CN110656110B - Cotton fiber specific expression promoter 8DP2 and application thereof - Google Patents

Abstract

The application discloses a cotton fiber specific expression promoter 8DP2, the nucleotide sequence of which is shown as SEQ ID NO. 1. The 8DP2 promoter sequence has fiber expression specificity in cotton, can guide the specific expression of a reporter gene in cotton fibers, and provides a promoter for fiber specific expression for improving the quality and yield of cotton fibers by utilizing genetic engineering.

Description

Cotton fiber specific expression promoter 8DP2 and application thereof

Technical Field

The application belongs to the technical field of genetic engineering, and particularly relates to a cotton fiber specific expression promoter.

Background

The cotton production is an important place in the national economy of China. Traditional breeding methods have been successful in cotton variety improvement, but for the last 20 years, the world cotton variety yields have reached a plateau. Therefore, it is difficult to greatly increase cotton yield using existing genetic resources and conventional breeding means. The genetic engineering method has the advantages of easy stability of offspring, short breeding period and the like, can break through genetic barriers among species, and realizes the directional transfer of excellent target genes. The improvement of cotton yield and fiber quality by genetic engineering is an effective way to solve this problem. However, the role of genetic engineering in crop improvement depends on the extent of progress in three ways: the function of target gene, the molecular mechanism of regulating target property and the specific promoter for controlling the expression of target gene in specific position and time. In genetic engineering improvement of cotton fiber quality and yield, it is often necessary to over-rate or inhibit expression of some genes in fiber cells to achieve the purpose of increasing yield or improving quality. In molecular mechanism research of cotton fiber development, a specific expression promoter of a fiber cell is also required to up-regulate or down-regulate the expression of a target gene, so that the function of the target gene in the fiber cell is analyzed. Minimizing the adverse effect of the target gene on other tissues and organs. However, the promoters with cotton fiber specificity that have been reported to date are very limited. Therefore, the cloning of the cotton fiber specific promoter has very important significance for the research of the cotton fiber development related gene functions and the genetic engineering improvement of cotton fibers.

In recent years, research on plant tissue organ and development-specific expression has become an important research field of plant molecular biology, and particularly in the practical stage of plant genetic engineering, research on tissue-specific expression has become a hot spot in order to preferentially express a target gene in a specific tissue organ and a specific development stage. Since the development of cotton fibers directly affects the quality and yield of the fibers. Therefore, research and screening of the fiber specific expression promoter not only is helpful for analyzing the molecular mechanism of gene expression regulation, but also can provide a useful regulation element for plant genetic engineering, and has important theoretical significance and application value.

Disclosure of Invention

It is an object of the present invention to provide a cotton fiber specific expression promoter 8DP2.

Another object of the present invention is to provide a plant expression vector comprising the above specific expression promoter 8DP2.

It is still another object of the present invention to provide a host (transformant) containing the above promoter or plant expression vector.

It is a further object of the present invention to provide the use of the above cotton fiber specific expression promoter 8DP2 in the preparation of transgenic plants.

It is a further object of the present invention to provide a method for preparing a transgenic plant.

To achieve the above object, one aspect of the present invention discloses a cotton fiber specific expression promoter 8DP2, wherein the nucleotide sequence of the promoter 8DP2 is shown as SEQ ID NO. 1.

In another aspect of the invention, an expression vector comprising the above promoter 8DP2 is disclosed. A preferred expression vector is a plant expression vector, more preferably pBI121-8DP 2:GUS.

According to yet another aspect of the present invention, a host comprising the above expression vector is disclosed. Preferably, the host is Agrobacterium tumefaciens. More preferably, the agrobacterium tumefaciens is agrobacterium LBA4404.

According to a further aspect of the invention, the use of the above-described promoter 8DP2 for the preparation of transgenic plants is disclosed. Preferably, the transgenic plant is cotton.

The invention also discloses application of the expression vector in preparation of transgenic plants. Preferably, the transgenic plant is cotton.

The application also discloses application of the host containing the plant expression vector in preparing transgenic plants. Preferably, the transgenic plant is cotton.

The application further discloses a method for preparing a transgenic plant by using the promoter 8DP2, which comprises the following steps:

(1) Operably inserting the promoter 8DP2 into an expression vector to construct a plant expression vector;

(2) Introducing the obtained plant expression vector into a host to obtain a transformant;

(3) Transforming a plant with the transformant, and culturing the transformed plant to obtain a transgenic plant.

