CN109536501B

CN109536501B - Constitutive promoter pBnaC05g31880D of brassica napus and application thereof

Info

Publication number: CN109536501B
Application number: CN201811546418.7A
Authority: CN
Inventors: 华兆晖; 范世航; 李俊
Original assignee: Shihezi University; Oil Crops Research Institute of Chinese Academy of Agriculture Sciences
Current assignee: Shihezi University; Oil Crops Research Institute of Chinese Academy of Agriculture Sciences
Priority date: 2018-12-18
Filing date: 2018-12-18
Publication date: 2022-03-15
Anticipated expiration: 2038-12-18
Also published as: CN109536501A

Abstract

The invention discloses a constitutive promoter of Brassica napus and application thereof, and clones genes from Brassica napusBnaC05g31880DThe promoter constructs a plant expression vector of a reporter gene GUS regulated and controlled by the promoter, an agrobacterium-mediated inflorescence dip-staining method is adopted to transform arabidopsis thaliana, GUS histochemical method staining is carried out on a screened positive transgenic strain, and the result shows that downstream genes driven by pBnaC05g31880D are at root,Strong expression is found in stem, leaf, flower, pericarp, ovule, seed coat and mature seed. The promoter has good application potential in the aspects of improving crop quality by rape transgenosis and in the aspects of genetic engineering research fields such as artificial creation of germplasm resources and the like.

Description

Constitutive promoter pBnaC05g31880D of brassica napus and application thereof

Technical Field

The invention belongs to the field of plant genetic engineering and biotechnology, and particularly relates to a constitutive promoter pBnaC05g31880D of Brassica napus, which can be used for constitutive expression of a target gene in a plant.

Background

The plant gene promoter plays a key role in the expression regulation of genes, is positioned in the upstream region of the 5' end of a structural gene, contains a DNA sequence of cis-acting elements and determines the specificity, direction and efficiency of the transcription of downstream genes. In addition, the promoter plays a key role in the process of constructing a vector capable of expressing heterologous genes at high levels, and determines the temporal and spatial sequence of expression of the foreign genes, the expression intensity, the transcription efficiency and the expression level of the genes. Therefore, the research on the functions of the promoter has very important scientific significance for gene expression regulation and control mechanisms and plant genetic engineering which matures day by day.

Analysis of promoter regions of various plant genes shows that the promoters of most functional protein genes have a common structural pattern, and generally consist of a promoter core element and an upstream element. The TATA box located AT-20 to-30 bp upstream of the transcription initiation site is a core element of a promoter, is an AT-rich conserved sequence region, is related to the melting of a DNA (deoxyribonucleic acid) double strand, and determines the selection of a transcription initiation point, and is necessary for the correct expression of most plant promoters. The conserved sequence upstream of TATA box is called promoter upstream element, and includes general upstream promoter elements such as CAAT box at-75 bp and GC box near-80 to-110 bp, and other special upstream elements such as Jasmonate Response Element (JRE), Ethylene Response Element (ERE) (Zhang Chun Xiao, Wang wen chess, Jianxiangning, etc.. plant gene promoter research progress [ J ]. Gen Xue, 2004,31(12): 1455. quick 1464; Loujing, Huayan, Haoyaku, etc.. higher plant promoter and its application research progress [ J ]. Natural science progress, 2004,8: 002.). Among them, the CAAT box is a relatively conserved sequence, which is involved in recognition and binding of RNA (ribonucleic acid) polymerase, and has a strong activation effect on gene transcription. If these conserved structural blocks are present, they may have a function of promoting the expression of downstream genes in response.

Promoters can be classified into 3 types according to their transcription patterns: constitutive promoters, tissue or organ specific promoters and inducible promoters.

