CN110656110A - Cotton fiber specific expression promoter 8DP2 and application thereof - Google Patents

Abstract

The application discloses a cotton fiber specific expression promoter 8DP2, the nucleotide sequence of which is shown in SEQ ID NO. 1. The 8DP2 promoter sequence has fiber expression specificity in cotton, can guide the specific expression of a reporter gene in cotton fibers, and provides a fiber specific expression promoter for improving the quality and yield of cotton fibers by using genetic engineering.

Description

Cotton fiber specific expression promoter 8DP2 and application thereof

Technical Field

The application belongs to the technical field of genetic engineering, and particularly relates to a cotton fiber specific expression promoter.

Background

China is a big country for cotton production and consumption, and cotton production plays an important role in national economy of China. Traditional breeding methods have been successful in improving cotton varieties, but the yield of cotton varieties in the world has reached a plateau in recent 20 years. Therefore, the cotton yield is difficult to be greatly improved by using the existing genetic resources and the traditional breeding means. The genetic engineering method has the advantages of easy and stable progeny, short breeding period and the like, and can break genetic disorder among species and realize directional transfer of excellent target genes. The improvement of cotton yield and fiber quality by genetic engineering is an effective way to solve the problem. However, the role of genetic engineering in crop improvement depends on the degree of progress in three areas: the function of target gene, the molecular mechanism for regulating target character and the specific promoter for controlling the expression of target gene in specific position and specific time. In genetic engineering improvement of cotton fiber quality and yield, it is often necessary to over-express or inhibit the expression of certain genes in fiber cells for the purpose of improving yield or quality. In the research of molecular mechanism of cotton fiber development, a fiber cell specific expression promoter is also needed to up-regulate or down-regulate the expression of a target gene so as to analyze the function of the promoter in the fiber cell. And the adverse effect of the target gene on other tissues and organs is reduced to the maximum extent. However, promoters with cotton fiber specificity have been reported to date to be very limited. Therefore, the cloning of the cotton fiber specific promoter has very important significance for the research of the cotton fiber development related gene function and the improvement of the cotton fiber gene engineering.

In recent years, the study of plant tissue-organ and development-specific expression has become an important field of plant molecular biology, and particularly, in the practical stage of plant genetic engineering, the study of tissue-specific expression has become a focus in order to preferentially express a target gene in a specific tissue organ and a specific development stage. The development of cotton fiber directly affects the quality and yield of the fiber. Therefore, the research and screening of the fiber specific expression promoter not only is helpful to analyze the molecular mechanism of gene expression regulation, but also can provide useful regulation elements for plant genetic engineering, and has important theoretical significance and application value.

Disclosure of Invention

An object of the present invention is to provide a cotton fiber specific expression promoter 8DP 2.

Another object of the present invention is to provide a plant expression vector containing the above-mentioned specific expression promoter 8DP 2.

It is still another object of the present invention to provide a host (transformant) containing the above promoter or plant expression vector.

The invention also aims to provide application of the cotton fiber specific expression promoter 8DP2 in preparing transgenic plants.

It is still another object of the present invention to provide a method for preparing a transgenic plant.

In order to achieve the purpose, the invention discloses a cotton fiber specific expression promoter 8DP2 in one aspect, wherein the nucleotide sequence of the promoter 8DP2 is shown as SEQ ID NO. 1.

In another aspect of the invention, an expression vector containing the promoter 8DP2 is disclosed. Preferred expression vectors are plant expression vectors, more preferably pBI121-8DP2:: GUS.

According to yet another aspect of the present invention, a host containing the above expression vector is disclosed. Preferably, the host is agrobacterium tumefaciens. More preferably, the agrobacterium tumefaciens is agrobacterium LBA 4404.

According to another aspect of the invention, the application of the promoter 8DP2 in preparing transgenic plants is disclosed. Preferably, the transgenic plant is cotton.

The invention also discloses an application of the expression vector in preparing transgenic plants. Preferably, the transgenic plant is cotton.

The application also discloses application of a host containing the plant expression vector in preparing transgenic plants. Preferably, the transgenic plant is cotton.

The present application further discloses a method for producing a transgenic plant using the promoter 8DP2, comprising the steps of:

(1) operably inserting the promoter 8DP2 into an expression vector to construct a plant expression vector;

(2) introducing the obtained plant expression vector into a host to obtain a transformant;

(3) and transforming a plant with the transformant, and culturing the transformed plant to obtain a transgenic plant.