Further, there is provided a method of preparing transgenic cotton comprising the steps of:

(1) Operably inserting the promoter 8DP2 into an expression vector to construct a plant expression vector;

(2) Introducing the obtained plant expression vector into a host to obtain a transformant:

(3) And transforming cotton callus regeneration tissues by using the transformant, culturing the cotton callus regeneration tissues, and obtaining cotton plants containing the cotton fiber specific promoter 8DP2 through screening and induction.

Compared with the prior art, the method has the following technical effects:

1) The application provides a promoter (8 DP 2) of cotton sphingolipid delta8 desaturase 1 (Ghdelta 8DES 1) and application thereof, wherein the promoter is a cotton fiber cell specific expression promoter.

2) The application successfully isolates the promoter of the Ghdelta8DES1 gene specifically expressed by cotton fibers by using a genetic engineering technology, and the 8DP2 promoter contains a 2179bp fragment.

3) The application also verifies that the 8DP2 promoter sequence has fiber expression specificity in cotton, can guide the specific expression of the reporter gene in cotton fiber, and provides a fiber specific expression promoter for improving the quality and yield of cotton fiber by using genetic engineering.

4) Compared with a constitutive promoter (such as a CaMV35S promoter), the 8DP2 promoter has higher fiber expression specificity and better expression efficiency (the expression efficiency of a plurality of fiber specific promoters is extremely low); in the genetic engineering of improving the fiber, the side effect caused by the expression of the target gene in other tissues and organs can be well avoided.

5) The application provides a new choice for further researching the functions of genes in fiber development, and provides an effective way for molecular design for improving cotton varieties and fiber quality.

Of course, it is not necessary for any of the products of the present application to be implemented simultaneously with all of the technical effects described above.

Drawings

The accompanying drawings, which are included to provide a further understanding of the application and are incorporated in and constitute a part of this application, illustrate embodiments of the application and together with the description serve to explain the application and do not constitute an undue limitation to the application. In the drawings:

FIG. 1 shows the expression characteristics of Ghdelta8DES1 gene in different organs and tissues of cotton in example 1 of the present application;

FIG. 2 shows the expression characteristics of Ghdelta8DES1 gene in example 1 of the present application at different development stages of cotton fiber and ovule;

FIG. 3 is a schematic diagram showing cis-regulatory elements on the 8DP2 promoter sequence of example 1 of the present application;

FIG. 4 is a map of the plant expression vector of pBI121-8DP 2:GUS in example 2 of the present application;

FIG. 5 is a schematic diagram showing the enzyme digestion verification electrophoresis of the plant expression vector analyzed by the promoter in example 2 of the present application;

FIG. 6 is an electrophoretogram of GUS gene in transgenic cotton for amplification verification in example 3 of the present application;

FIG. 7 is a graph showing expression of the 8DP2 promoter in roots, stems and leaves of transgenic cotton in example 3 of this application;

FIG. 8 is a diagram showing expression of 8DP2 promoter in transgenic cotton flower organ in example 3 of the present application;

FIG. 9 is a graph showing the expression of 8DP2 in example 3 of the present application during the development of transgenic cotton fibers.

Detailed Description

The following detailed description will be given with reference to the accompanying drawings and examples, by which the implementation process of how the technical means are applied to solve the technical problems and achieve the technical effects can be fully understood and implemented.

Reagents, drugs, materials are commercially available in the examples of this application, unless otherwise indicated, and methods are referred to in the guidelines for molecular cloning experiments (Sambrook and Russell, 2001).

In the following examples of the present application, the cotton test material used was Xuzhou 142 (Gossypium hirsutum L.cv Xuzhou 142), which was sourced from the cotton institute of China national academy of agriculture. The transgene acceptor is Ji cotton 14, which is derived from Hebei university of agriculture.

Example 1

1. Extraction of cotton RNA

Fresh cotton materials (roots, stems, leaves, flowers, ovules and fibers from 0 day post-flowering to ovules and fibers from 6 days post-flowering, fibers from 6 days post-flowering to fibers from 20 days post-flowering, ovules from 6 days post-flowering to ovules from 20 days post-flowering) were selected, and total RNA of each sample was extracted using EASYspin plant RNA rapid extraction kit (cat # RN 09) from bio-tech company of beijing Ai Delai (Aidlab, china) according to the instructions.

2. cDNA one-strand Synthesis

cDNA one-strand synthesis kit (PrimeScript) using Takara Shuzo Co., ltd ^TM RT reagent Kit with gDNA Eraser, cargo number: RR 047A) and total RNA extracted from experiment 1, a single strand of cDNA was synthesized. The product was frozen at-20 ℃.