Among them, constitutive promoters (constitutive promoters) are called constitutive because the expression of genes controlled by these promoters is generally constant at a certain level, and there is no obvious difference in the expression level at different tissue sites, and they are characterized by continuous expression, relatively constant RNA and protein expression levels, no expression of temporal and spatial and organ specificity, and no induction by external factors. Plasmid vectors containing the 35S promoter from cauliflower virus (CaMV) or the nos promoter from bacterial nopaline synthase are commonly used for transformation of many dicotyledonous plants, while the most commonly used plasmid vectors for transformation of monocotyledonous plants are those containing the rice actin Act promoter, the maize ubiquitin Ubi promoter and the 35S promoter (Guanilin, Liuxianglin, Indian duckweed. efficient expression of foreign genes in transgenic plants and evaluation of their safety [ J ]. proceedings of the university of the capital faculty of sciences: Nature science edition, 2002,23(2): 52-56). The CaMV35S promoter and the nos promoter can drive exogenous genes to be expressed in most plants, for example, the promoters are applied to the research of transgenic plants such as rice, arabidopsis thaliana and wheat, however, the promoters are not derived from plants after all, so that potential biological insecurity may exist when the promoters are applied to plant genetic engineering. Research shows that the endogenous promoter has more advantages than the exogenous promoter in driving the high-efficiency expression of the exogenous gene of the transgenic dunaliella salina. Therefore, the study of plant endogenous constitutive promoters is very important.

Inducible promoters mainly comprise abiotic stress inducible promoters, biotic stress inducible promoters, hormone inducible promoters and the like (Neilina, Charanqin, Xumegashi and the like. cloning of plant gene promoters and development of function research thereof [ J ]. plant genetic resource bulletin, 2008,9(3): 385-391). However, the application of inducible promoters has certain limitations, and the external condition treatment, such as heat shock, hormone treatment and the like, performed on the recipient plants can cause a series of physiological and biochemical reactions in organisms and is not favorable for the normal growth of the plants. Furthermore, methyl dehydrocortisol, estradiol and tetracycline, which are used as inducers in chemical regulatory systems, are all harmful to the ecological environment and are not suitable for production practice.

In recent years, research on tissue-specific promoters has been greatly advanced, including organ-specific expression promoters such as leaf, phloem, vascular bundle, root, and the like, and reproductive organ-specific expression promoters such as pollen, stamen, pistil, fruit, seed, and the like (Sungyang, Zyongqiang. plant tissue-specific promoter research [ J ] Biotech, ,2007(6): 21-24).

These reports are examples of promoter function analysis among different plants using transgenic technology, and these examples show that the function of promoters from other plants is widely recognized and accepted through expression analysis of transgenic plants using model plants such as Arabidopsis thaliana, tobacco, etc. as vectors.

The rape is an important edible oil source, the traits of the rape such as yield, oil content, resistance and the like are improved through transgenosis, and the rape is a hot topic for researchers, so that the screening of endogenous constitutive expression promoters of the rape is necessary. According to experimental analysis, the promoter pBnaC05g31880D shows strong constitutive characteristics, in pBnaC05g31880D transgenic arabidopsis thaliana, the reporter gene GUS driven by the promoter is strongly expressed in roots, stems, leaves, flowers, horny pericarp and ovule of the transgenic arabidopsis thaliana, and the data fully indicate that pBnaC05g31880D is a strong constitutive expression promoter and has a good application prospect in plant transgenic breeding.

Disclosure of Invention

One of the purposes of the invention is to provide a Brassica napus promoter pBnaC05g31880D, which has the advantages that the promoter is a constitutive promoter derived from rape endogenesis and can drive a target gene to have strong expression capacity in each tissue and each period of a transgenic plant. Therefore, the promoter can be applied to genetic engineering research and germplasm resource improvement research of plants.

The second purpose of the invention is to provide an amplification primer of the Brassica napus pBnaC05g31880D promoter. The genome DNA of the cabbage type rape is used as a template, the specific primer is adopted for PCR amplification, and a cabbage type rape promoter pBnaC05g31880D sequence is obtained, so that the operation is simple, the product is specific, and the result is stable and reliable.

The invention also aims to provide a recombinant vector containing a plant high-efficiency expression promoter pBnaC05g 31880D. The recombinant vector can be a constitutive promoter inserted into a plant expression vector DX2181G, is suitable in size, is easy to transform in plants, and is high in GUS expression strength of a carried marker gene and easy to detect.