Further, a method for preparing transgenic cotton is provided, comprising the steps of:

(1) operably inserting the promoter 8DP2 into an expression vector to construct a plant expression vector;

(2) introducing the obtained plant expression vector into a host to obtain a transformant:

(3) and transforming the cotton callus regeneration tissue by using the transformant, culturing the cotton callus regeneration tissue, and screening and inducing to obtain a cotton plant containing the cotton fiber specific promoter 8DP 2.

Compared with the prior art, the application can obtain the following technical effects:

1) the application provides a promoter (8DP2) of cotton sphingolipid delta8 desaturase 1(Ghdelta8DES1) and application thereof, wherein the promoter is a cotton fiber cell specific expression promoter.

2) The application successfully separates the promoter of Ghdelta8DES1 gene specifically expressed by cotton fiber by using genetic engineering technology, wherein the 8DP2 promoter contains 2179bp fragment.

3) The application also verifies that the 8DP2 promoter sequence has fiber expression specificity in cotton, can guide the specific expression of a reporter gene in cotton fibers, and provides a fiber-specific expression promoter for improving the quality and yield of the cotton fibers by using genetic engineering.

4) Compared with a constitutive promoter (such as a CaMV35S promoter), the 8DP2 promoter has higher fiber expression specificity and better expression efficiency (most fiber-specific promoters have extremely low expression efficiency); in the genetic engineering of the improved fiber, the side effect caused by the expression of the target gene in other tissues and organs can be well avoided.

5) The method provides a new choice for further researching the functions of the genes in fiber development, and simultaneously provides an effective way for molecular design for improving cotton varieties and fiber quality.

Of course, it is not necessary for any one product to achieve all of the above-described technical effects simultaneously.

Drawings

The accompanying drawings, which are included to provide a further understanding of the application and are incorporated in and constitute a part of this application, illustrate embodiment(s) of the application and together with the description serve to explain the application and not to limit the application. In the drawings:

FIG. 1 shows the expression characteristics of the Ghdelta8DES1 gene in different organs and tissues of cotton in example 1 of the present application;

FIG. 2 shows the expression characteristics of the Ghdelta8DES1 gene in different developmental stages of cotton fiber and ovule in example 1;

FIG. 3 shows a cis-regulatory element present in the 8DP2 promoter sequence of example 1 of the present application;

FIG. 4 is a map of a GUS plant expression vector in pBI121-8DP2 in example 2 of the present application;

FIG. 5 is an enzyme digestion verification electrophoresis chart of promoter analysis plant expression vector in example 2 of the present application;

FIG. 6 is an electrophoretogram of GUS gene in amplification-verified transgenic cotton in example 3 of the present application;

FIG. 7 is a diagram showing the expression of the 8DP2 promoter in transgenic cotton roots, stems and leaves in example 3 of the present application;

FIG. 8 is a diagram showing the expression of the 8DP2 promoter in the floral organs of transgenic cotton in example 3 of the present application;

FIG. 9 is a graph showing the expression of 8DP2 in example 3 of the present application during the development of transgenic cotton fibers.

Detailed Description

Embodiments of the present application will be described in detail with reference to the drawings and examples, so that how to implement technical means to solve technical problems and achieve technical effects of the present application can be fully understood and implemented.

Unless otherwise indicated, reagents, drugs, materials in the examples of the present application are commercially available and the procedures are described in molecular cloning, a laboratory Manual (Sambrook and Russell, 2001).

In the following examples of the present application, the experimental cotton material used was xu 142(Gossypium hirsutum l.cv xu 142), which was obtained from the cotton institute of the chinese academy of agricultural sciences. The transgenic receptor is Ji cotton 14 and is from Hebei agriculture university.

Example 1

1. Extraction of cotton RNA

Selecting fresh cotton materials (roots, stems, leaves, flowers, ovules and fibers from 0 day after flowering to 6 days after flowering, fibers from 6 days after flowering to 20 days after flowering, ovules from 6 days after flowering to 20 days after flowering), extracting total RNA of each sample by using an EASYspin plant RNA rapid extraction kit (Cat: RN09) of Beijing Aidlab biotech, China, and carrying out specific operation according to an instruction.

2. cDNA one-Strand Synthesis

Using cDNA one-Strand Synthesis kit (PrimeScript) of Takara, Chinese Dalian^TMRT reagent Kit with gDNA Eraser, cat #: RR047A) and total RNA extracted in experiment 1, and synthesizing a cDNA single strand. The product was frozen at-20 ℃.