3. Expression characteristics of Ghdelta8DES1 gene in different tissues, organs and different developmental stages of fiber ovule of cotton

The expression level of Ghdelta8DES1 was analyzed by real-time quantitative PCR amplification. Amplification was performed using a real-time quantitative PCR kit (Bio-Rad) comprising 10 microliters of amplification mix buffer (kit supply) in a 20 microliter reaction system, 1 microliter (5 microliter/liter) of each of the 5 '-and 3' -end primers, 1 microliter of cDNA, and the total of the cDNA strands was made up to 20 microliters with water. The cycle parameters were 94℃for 3 minutes of pre-denaturation; 94 ℃,30 seconds, 54 ℃,30 seconds, 72 ℃,30 seconds, and the preset cycle number is 40. Using cotton Histone3 gene as internal standard, the 5 '-primer of Histone3 is GhHIS1 (5'-ATGCCCAAGGACATCCAGTTG-3') (shown as SEQ ID NO. 2) and the 3' -primer is GhHIS2 (5'-CCTACCACTACCATCATGGCT-3') (shown as SEQ ID NO. 3). The 5 '-primer sequence of the amplified Ghdelta8DES1 gene is Ghdelta8DES1-1 (5'-GATACAGAGTGGTTGGATAGG-3') (shown as SEQ ID NO. 4), and the 3' -primer sequence is Ghdelta8DES1-2 (5'-GATCCTAGCAAAGCACATGAC-3') (shown as SEQ ID NO. 5).

Total RNA of different tissues and organs of cotton and different development periods of ovules of fiber were obtained by the methods of experiments 1 and 2 and analyzed by real-time quantitative RT-PCR. Before running the real-time quantitative PCR, the same primer and template are used for amplification once in the same temperature regulation program, and the electrophoresis of the amplified products ensures that the amplified products are single-band, and each sample is repeated 3 times.

As a result, as shown in FIG. 1, the Ghdelta8DES1 gene was hardly expressed in the cotton roots, stems, leaves, flowers, the day of flowering fiber ovules and the day of flowering 16 after flowering, and was expressed in a small amount in the ovules 10 days after flowering, and the expression level in the fiber cells 10 days after flowering was extremely high. The Ghdelta8DES1 gene has obvious expression specificity of the fiber cells and expression specificity of the fiber cells in development period. In fig. 2, 0DPA and 4DPA represent ovules (containing fibers) 0 day after flowering and ovules (containing fibers) 4 days after flowering, respectively; 6-F-20F, which respectively represent fibers from 6 days after flowering to 20 days after flowering; 6-O to 20-O, which represent ovules from 6 days after flowering to 20 days after flowering, respectively. During fiber development, the Ghdelta8DES1 gene is hardly expressed in the development initial stage (0 DPA), and the expression of the gene is gradually increased in the early elongation stage of fibers (4 DPA ovule fibers and 6DPA fibers); the expression level is highest in the rapid elongation period of the fiber cells (8 DPA fiber and 10DPA fiber); thereafter, the expression level gradually decreases; the expression level of this gene was very low during the initial stage of fibroblast secondary wall synthesis (16 DAP and 18 DPA); the expression level of the gene is extremely low in the secondary wall stable deposition phase of the fiber cell (the complete stop of the elongation phase of the fiber cell). Meanwhile, the gene is not basically expressed in the whole ovule development process except for a certain expression in the 6DPA ovule. Therefore, the Ghdelta8DES1 gene is specifically expressed in the fiber, and the expression level of the Ghdelta8DES1 gene is higher in the rapid elongation period of the fiber cell. Error bars in figures 1 and 2 represent standard deviations of 3 biological replicates.

4. Extraction of cotton genomic DNA

Cotton young leaves are taken, and the genomic DNA of cotton is extracted by using a novel plant genomic DNA rapid extraction kit (product number: DN 15) of Beijing Ai Delai (Aidlab, china) biotechnology company and stored at-20 ℃ for standby. The specific operations are performed in accordance with instructions.