The fourth purpose of the invention is to provide the application of the Brassica napus promoter pBnaC05g31880D in constitutively expressing target genes in various tissues of plants, such as roots, stems, leaves, flowers, pericarps, ovules, seed coats, mature seeds and the like. Driven by the promoter, the target gene has strong expression in roots, stems, leaves, flowers, horny pericarps, ovules, seed coats and mature seeds. The promoter with the constitutive expression characteristic has good application value in genetic engineering such as establishment of excellent germplasm resources and the like and transgene safety.

In order to achieve the purpose, the invention adopts the following technical scheme:

cloning of the promoter pBnaC05g 31880D: PCR amplification is carried out by taking genome DNA of Brassica napus as a template, a forward primer pBnaC05g31880D-F is 5'-GAGATCTACAGCGCTAAGCTTtatcagacatggagaagaac-3', a reverse primer pBnaC05g31880D-R is 5'-GGACTGACCACCCGGGGATCCaaagaactgttgttttgctc-3' (in the primer pBnaC05g31880D-F, a sequence GAGATCTACAGCGCT is an upstream sequence of a fusion site of a vector DX2181G, a sequence AAGCTT is a restriction enzyme digestion site of Hind III, in the primer pBnaC05g31880D-R, a sequence GGACTGACCACCCGG is a downstream sequence of a fusion site of a vector DX2181G, and a sequence GGATCC is a restriction enzyme digestion site of BamH I), and a sequence of pBnaC05g31880D of the Brassica napus is obtained and is shown as SEQ ID NO: 1.

The construction method of the recombinant vector DX2181G-pBnaC05g31880D comprises the following steps:

double enzyme digestion of plant expression vector DX2181G with Hind III and BamH I, detection and recovery by 1% agarose gel electrophoresis; the promoter pBnaC05g31880D and the recovered enzyme cutting plasmid are cloned according to a one-step cloning kit (

Entry One Step Cloning Kit), transforming E.coli competent DH5 alpha after 30min water bath at 37 ℃; the single clone that grew out was purified with the vector upstream primer DX 2181G-F: TACGTCGCCGTCCAGCTCGA and a target sequence specific primer pBnaC05g 31880D-R: GGACTGACCACCCGGGGATCCaaagaactgttgttttgctc and carrying out positive clone detection, and extracting expression vector plasmid of the positive clone, wherein the plasmid is the recombinant vector DX2181G-pBnaC05g 31880D.

Functional analysis of promoter pBnaC05g31880D and its application in Arabidopsis thaliana root, stem, leaf, flower, silique peel, ovule expression:

the promoter cis-acting element is subjected to online prediction analysis by promoter functional element prediction software plantarCARE, and the result shows that the cloned promoter sequence contains TATA box core promoter sequence, upstream promoter elements such as CAAT box and the like and endosperm specific expression elements; on the basis, a plant expression vector DX2181-pBnaC05g31880D of reporter gene GUS regulated and controlled by the promoter is constructed; transforming arabidopsis thaliana by adopting an agrobacterium-mediated inflorescence dip-dyeing method, and obtaining a transgenic positive plant by double screening of hygromycin and PCR; GUS histochemical staining is carried out on positive transgenic lines, and the result shows that GUS gene driven by the promoter is strongly expressed in root, stem, leaf, flower, horny pericarp and ovule of Arabidopsis thaliana. Therefore, the GUS gene driven by the promoter has constitutive expression characteristics; the promoter with the characteristic has good application value in the aspects of artificially creating excellent germplasm resources, plant genetic engineering and the like.

Compared with the prior art, the invention has the following advantages and beneficial effects:

1. the promoter can drive the expression of downstream target genes in plant roots, stems, leaves, flowers, horny pericarp, ovules, seed coats and mature seeds, and has a constitutive expression characteristic.

2. A breeding expert can utilize the constitutive expression characteristic of the gene to express a target gene to change plant traits, such as functional genes for improving photosynthesis and the like, is used for artificially creating excellent germplasm resources and the like, and has good application potential for modern agriculture.

Drawings

FIG. 1 is the electrophoresis picture of Brassica napus BnaC05g31880D gene promoter fragment

Lane 1 is nucleic acid Marker of DL 2000; lane 2 shows the results of the PCR amplification of the promoter fragment using genomic DNA as a template.