3. Expression characteristics of Ghdelta8DES1 gene in different tissue organs and different developmental stages of fiber ovule of cotton

The expression level of Ghdelta8DES1 was analyzed using real-time quantitative PCR amplification. The amplification was performed using a real-time quantitative PCR kit (Bio-Rad), comprising 10. mu.l of amplification mix buffer (provided by the kit) in a 20. mu.l reaction system, 1. mu.l each of 5 '-end and 3' -end primers (5. mu. mol/l), 1. mu.l of cDNA in one strand, and made up to 20. mu.l with water. The cycle parameter was 94 ℃ pre-denaturation for 3 min; 94 ℃, 30 seconds, 54 ℃, 30 seconds, 72 ℃, 30 seconds, and the preset number of cycles is 40. The cotton Histone3 gene was used as an internal standard, the 5 '-primer of Histone3 was GhHIS1(5'-ATGCCCAAGGACATCCAGTTG-3') (shown in SEQ ID NO. 2), and the 3' -primer was GhHIS2(5'-CCTACCACTACCATCATGGCT-3') (shown in SEQ ID NO. 3). The 5 '-primer sequence for amplifying the Ghdelta8DES1 gene is Ghdelta8DES1-1(5'-GATACAGAGTGGTTGGATAGG-3') (shown as SEQ ID NO. 4), and the 3' -primer sequence is Ghdelta8DES1-2(5'-GATCCTAGCAAAGCACATGAC-3') (shown as SEQ ID NO. 5).

The total RNA of different tissues and organs of cotton and different developmental stages of fiber ovules are obtained by the methods of the experiments 1 and 2 to carry out real-time quantitative RT-PCR analysis. Before running real-time quantitative PCR, the same primers and templates were amplified once in the same temperature control program, and the amplification product was confirmed to be a single band by electrophoresis of the amplification product, which was repeated 3 times per sample.

As shown in FIG. 1, the Ghdelta8DES1 gene was hardly expressed in cotton roots, stems, leaves, flowers, fiber ovules on the day of flowering and fiber cells 16 days after flowering, slightly expressed in ovules 10 days after flowering, and extremely highly expressed in fiber cells 10 days after flowering. The Ghdelta8DES1 gene is proved to have obvious fibroblast expression specificity and fibroblast development period expression specificity. In FIG. 2, 0DPA and 4DPA represent ovule (containing fiber) at 0 day after flowering and ovule (containing fiber) at 4 days after flowering, respectively; 6-F to 20F respectively represent fibers from 6 days after flowering to 20 days after flowering; 6-O to 20-O respectively represent ovules from 6 days after flowering to 20 days after flowering. During fiber development, the Ghdelta8DES1 gene is hardly expressed at the initial stage of development (0DPA), and its expression is gradually increased during the early elongation stage of fiber (4DPA ovule fiber and 6DPA fiber); the expression level is highest in the rapid elongation stage of the fiber cells (8DPA fibers and 10DPA fibers); thereafter, the expression amount gradually decreased; in the initial phase of the secondary wall synthesis of the fiber cells (16DAP and 18DPA), the expression level of the gene is very low; the expression level of the gene is extremely low in the stable deposition phase of the secondary wall of the fiber cells (the complete stop elongation phase of the fiber cells). Meanwhile, the gene is not expressed basically in the whole ovule development process except for certain expression in the 6DPA ovule. Therefore, the Ghdelta8DES1 gene is specifically expressed in the fiber and has higher expression level in the rapid elongation phase of the fiber cell. Error bars in fig. 1 and 2 represent standard deviations of 3 biological replicates.

4. Extraction of cotton genomic DNA

Cotton young leaves are taken, and the genomic DNA of cotton is extracted by a novel plant genomic DNA rapid extraction kit (product number: DN15) of Biotech company of Beijing Aidlab (China) and stored at-20 ℃ for later use. The specific operation is carried out according to the instruction.