5. Cloning of the promoter 8DP2 sequence of the Ghdelta8DES1 Gene

The published cotton D-subgenomic sequence (http:// www.phytozome.net) was searched using the cDNA sequence of the Ghdelta8DES1 gene. The 5' -upstream regulatory sequence of Ghdelta8DES1 gene was obtained, and then a specific primer 8DP2-up (5'-CCTAAAGCAACCACATGCTTC-3') was designed at about 2.0Kb upstream of ATG (as shown in SEQ ID NO. 6) and a specific primer 8DP2-down (5'-GGTTTGCATGTGGTGGAGAAT-3') was designed at the near ATG site (as shown in SEQ ID NO. 7), and amplification was performed using Xuzhou 142 genomic DNA as a template, with a 20. Mu.l reaction system comprising about 20 nanograms of cotton DNA, 10. Mu.l 2XTaq Master Mix (offshore technology Co., ltd., novoprotein, cat# E005-02), 5. Mu.l of each of the downstream primers, and water to 20. Mu.l. The amplification procedure was: 94 ℃ for 5 minutes; 94 ℃,30 seconds, 52 ℃,30 seconds, 72 ℃,2.5 minutes, 35 cycles; extension was carried out at 72℃for 10 minutes. The amplified product is recovered by electrophoresis and is connected to a cloning vector pMD19 (TaKaRa, dalian, china) to form a pMD19-8DP2 vector, and the result shows that the amplified fragment length is 2179bp and is named as 8DP2 after the transformation of escherichia coli, verification and sequencing, and is shown as SEQ ID NO. 1. Sequence analysis was performed in the plantacare database (http:// bioinformation. Psb. Ugent. Be/webtools/plantacare/html /), and the analysis results are shown in FIG. 3, wherein the sequence has a plurality of specific response elements, such as anaerobic response elements (AAACCA), brassinolide response elements (CACGTG), jasmonic acid response elements (CGTCA), MYB binding sites (CAACCA), defense and stress response elements (CTATCTCTTA), in addition to a plurality of TATA boxes and CAAT boxes and more photoreactive elements, which are possessed by a general promoter.

SEQ ID NO.1

CCTAAAGCAACCACATGCTTCATTGCTGTTTCTTTTTTCAATTAATCTAACATTCCAAACCATATCCTTCAACTACCCTTCAAAATTATATGGATATTCGTTTTTGAAAGGTTGAATATGCTACCATGATTATTATTTTTCAAATAAATTAAATTTCATTAAACATAATAAAATAAGGGTAGTAATAACTGTAATTAATCTTATCACTACATGAACGGAGACGATGGTGCACATCGACCAACAATTATAATCAAGGGCGAAGATAGAGAATTCTTTTAGGAGCTTGAATTAAGTTATTTTATATTGCTATAATTTGTTATTAGATCAAAAAAATTTCTATTTTAAAAAGGTCAAAGTGTAATTTTAACATTTACTAAATTAAAATCTTATAAAATGTAAAAGGTTAAAAGTGAAATTCCTTATTTTAGGGGACTGAAGCCGCTTACTGTATCCCTAAGACTAGTTGCACCGAGAGACGATGAAGATTTTATTTCTATGTAATGGTAAAAAAATTATGTTGTCATCACGTGACATCCTTCTCTATAAATATAGGTAGGTCCAATGTAATTTGATTTATACTTTGAAAATCAATACATATTTAAATAATTTAGAAGAGAGTATTGTATATGAAGATGATAACATTAATAAGTATATGAAGAAAAGCTCTTGTCTTGAAGGACTAAGCTAACATCACGTGGTTATATTTTACTACAAAATTGTGATTGTGTTAGGTTTGACTTCATTTCTTGTCGTCCAAGTAACAATATTTTCATGATGTAAACTTCAATCTTGACTAATTAAGTATAAATAATAATAATAATAACAACCAAAGCTGTCAAATTAATTGGAAAATTTCTATTAGGGATGAATTAATATCTACTCCATCACAACTTTTTCTAACTTTATTCTTGACATATTTTATCTATTTCGAAACTTGTCAACTTTATTAGGTGATGAATGGCACGACACAAATTTAAAGTGTCACATTATTATATTTTAATAAAATTTAAATTCAGAGACTAAATTAGAAAAAAAGTTCCTAAATTTCGAAACTAATGCAAACAAAAAGATCCCGTCACCAAAACGAACAAAATTATGACTAAATTTCATATTATCAAAAAGGAAAAACATGAGAAAATTTCAATCTTAATCTTAAAATTACTTGCAACTTGAAAGAATTTTCATGTACTTCTTTGCTTATTATAATATTTCTCTAGATCTATTCAAACATTGAATTATTTGATGATTAAAGTGATTGGACCGTTATTTCTACCATATAATAAAATAGATGTATTTAAATTTTCCTCTTTTAAAGGTGAGTTTGGATGGGCAGTGCGTTTATCTACAGTTAGTGTAAAAACAGTGGTGGCGGTGAGATTAGATACTGTAGCGTGAGACAAAAAGTAAGCTAAACGCACCGCACCGCACTCAAAACCCAATCGCCCACCCAAACCCACCCTAAGTCAACAAGATTTTATATTAATTACAAGGGTAAGTTTTGAGCAATAAAATCTCAAATAGTTAAAACCTATTTATTTACATACCTTTTTTAGAATTTATTTAAAAGGAAAACCACCCATATTTAACTAAAAAAAGTATTTTGTTATACAATTGCCTTCATTTAATTCAATAGAAACACATTTAATTTTTTTTCTATAAAAAGTATTATAATAAATATAAATAAGTTTCATTTTATCTTTTAGATAATTTATTTTAAAAATATAAAAAAGCAACCACTACATTTTGTTAAATTTAAAAAGGTTAAATATGCTTCAAATCTCTGTATTCTTTGTACATTTAGCATTTAGTCCCTCTCCTTTATTTTTCATGAATTTAGTCTTTGTACTTTTCAGATTTCAAAATTCAAGTTTAATTATTAACACTGTTAAAATTATTCCATTAAATTTGTCGATCTGACAGTTTTAATTAAACAAAAAACCATTGAAATGAACTTGAATTTAACAAAAGAATGTTAATAGGGTTTAACAATAAGACTTACATTTTTAAATTAAAAAAGTAGAGGGACTAAATCCCTTATTTTTCCTCATTCAATTTCATCCTTCTCTTTTTATTTTGGCTTTTGCTTTGCATGTGAGCTCTATAAACCCCGCCTCCCATTTTCCTCTACATCATGATAAATTCATATCACTTCCCTTCCATTCTCCACCACATGCAAACC

