

5 GAIsRNAi transgene cotton fiber production characters of table

Sample	Ginning outturn (%)	Ginning outturn increases (%) than control	Clothing refers to (g)	Clothing refers to increases (%) than control
					WT	38.6		5.5

FGi01-10	48.1	24.61	9.9	80.0
					Fgi02-2	44.2	14.51	6.6	20.0
FGi02-3	43.5	12.69	7.7	40.0
					FGi04-2	40.2	4.15	6.6	20.0
FGi05-1	42.1	9.07	7.1	29.1
					FGi06-13	42.0	8.81	7.2	30.9
FGi07-1	40.8	5.70	6.6	20.0
					FGi08-7	42.5	10.10	7.3	32.7

Note：WT is non-transgenic cotton in upper table.FGi is GAIsRNAi transgene cottons, and number display thereafter is different Transformant and homozygous lines.

In sending Ministry of Agriculture's cotton quality supervisory detection to test in the cotton fiber sample of GAIsRNAi transgene cottons and control The heart (Anyang), according to ASTM D5867-95《HVI900 large capacity fiber tester test methods》, using HFT9000 in temperature Under the environmental condition of 20 DEG C of relative humidity 65%, to upper half mean length, regularity index, strength, elongation, horse Test by totally 5 indexs for clone's value.6 are the results are shown in Table, shows the fiber quality of GAIsRNAi transgene cottons compared with the control There is no significant change.

The fiber quality characteristics of 6 GhGAIsRNAi transgene cottons of table

Note：WT is non-transgenic cotton in upper table.FGi is GAIsRNAi transgene cottons, and number display thereafter is different Transformant and homozygous lines.

Examples detailed above shows the method that the present invention improves cotton, can realize in secondary wall thickening synthesis phase specific regulatory 4 To cotton DELLA protein gene expressions, achieve the purpose that improve cotton fiber yield (ginning outturn and clothing refer to).

Bibliography：

1.Yue-Hua Xiao,Meng-Hui Yin,Lei Hou,and Yan Pei(2006)Direct amplification of intron-containing hairpin RNA construct from genomic DNA, BioTechniques 41:548-552(November 2006)。

Claims (7)

1. the plant expression vector of 4 pairs of cotton DELLA protein gene GhGAIs expression of regulation and control, described 4 pairs of genes are GhGAI1A With GhGAI1D, GhGAI2A and GhGAI2D, GhGAI3A and GhGAI3D, GhGAI4A and GhGAI4D；

The carrier includes the RNAi elements for targeting 4 pairs of genes of having connected；The RNAi elements have such as SEQ ID Nucleotide sequence shown in No.5；

The carrier includes the promoter for regulating and controlling the RNAi elements；The promoter is that secondary wall thickening synthesizes phase specificity Promoter；The promoter is cotton FbLate-2 gene promoters, and nucleotide sequence is as shown in SEQ ID No.6.

2. carrier as described in claim 1, it is characterised in that：The plant expression vector has such as SEQ ID No.7 institutes The nucleotide sequence shown.

3. the host cell containing carrier described in claim 1, the host cell is non-plant cell.

4. host cell as claimed in claim 3, it is characterised in that：The host cell is Agrobacterium tumefaciems.

5. improving the substance of cotton fiber yield, it is characterised in that：Its main active is carrier described in claim 1, or Host cell described in person's claim 3 or 4.

6. purposes of the carrier described in claim 1 in improving cotton fiber yield.

7. purposes of the host cell in improving cotton fiber yield described in claim 3 or 4.