5. Cloning of promoter 8DP2 sequence of Ghdelta8DES1 Gene

The published D-subgenomic sequence of cotton was searched using the cDNA sequence of the Ghdelta8DES1 gene (http:// www.phytozome.net). The 5' -upstream regulatory sequence of the Ghdelta8DES1 gene was obtained, and then specific primers 8DP2-up (5'-CCTAAAGCAACCACATGCTTC-3') (shown as SEQ ID NO. 6) and 8DP2-down (5'-GGTTTGCATGTGGTGGAGAAT-3') (shown as SEQ ID NO. 7) were designed at about 2.0Kb upstream of ATG, and amplified using Xuzhou 142 genomic DNA as a template, 20. mu.l of a reaction system containing about 20 ng of cotton DNA, 10. mu.l of 2XTaq Master Mix (Shanghai near shore science Co., Ltd., novoprotein, cat # E005-02. mu.l), and 5. mu.l/l of upstream and downstream primers each 1, and made up to 20. mu.l with water. The amplification procedure was: 94 ℃ for 5 minutes; 94 ℃, 30 seconds, 52 ℃, 30 seconds, 72 ℃, 2.5 minutes, 35 cycles; extension at 72 ℃ for 10 min. The amplified product is recovered by electrophoresis and is connected to a cloning vector pMD19(TaKaRa, Chinese Dalian) to form a pMD19-8DP2 vector, and the vector is transformed into escherichia coli, verified and sequenced, and the result shows that the length of the amplified fragment is 2179bp, which is named as 8DP2 and is shown as SEQ ID No. 1. Sequence analysis is carried out on a plant database (http:// bioinformatics. psb. agent. be/wbtools/planta/html /), and the analysis result is shown in FIG. 3, and the sequence has a plurality of specific response elements such as anaerobic response elements (AAACCA), brassinolide response elements (CACGTG), jasmonic acid response elements (CGTCA), MYB binding sites (CAACCA), defense and stress response elements (CTATCTCTTA) in addition to a plurality of TATA boxes and CAAT boxes of common promoters and a plurality of photoreactive elements.

SEQ ID NO.1

CCTAAAGCAACCACATGCTTCATTGCTGTTTCTTTTTTCAATTAATCTAACATTCCAAACCATATCCTTCAACTACCCTTCAAAATTATATGGATATTCGTTTTTGAAAGGTTGAATATGCTACCATGATTATTATTTTTCAAATAAATTAAATTTCATTAAACATAATAAAATAAGGGTAGTAATAACTGTAATTAATCTTATCACTACATGAACGGAGACGATGGTGCACATCGACCAACAATTATAATCAAGGGCGAAGATAGAGAATTCTTTTAGGAGCTTGAATTAAGTTATTTTATATTGCTATAATTTGTTATTAGATCAAAAAAATTTCTATTTTAAAAAGGTCAAAGTGTAATTTTAACATTTACTAAATTAAAATCTTATAAAATGTAAAAGGTTAAAAGTGAAATTCCTTATTTTAGGGGACTGAAGCCGCTTACTGTATCCCTAAGACTAGTTGCACCGAGAGACGATGAAGATTTTATTTCTATGTAATGGTAAAAAAATTATGTTGTCATCACGTGACATCCTTCTCTATAAATATAGGTAGGTCCAATGTAATTTGATTTATACTTTGAAAATCAATACATATTTAAATAATTTAGAAGAGAGTATTGTATATGAAGATGATAACATTAATAAGTATATGAAGAAAAGCTCTTGTCTTGAAGGACTAAGCTAACATCACGTGGTTATATTTTACTACAAAATTGTGATTGTGTTAGGTTTGACTTCATTTCTTGTCGTCCAAGTAACAATATTTTCATGATGTAAACTTCAATCTTGACTAATTAAGTATAAATAATAATAATAATAACAACCAAAGCTGTCAAATTAATTGGAAAATTTCTATTAGGGATGAATTAATATCTACTCCATCACAACTTTTTCTAACTTTATTCTTGACATATTTTATCTATTTCGAAACTTGTCAACTTTATTAGGTGATGAATGGCACGACACAAATTTAAAGTGTCACATTATTATATTTTAATAAAATTTAAATTCAGAGACTAAATTAGAAAAAAAGTTCCTAAATTTCGAAACTAATGCAAACAAAAAGATCCCGTCACCAAAACGAACAAAATTATGACTAAATTTCATATTATCAAAAAGGAAAAACATGAGAAAATTTCAATCTTAATCTTAAAATTACTTGCAACTTGAAAGAATTTTCATGTACTTCTTTGCTTATTATAATATTTCTCTAGATCTATTCAAACATTGAATTATTTGATGATTAAAGTGATTGGACCGTTATTTCTACCATATAATAAAATAGATGTATTTAAATTTTCCTCTTTTAAAGGTGAGTTTGGATGGGCAGTGCGTTTATCTACAGTTAGTGTAAAAACAGTGGTGGCGGTGAGATTAGATACTGTAGCGTGAGACAAAAAGTAAGCTAAACGCACCGCACCGCACTCAAAACCCAATCGCCCACCCAAACCCACCCTAAGTCAACAAGATTTTATATTAATTACAAGGGTAAGTTTTGAGCAATAAAATCTCAAATAGTTAAAACCTATTTATTTACATACCTTTTTTAGAATTTATTTAAAAGGAAAACCACCCATATTTAACTAAAAAAAGTATTTTGTTATACAATTGCCTTCATTTAATTCAATAGAAACACATTTAATTTTTTTTCTATAAAAAGTATTATAATAAATATAAATAAGTTTCATTTTATCTTTTAGATAATTTATTTTAAAAATATAAAAAAGCAACCACTACATTTTGTTAAATTTAAAAAGGTTAAATATGCTTCAAATCTCTGTATTCTTTGTACATTTAGCATTTAGTCCCTCTCCTTTATTTTTCATGAATTTAGTCTTTGTACTTTTCAGATTTCAAAATTCAAGTTTAATTATTAACACTGTTAAAATTATTCCATTAAATTTGTCGATCTGACAGTTTTAATTAAACAAAAAACCATTGAAATGAACTTGAATTTAACAAAAGAATGTTAATAGGGTTTAACAATAAGACTTACATTTTTAAATTAAAAAAGTAGAGGGACTAAATCCCTTATTTTTCCTCATTCAATTTCATCCTTCTCTTTTTATTTTGGCTTTTGCTTTGCATGTGAGCTCTATAAACCCCGCCTCCCATTTTCCTCTACATCATGATAAATTCATATCACTTCCCTTCCATTCTCCACCACATGCAAACC