Example 2

Analysis of 8DP2 promoter construction of plant expression vector pBI121-8DP2:: GUS

The 8DP2 fragment was excised from the pMD19-8DP2 vector using Hind III and Xba I endonucleases and ligated into the pBI121 vector fragment double digested with Hind III and Xba I, thereby substituting the CaMV35S promoter in the pBI121 vector with the 8DP2 fragment. The plant expression vector pBI121-8DP2:: GUS (see FIG. 4) was constructed by enzyme digestion verification (see FIG. 5).

As shown in FIG. 4, the plant expression vector pBI121-8DP2 is shown in GUS, LB is the left border of the T-DNA segment; RB is the right border of the T-DNA segment; kan ^r Is a kanamycin resistance gene; GUS is a beta-glucosidase gene (reporter gene); the Nos-T is the opine synthase gene terminator.

In FIG. 5, M is a DNA Marker; 1-5 represent pBI121-8DP2 having been ligated into the 8DP2 fragment:: GUS plasmid. The fragment of about 2000bp is cut out in the sample 1-5, which shows that the vector plasmid already contains 8DP2 fragment, the promoter 8DP2 has been successfully inserted into the pBI121 vector, and the plant expression vector pBI121-8DP2 is successfully constructed.

Example 3

1. Genetic transformation of cotton

The constructed plant expression vector plasmid is introduced into agrobacterium LBA4404 strain by an electric excitation method, and cotton genetic transformation is carried out.

The above vectors were introduced into Agrobacterium LBA4404 strain by the electric shock transformation method, with reference to Bio-RAD Micropulser user's instructions.

The plant expression vector is introduced into cotton by an agrobacterium-mediated cotton hypocotyl transformation method. The specific method comprises the following steps:

ji cotton 14 (supplied by Hebei university of agriculture) seeds are dehulled and treated with 0.1% mercuric chloride (HgCl) ₂ ) Sterilizing for 10 min, and washing with large amount of sterile water for 8 times. About 35 ml of sterile water was added to a 125 ml Erlenmeyer flask and shaken overnight, and the sterile water was changed once a day. After the seed grows the hypocotyl root, sowing the seed on a seed germination culture medium, germinating for 2-3 days at 28 ℃ under the dark condition, and at the moment, the seed hypocotyl starts to enter a rapid elongation period, so that genetic transformation is suitable to be carried out.

Agrobacterium strains containing pBI121-8DP 2:GUS plant expression vectors for transformation were activated on YEB solid medium containing 50 mg/l kanamycin (Kan) and 125 mg/l streptomycin (Sm). Single colonies were picked and inoculated into 5 ml of YEB liquid medium containing the same antibiotic and shake-cultured overnight at 28℃at 200 rpm. Transferring the cultured Agrobacterium solution into 25 ml YEB liquid culture medium containing the same antibiotics according to the ratio of 1:20, continuously culturing until the OD600 value is about 0.6-0.8, centrifugally collecting thalli at 10000 rpm for 1 min, and re-suspending the thalli with an equal volume of liquid co-culture medium for later use.

During transformation, the cotton hypocotyl is cut into small sections of 1.5-2.0 cm, and the small sections are placed into a triangular flask to be infected by prepared agrobacterium tumefaciens bacteria liquid, wherein the conditions are that a shaking table is at 28 ℃ for 120 revolutions per minute, and the infection is carried out for 30 minutes. Then the bacterial liquid is sucked and transferred to a co-culture medium, and the hypocotyl segments are dark-cultured for 2-3 days at 28 ℃.

After co-cultivation, the hypocotyl sections were transferred to a hypocotyl screening medium, and light-cultivated at 28℃for about 20 days for a further time until a large number of calli appeared. The calli were transferred to embryogenic callus induction medium along with the lower embryo section, for approximately 15 days, once until a large number of pale yellow embryogenic calli were developed. Embryogenic callus is picked into embryogenic callus suspension medium and shake-cultured at 28 ℃ for about 120 revolutions per minute for one week. The fine sandy embryo is sucked by a 1.0 ml gun head minus the tip and spread on the embryo elongation culture medium, and a large amount of green small embryos appear after 20-30 days. And (3) picking and subculturing the somatic embryos with good growth state, and transferring the somatic embryos to a seedling culture medium for rooting and seedling emergence when the somatic embryos stretch to 1-2 cm. When the seedlings grow to 3-5 cm in height, the seedlings are transferred to a greenhouse flower pot for growth through grafting or transplanting. The culture medium used in this experimental example is shown in table 1.

TABLE 1 Agrobacterium tumefaciens-mediated transformation of cotton hypocotyls

/>

MS (base salt mixture): murashige & Skoog,1962; b5 Gamborg,1986.

2. Molecular validation of transgenic cotton

Cotton resistant young leaves were extracted using a novel plant genomic DNA rapid extraction kit (product number: DN 15) from Beijing Ai Delai (Aidlab, china) biotechnology company, and stored at-20℃for later use. The specific operations are performed in accordance with instructions. The resistant cotton genomic DNA was amplified with 8DP2-up (5'-CCTAAAGCAACCACATGCTTC-3') (shown as SEQ ID NO. 6) and a 3 'primer GUS-Down (5'-ATCGAAACGCAGCACGATACG-3') (shown as SEQ ID NO. 8) that binds to the 5' -end of the GUS gene, and the amplified fragment was expected to be approximately 2.4kb. A20. Mu.l reaction system comprised about 20 ng of cotton DNA, 10. Mu.l of 2XPrimeSTAR Max Premix (TaKaRa, dai, china, cat# R045), 5. Mu.m, 1. Mu.l of each of the upstream and downstream primers, and water was added to make up to 20. Mu.l. The amplification procedure was: 94 ℃ for 5 minutes; 94 ℃,30 seconds, 52 ℃,30 seconds, 72 ℃,20 seconds, 35 cycles; extending at 72℃for 30 seconds. The amplified products were detected by agarose gel electrophoresis.

As shown in fig. 6, M is a DNA Marker; "+" is positive control (boiled pBI121-8DP2:: GUS Agrobacterium solution); "W" is the amplification product with water as template; "C" is a negative control (non-transgenic cotton); 1 is a regenerated kanamycin (Kan) resistant shoot after transgene, indicating that the T-DNA segment has been integrated into the transgenic cotton genome. As can be seen from FIG. 6, a specific band of a promoter sequence of about 2.4kb and a part of the GUS gene (. Beta. -glucuronidase gene) was amplified from the resistant cotton plants, indicating that the exogenous fragment had been integrated into the genome of the transgenic cotton plants.

3. Detection of GUS Activity in transgenic Cotton

Randomly selecting 5 PCR positive transgenic cotton plants to perform comprehensive beta-Glucosidase (GUS) activity detection, wherein the GUS expression characteristics are basically consistent. Detecting the expression condition of roots, stems, leaves and flowers, wherein the detection result is shown in fig. 7 and 8, and Non-T is Non-transgenic wild cotton; 8DP2-GUS is pBI121-8DP2:: GUS vector transgenic cotton; 35S-GUS is pBI121 vector transgenic cotton. No positive signal was detected in all samples except for weak GUS signal in stamens, indicating that the 8DP2 promoter was not expressed in roots, stems, leaves, petioles and floral organs of cotton.

Further, GUS expression conditions of fibers at different development periods are detected, as shown in FIG. 9, wherein Non-T is the fiber of Non-transgenic wild cotton at different development periods; 8DP2-GUS is pBI121-8DP2, GUS vector transgenic cotton fibers at different development stages; 35S-GUS is the fiber of the pBI121 vector transgenic cotton at different development stages; 5DPA to 30DPA each represent fibers from 5 days after flowering to 30 days after flowering. There was little GUS signal on the fibroblasts 5 days post-flowering, higher GUS signal in the 10 and 15 day post-flowering fibers and lower GUS signal in the 20 to 30 day post-flowering fibers. The 8DP2-GUS samples showed weaker GUS signals at each stage compared to the 35S-GUS samples. The 8DP2 promoter is a fibroblast specific expression promoter, is high-volume expressed in the fiber rapid elongation period, is lower in expression in the fiber elongation later period and the secondary wall synthesis period, and has lower expression efficiency than the constitutive strong promoter CaMV35S.