Example 2

8DP2 promoter analysis plant expression vector pBI121-8DP2 GUS construction

The 8DP2 fragment was excised from the pMD19-8DP2 vector using HindIII and XbaI endonucleases and ligated into the pBI121 vector fragment double digested with HindIII and XbaI, so that the CaMV35S promoter in the pBI121 vector was replaced by the 8DP2 fragment. Through enzyme digestion verification (see figure 5), a plant expression vector pBI121-8DP2:: GUS (see figure 4) was constructed.

As shown in FIG. 4, the plant expression vector pBI121-8DP2 shows that in GUS, LB is the left border of the T-DNA segment; RB is the right border of the T-DNA segment; kan^rIs a kanamycin resistance gene; GUS is beta-glucuronidase gene (reporter gene); Nos-T is a crown gall alkali synthetase gene terminator.

In FIG. 5, M is a DNA Marker; 1-5 represent pBI121-8DP2 which has been inoculated with 8DP2 fragment, GUS plasmid. The fragments of about 2000bp are cut out in the samples 1-5 by enzyme, which indicates that the vector plasmid contains the 8DP2 fragment, the promoter 8DP2 is successfully inserted into the pBI121 vector, and the plant expression vector pBI121-8DP2 shows that GUS construction is successful.

Example 3

1. Genetic transformation of cotton

The constructed plant expression vector plasmid is introduced into agrobacterium LBA4404 strain by electric excitation method and cotton genetic transformation is carried out.

The above vector was introduced into Agrobacterium LBA4404 strain by electroporation, according to the Bio-RAD MicroPulser user's instructions.

The plant expression vector is introduced into cotton by an agrobacterium-mediated cotton hypocotyl transformation method. The specific method comprises the following steps:

peeling seeds of Ji cotton 14 (provided by Hebei agricultural university) and adding 0.1% mercuric chloride (HgCl)₂) Sterilized for 10 minutes and rinsed 8 times with copious amounts of sterile water. About 35 ml of sterile water was added to a 125 ml Erlenmeyer flask and shaken overnight, and the sterile water was changed the next day. After the seeds grow hypocotyl roots, the seeds are sown on a seed germination culture medium and germinate at the temperature of 28 ℃ in the dark condition to 2E to E3 days, when the hypocotyl of the seed begins to enter a period of rapid elongation, genetic transformation is suitably performed.

Agrobacterium strains containing the GUS plant expression vector for transformation were activated on YEB solid medium containing 50 mg/L kanamycin (Kan) and 125 mg/L streptomycin (Sm). A single colony was picked and inoculated in 5 ml of YEB liquid medium containing the same antibiotic, and shake-cultured overnight at 28 ℃ at 200 rpm. Transferring the cultured agrobacterium tumefaciens bacterial liquid into 25 ml of YEB liquid culture medium containing the same antibiotics according to the ratio of 1: 20, continuously culturing until the OD600 value is about 0.6-0.8, centrifugally collecting thalli at 10000 rpm for 1 minute, and suspending the thalli for later use by using the same volume of liquid co-culture medium.

During transformation, cutting the cotton hypocotyl into small sections of 1.5-2.0 cm, placing the small sections into a triangular flask, and infecting the small sections with the prepared agrobacterium liquid under the condition that the cotton hypocotyl is infected for 30 minutes by 120 revolutions per minute of a shaking table at 28 ℃. Then the bacterial liquid is sucked dry, the hypocotyl section is transferred to a co-culture medium, and dark culture is carried out for 2-3 days at 28 ℃.