The application provides a promoter (8 DP 2) of a sphingolipid delta8 desaturase gene Ghdelta8DES1 and application thereof, wherein the promoter is a cotton fiber cell specific expression promoter; the invention successfully separates the promoter of Ghdelta8DES1 gene specifically expressed by cotton fiber by utilizing a genetic engineering technology, wherein the 8DP2 promoter contains 2179bp fragments; the invention also verifies that the 8DP2 promoter sequence has fiber expression specificity in cotton, can guide the specific expression of a reporter gene in cotton fiber, and provides a promoter sequence for fiber specific expression for improving the quality and yield of cotton fiber by utilizing genetic engineering.

Compared with a constitutive strong promoter (such as a CaMV35S promoter), the 8DP2 promoter has weaker expression efficiency (the expression efficiency of a plurality of fiber-specific promoters is lower than that of the CaMV35S promoter) and fiber expression specificity; in the genetic engineering of improving the fiber, the side effect caused by the expression of the target gene in other tissues and organs can be well avoided. Provides a new choice for further researching the functions of genes in fiber development and provides an effective way for molecular design for improving cotton varieties and fiber quality.

Certain terms are used throughout the description and claims to refer to particular components or methods. It will be appreciated by those of ordinary skill in the art that different regions may be referred to by different terms as a single component. The description and claims do not take the difference in name as a way of distinguishing components. As used throughout the specification and claims, the word "comprise" is an open-ended term, and thus should be interpreted to mean "include, but not limited to. By "substantially" is meant that within an acceptable error range, a person skilled in the art is able to solve the technical problem within a certain error range, substantially achieving the technical effect. The description hereinafter sets forth the preferred embodiment for carrying out the present application, but is not intended to limit the scope of the present application in general, for the purpose of illustrating the general principles of the present application. The scope of the present application is defined by the appended claims.

It should also be noted that the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a product or system that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such product or system. Without further limitation, an element defined by the phrase "comprising one … …" does not exclude the presence of other like elements in a commodity or system comprising such elements.

While the foregoing description illustrates and describes the preferred embodiments of the present application, it is to be understood that this application is not limited to the forms disclosed herein, but is not to be construed as an exclusive use of other embodiments, and is capable of many other combinations, modifications and environments, and adaptations within the scope of the teachings described herein, through the foregoing teachings or through the knowledge or skills of the relevant art. And that modifications and variations which do not depart from the spirit and scope of the present invention are intended to be within the scope of the appended claims.

SEQUENCE LISTING

<110> university of southwest

<120> Cotton fiber specific expression promoter 8DP2 and application thereof

<130> CQ302-19P122631

<160> 8

<170> PatentIn version 3.3

<210> 1

<211> 2179

<212> DNA

<213> Gossypium hirsutum L.

<400> 1

cctaaagcaa ccacatgctt cattgctgtt tcttttttca attaatctaa cattccaaac 60

catatccttc aactaccctt caaaattata tggatattcg tttttgaaag gttgaatatg 120

ctaccatgat tattattttt caaataaatt aaatttcatt aaacataata aaataagggt 180

agtaataact gtaattaatc ttatcactac atgaacggag acgatggtgc acatcgacca 240

acaattataa tcaagggcga agatagagaa ttcttttagg agcttgaatt aagttatttt 300

atattgctat aatttgttat tagatcaaaa aaatttctat tttaaaaagg tcaaagtgta 360

attttaacat ttactaaatt aaaatcttat aaaatgtaaa aggttaaaag tgaaattcct 420

tattttaggg gactgaagcc gcttactgta tccctaagac tagttgcacc gagagacgat 480

gaagatttta tttctatgta atggtaaaaa aattatgttg tcatcacgtg acatccttct 540

ctataaatat aggtaggtcc aatgtaattt gatttatact ttgaaaatca atacatattt 600

aaataattta gaagagagta ttgtatatga agatgataac attaataagt atatgaagaa 660

aagctcttgt cttgaaggac taagctaaca tcacgtggtt atattttact acaaaattgt 720

gattgtgtta ggtttgactt catttcttgt cgtccaagta acaatatttt catgatgtaa 780

acttcaatct tgactaatta agtataaata ataataataa taacaaccaa agctgtcaaa 840

ttaattggaa aatttctatt agggatgaat taatatctac tccatcacaa ctttttctaa 900

ctttattctt gacatatttt atctatttcg aaacttgtca actttattag gtgatgaatg 960

gcacgacaca aatttaaagt gtcacattat tatattttaa taaaatttaa attcagagac 1020

taaattagaa aaaaagttcc taaatttcga aactaatgca aacaaaaaga tcccgtcacc 1080

aaaacgaaca aaattatgac taaatttcat attatcaaaa aggaaaaaca tgagaaaatt 1140

tcaatcttaa tcttaaaatt acttgcaact tgaaagaatt ttcatgtact tctttgctta 1200

ttataatatt tctctagatc tattcaaaca ttgaattatt tgatgattaa agtgattgga 1260

ccgttatttc taccatataa taaaatagat gtatttaaat tttcctcttt taaaggtgag 1320

tttggatggg cagtgcgttt atctacagtt agtgtaaaaa cagtggtggc ggtgagatta 1380

gatactgtag cgtgagacaa aaagtaagct aaacgcaccg caccgcactc aaaacccaat 1440

cgcccaccca aacccaccct aagtcaacaa gattttatat taattacaag ggtaagtttt 1500

gagcaataaa atctcaaata gttaaaacct atttatttac ataccttttt tagaatttat 1560

ttaaaaggaa aaccacccat atttaactaa aaaaagtatt ttgttataca attgccttca 1620

tttaattcaa tagaaacaca tttaattttt tttctataaa aagtattata ataaatataa 1680

ataagtttca ttttatcttt tagataattt attttaaaaa tataaaaaag caaccactac 1740

attttgttaa atttaaaaag gttaaatatg cttcaaatct ctgtattctt tgtacattta 1800

gcatttagtc cctctccttt atttttcatg aatttagtct ttgtactttt cagatttcaa 1860

aattcaagtt taattattaa cactgttaaa attattccat taaatttgtc gatctgacag 1920

ttttaattaa acaaaaaacc attgaaatga acttgaattt aacaaaagaa tgttaatagg 1980

gtttaacaat aagacttaca tttttaaatt aaaaaagtag agggactaaa tcccttattt 2040

ttcctcattc aatttcatcc ttctcttttt attttggctt ttgctttgca tgtgagctct 2100

ataaaccccg cctcccattt tcctctacat catgataaat tcatatcact tcccttccat 2160

tctccaccac atgcaaacc 2179

<210> 2

<211> 21

<212> DNA

<213> Synthetic

<400> 2

atgcccaagg acatccagtt g 21

<210> 3

<211> 21

<212> DNA

<213> Synthetic

<400> 3

cctaccacta ccatcatggc t 21

<210> 4

<211> 21

<212> DNA

<213> Synthetic

<400> 4

gatacagagt ggttggatag g 21

<210> 5

<211> 21

<212> DNA

<213> Synthetic

<400> 5

gatcctagca aagcacatga c 21

<210> 6

<211> 21

<212> DNA

<213> Synthetic

<400> 6

cctaaagcaa ccacatgctt c 21

<210> 7

<211> 21

<212> DNA

<213> Synthetic

<400> 7

ggtttgcatg tggtggagaa t 21

<210> 8

<211> 21

<212> DNA

<213> Synthetic

<400> 8

atcgaaacgc agcacgatac g 21

Claims (9)

1. The cotton fiber specific expression promoter 8DP2 is characterized in that the nucleotide sequence of the promoter 8DP2 is shown as SEQ ID NO. 1.

2. An expression vector comprising the promoter 8DP2 according to claim 1.

3. The expression vector of claim 2, wherein the expression vector is a plant expression vector that is pBI121-8DP 2:GUS.

4. A host comprising the expression vector of claim 2 or 3, characterized in that said host is agrobacterium tumefaciens.

5. Use of the cotton fiber specific expression promoter 8DP2 according to claim 1 for the preparation of transgenic plants.

6. The use according to claim 5, wherein the transgenic plant is cotton.

7. Use of an expression vector according to claim 2 or 3 for the preparation of transgenic plants.

8. The use according to claim 7, wherein the transgenic plant is cotton.

9. A method for preparing a transgenic plant using the cotton fiber specific expression promoter 8DP2 according to claim 1, comprising the steps of:

(1) Operably inserting the promoter 8DP2 into an expression vector to construct a plant expression vector;

(2) Transforming the obtained plant expression vector into a host to obtain a transformant;

(3) Transforming a plant with the transformant, and culturing the transformed plant to obtain a transgenic plant.

Images