After co-culture, the hypocotyl section is transferred to a hypocotyl section screening culture medium, and is subjected to illumination culture at 28 ℃ for about 20 days for subculture once until a large amount of callus appears. The calli together with the hypocotyls were transferred to embryogenic callus induction medium and subcultured once for about 15 days until a large number of pale yellow embryogenic calli appeared. The embryogenic callus is picked into an embryogenic callus suspension culture medium and is subjected to shake cultivation at 28 ℃ and 120 r/min for about one week. The fine sand-like somatic embryos are sucked by a 1.0 ml pipette tip with the tip removed and are laid on a somatic embryo elongation medium, and a large number of small green somatic embryos appear after 20 to 30 days. Selecting the somatic embryo with good growth state for subculture, and transferring the somatic embryo to a seedling culture medium for rooting and seedling emergence when the somatic embryo extends to 1-2 cm. When the seedlings grow to 3-5 cm high, the seedlings are transferred to a greenhouse flowerpot for growth in a grafting or transplanting mode. The culture media used in the present experimental examples are shown in table 1.

TABLE 1 Agrobacterium tumefaciens-mediated culture Medium for genetic transformation of Cotton hypocotyls

Note MS (base salt mixture): murashige & Skoog, 1962; b5 Gamborg,1986.

2. Molecular validation of transgenic cotton

The cotton resistant seedling young leaves are taken, the novel plant genome DNA rapid extraction kit (product number: DN15) of the Biotech company of Beijing Aidella (Aidlab, China) is utilized to extract the genome DNA of the cotton, and the cotton is preserved at the temperature of minus 20 ℃ for standby. The specific operation is carried out according to the instruction. The resistant cotton genomic DNA was amplified with 8DP2-up (5'-CCTAAAGCAACCACATGCTTC-3') (shown in SEQ ID NO. 6) and GUS-down (5'-ATCGAAACGCAGCACGATACG-3') (shown in SEQ ID NO. 8) as a 3 'primer binding to the 5' -end of the GUS gene, and the amplified fragment was expected to be about 2.4 kb. A20. mu.l reaction system contained about 20 ng of cotton DNA, 10. mu.l of 2XPrimeSTAR Max Premix (TaKaRa, Conn. chinensis., Cat. No.: R045), 5. mu.l of each of the upstream and downstream primers, and water was added to make up to 20. mu.l. The amplification procedure was: 94 ℃ for 5 minutes; at 94 ℃, 30 seconds, 52 ℃, 30 seconds, 72 ℃, 20 seconds, 35 cycles; extension at 72 ℃ for 30 seconds. Detecting the amplification product by agarose gel electrophoresis.

As shown in FIG. 6, M is a DNA Marker; "+" is a positive control (boiled pBI121-8DP2:: GUS Agrobacterium solution); "W" is an amplification product using water as a template; "C" is a negative control (non-transgenic cotton); 1 is a kanamycin (Kan) resistant shoot regenerated after the transgene, indicating that the T-DNA segment has integrated into the transgenic cotton genome. As can be seen in FIG. 6, a promoter sequence of about 2.4kb and a specific band of a part of GUS gene (. beta. -glucuronidase gene) were amplified from the resistant cotton plant, indicating that the foreign fragment had integrated into the genome of the transgenic cotton plant.

3. Detection of GUS Activity in transgenic Cotton

5 PCR positive transgenic cotton plants are randomly selected for comprehensive detection of the activity of beta-Glucuronidase (GUS), and the expression characteristics of GUS are basically consistent. The expression conditions of roots, stems, leaves and flowers are detected, and the detection results are shown in figures 7 and 8, wherein Non-T is Non-transgenic wild cotton; 8DP2-GUS is pBI121-8DP2 GUS vector transgenic cotton; 35S-GUS is pBI121 vector transgenic cotton. No positive signals were detected in all tested samples except for the weak GUS signal detected in the stamen, indicating that the 8DP2 promoter was not expressed in the roots, stems, leaves, petioles and floral organs of cotton.

Furthermore, GUS expression conditions of the fibers at different development stages are detected, and as shown in FIG. 9, Non-T in the figure is fibers of Non-transgenic wild type cotton at different development stages; 8DP2-GUS is pBI121-8DP2 GUS vector transgenes cotton fibers at different developmental stages; 35S-GUS is a fiber of pBI121 vector transgenic cotton in different development stages; 5DPA to 30DPA represent fibers from 5 days after flowering to 30 days after flowering, respectively. There was almost no GUS signal on fibroblasts 5 days after flowering, higher GUS signals in fibers 10 and 15 days after flowering, and lower GUS signals in fibers 20 to 30 days after flowering. The GUS signal was weaker in the 8DP2-GUS samples at each stage compared to the 35S-GUS samples. The 8DP2 promoter is a fiber cell specific expression promoter, is highly expressed in the fiber rapid elongation phase, is low in expression in the fiber elongation later phase and the secondary wall synthesis phase, and is lower in expression efficiency than a constitutive strong promoter CaMV 35S.

The application provides a promoter (8DP2) of a sphingolipid delta8 desaturase gene Ghdelta8DES1 and application thereof, wherein the promoter is a cotton fiber cell specific expression promoter; the invention successfully separates the promoter of Ghdelta8DES1 gene specifically expressed by cotton fiber by using genetic engineering technology, wherein the 8DP2 promoter contains 2179bp segment; the invention also verifies that the 8DP2 promoter sequence has fiber expression specificity in cotton, can guide the specific expression of a reporter gene in cotton fibers, and provides a fiber-specific expression promoter sequence for improving the quality and yield of the cotton fibers by using genetic engineering.

Compared with a constitutive strong promoter (such as a CaMV35S promoter), the 8DP2 promoter has slightly weaker expression efficiency (most fiber-specific promoters have lower expression efficiency than the CaMV35S promoter) and fiber expression specificity; in the genetic engineering of the improved fiber, the side effect caused by the expression of the target gene in other tissues and organs can be well avoided. Provides a new choice for further researching the function of the gene in fiber development, and simultaneously provides an effective way for molecular design for improving cotton varieties and fiber quality.

As used in the specification and claims, certain terms are used to refer to particular components or methods. As one skilled in the art will appreciate, different regions may refer to a component by different names. The present specification and claims do not intend to distinguish between components that differ in name but not in name. In the following description and in the claims, the terms "include" and "comprise" are used in an open-ended fashion, and thus should be interpreted to mean "include, but not limited to. "substantially" means within an acceptable error range, and a person skilled in the art can solve the technical problem within a certain error range to substantially achieve the technical effect. The description which follows is a preferred embodiment of the present application, but is made for the purpose of illustrating the general principles of the application and not for the purpose of limiting the scope of the application. The protection scope of the present application shall be subject to the definitions of the appended claims.

It is also noted that the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a good or system that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such good or system. Without further limitation, an element defined by the phrase "comprising an … …" does not exclude the presence of other like elements in a commodity or system that includes the element.

The foregoing description shows and describes several preferred embodiments of the present application, but as aforementioned, it is to be understood that the application is not limited to the forms disclosed herein, but is not to be construed as excluding other embodiments and is capable of use in various other combinations, modifications, and environments and is capable of changes within the scope of the application as described herein, commensurate with the above teachings, or the skill or knowledge of the relevant art. And that modifications and variations may be effected by those skilled in the art without departing from the spirit and scope of the application, which is to be protected by the claims appended hereto.

SEQUENCE LISTING

<110> university of southwest

<120> cotton fiber specific expression promoter 8DP2 and application thereof

<130> CQ302-19P122631

<160> 8

<170> PatentIn version 3.3

<210> 1

<211> 2179

<212> DNA

<213> Gossypium hirsutum L.

<400> 1

cctaaagcaa ccacatgctt cattgctgtt tcttttttca attaatctaa cattccaaac 60

catatccttc aactaccctt caaaattata tggatattcg tttttgaaag gttgaatatg 120

ctaccatgat tattattttt caaataaatt aaatttcatt aaacataata aaataagggt 180

agtaataact gtaattaatc ttatcactac atgaacggag acgatggtgc acatcgacca 240

acaattataa tcaagggcga agatagagaa ttcttttagg agcttgaatt aagttatttt 300

atattgctat aatttgttat tagatcaaaa aaatttctat tttaaaaagg tcaaagtgta 360

attttaacat ttactaaatt aaaatcttat aaaatgtaaa aggttaaaag tgaaattcct 420

tattttaggg gactgaagcc gcttactgta tccctaagac tagttgcacc gagagacgat 480

gaagatttta tttctatgta atggtaaaaa aattatgttg tcatcacgtg acatccttct 540

ctataaatat aggtaggtcc aatgtaattt gatttatact ttgaaaatca atacatattt 600

aaataattta gaagagagta ttgtatatga agatgataac attaataagt atatgaagaa 660

aagctcttgt cttgaaggac taagctaaca tcacgtggtt atattttact acaaaattgt 720

gattgtgtta ggtttgactt catttcttgt cgtccaagta acaatatttt catgatgtaa 780

acttcaatct tgactaatta agtataaata ataataataa taacaaccaa agctgtcaaa 840

ttaattggaa aatttctatt agggatgaat taatatctac tccatcacaa ctttttctaa 900

ctttattctt gacatatttt atctatttcg aaacttgtca actttattag gtgatgaatg 960

gcacgacaca aatttaaagt gtcacattat tatattttaa taaaatttaa attcagagac 1020

taaattagaa aaaaagttcc taaatttcga aactaatgca aacaaaaaga tcccgtcacc 1080

aaaacgaaca aaattatgac taaatttcat attatcaaaa aggaaaaaca tgagaaaatt 1140

tcaatcttaa tcttaaaatt acttgcaact tgaaagaatt ttcatgtact tctttgctta 1200

ttataatatt tctctagatc tattcaaaca ttgaattatt tgatgattaa agtgattgga 1260

ccgttatttc taccatataa taaaatagat gtatttaaat tttcctcttt taaaggtgag 1320

tttggatggg cagtgcgttt atctacagtt agtgtaaaaa cagtggtggc ggtgagatta 1380

gatactgtag cgtgagacaa aaagtaagct aaacgcaccg caccgcactc aaaacccaat 1440

cgcccaccca aacccaccct aagtcaacaa gattttatat taattacaag ggtaagtttt 1500

gagcaataaa atctcaaata gttaaaacct atttatttac ataccttttt tagaatttat 1560

ttaaaaggaa aaccacccat atttaactaa aaaaagtatt ttgttataca attgccttca 1620

tttaattcaa tagaaacaca tttaattttt tttctataaa aagtattata ataaatataa 1680

ataagtttca ttttatcttt tagataattt attttaaaaa tataaaaaag caaccactac 1740

attttgttaa atttaaaaag gttaaatatg cttcaaatct ctgtattctt tgtacattta 1800

gcatttagtc cctctccttt atttttcatg aatttagtct ttgtactttt cagatttcaa 1860

aattcaagtt taattattaa cactgttaaa attattccat taaatttgtc gatctgacag 1920

ttttaattaa acaaaaaacc attgaaatga acttgaattt aacaaaagaa tgttaatagg 1980

gtttaacaat aagacttaca tttttaaatt aaaaaagtag agggactaaa tcccttattt 2040

ttcctcattc aatttcatcc ttctcttttt attttggctt ttgctttgca tgtgagctct 2100

ataaaccccg cctcccattt tcctctacat catgataaat tcatatcact tcccttccat 2160

tctccaccac atgcaaacc 2179

<210> 2

<211> 21

<212> DNA

<213> Synthetic

<400> 2

atgcccaagg acatccagtt g 21

<210> 3

<211> 21

<212> DNA

<213> Synthetic

<400> 3

cctaccacta ccatcatggc t 21

<210> 4

<211> 21

<212> DNA

<213> Synthetic

<400> 4

gatacagagt ggttggatag g 21

<210> 5

<211> 21

<212> DNA

<213> Synthetic

<400> 5

gatcctagca aagcacatga c 21

<210> 6

<211> 21

<212> DNA

<213> Synthetic

<400> 6

cctaaagcaa ccacatgctt c 21

<210> 7

<211> 21

<212> DNA

<213> Synthetic

<400> 7

ggtttgcatg tggtggagaa t 21

<210> 8

<211> 21

<212> DNA

<213> Synthetic

<400> 8

atcgaaacgc agcacgatac g 21

Claims (10)

1. The cotton fiber specific expression promoter 8DP2 is characterized in that the nucleotide sequence of the promoter 8DP2 is shown as SEQ ID NO. 1.

2. An expression vector comprising the promoter 8DP2 of claim 1.

3. The expression vector of claim 2, wherein the expression vector is a plant expression vector, and the plant expression vector is pBI121-8DP2:: GUS.

4. A host comprising the expression vector of any one of 2 or 3.

5. The host of claim 4, wherein the host is Agrobacterium tumefaciens.

6. Use of the promoter 8DP2 according to claim 1 in the preparation of transgenic plants.

7. The use of claim 6, wherein the transgenic plant is cotton.

8. Use of an expression vector according to any one of claims 2 or 3 for the preparation of a transgenic plant.

9. The use of claim 8, wherein the transgenic plant is cotton.

10. A method for producing a transgenic plant using promoter 8DP2, comprising the steps of:

(1) operably inserting the promoter 8DP2 into an expression vector to construct a plant expression vector;

(2) transforming the obtained plant expression vector into a host to obtain a transformant;

(3) and transforming a plant with the transformant, and culturing the transformed plant to obtain a transgenic plant.

Images