FIG. 2 is a diagram showing the results of sequence analysis of pBnaC05g31880D promoter.

FIG. 3 is a map of plant expression vector DX 2181G.

FIG. 4 is a T-DNA region map of the construction vector DX2181G-pBnaC05g 31880D.

FIG. 5 is the PCR identification result chart of transgenic plant

Lane 1 is nucleic acid Marker of DL 2000; lanes 2-13 are different strains of transgenic Arabidopsis.

FIG. 6 is a diagram showing the histochemical staining result of transgenic Arabidopsis GUS.

A: maturing the seeds; b: 3 days, seedling growing; c: 35 days for seedling; d: stems and flowers; e: flower; f: carrying out silique; g: young ovules; h: young embryos.

Detailed Description

The methods used in the following examples are conventional methods unless otherwise specified, the primers used are synthesized by Wuhan Optimalaceae Biotech, Inc., and the sequencing is performed by Wuhan Optimalaceae Biotech, Inc.,

entry One Step Cloning Kit from Nanjing Novozam Biotechnology LimitedThe rapid endonuclease is purchased from Thermo Fisher Scientific, the DNA gel recovery kit, the DNA Marker and the like are purchased from Dalibao biological company, and the cabbage type rape variety Darmor used in the experiment is a gift from Withania Liusheng and Yiyi teacher of oil crop research institute of Chinese academy of agricultural sciences; columbia wild type Arabidopsis Thaliana Arabidopsis Thaliana, Escherichia coli susceptible strain DH5 alpha, Agrobacterium susceptible strain GV3101, and modified plant genetic expression vector DX2181G, etc. are stored in the laboratory.

Example 1: primer sequence design of rape promoter pBnaC05g 31880D:

designing a pair of primers according to 1525bp of a gene interval Sequence at the upstream of a BnaC05g31880D gene (Sequence ID: GCF _000686985.2) obtained by rape whole genome sequencing for PCR amplification, and obtaining a 5' upstream promoter Sequence of rape BnaC05g31880D by amplification, wherein the used primers are pBnaC05g 31880D-F: 5'-GAGATCTACAGCGCTAAGCTTtatcagacatggagaagaac-3' and pBnaC05g 31880D-R: 5'-GGACTGACCACCCGGGGATCCaaagaactgttgttttgctc-3' are provided. In the primer pBnaC05g31880D-F, the sequence GAGATCTACAGCGCT is the upstream sequence of the fusion site of the vector DX2181, and the sequence AAGCTT is the enzyme cutting site of Hind III; in the primer pBnaC05g31880D-R, the sequence GGACTGACCACCCGG is the downstream sequence of the fusion site of the vector DX2181, and the sequence GGATCC is the enzyme cutting site of BamH I.

Example 2: preparation of the rape promoter pBnaC05g 31880D:

the rape used in the invention is cabbage type rape (Brassica napus L.) (provided by oil crop research institute of Chinese academy of agricultural sciences, the same applies below), and the rape is sowed in a field for normal field management. Extracting genome DNA of rape leaves by a CTAB method, and carrying out Polymerase Chain Reaction (PCR) by taking the extracted whole genome DNA of the rape as a template. The PCR system is as follows: 2 Xmix buffer 25. mu.L, pBnaC05g 31880D-F: 1 μ L, pBnaC05g 31880D-R: 1 μ L, DNA1 μ L, ddH₂O22. mu.L. The PCR procedure was: 5min at 94 ℃; 30s at 94 ℃,30 s at 56 ℃, 1min at 72 ℃ and 35 cycles; 10min at 72 ℃; infinity at 4 ℃. The size of the PCR product is 990bp (see figure 1), and the PCR product is identified by 1.0% agarose gel electrophoresis and purified, recovered and detected according to the kit instructions.

The DX2181G vector plasmid is completely digested by Hind III and BamH I, and is recovered by 1% agarose gel electrophoresis. The recovered PCR product and the digested plasmid were cloned in one step (kit)

Entry One Step Cloning Kit) instructions (5 × CE II Buffer 4. mu.L, linearized Cloning vector 50-200 ng, insert amplification product 20-200 ng,

II 2μL，ddH₂o to 20. mu.L), water bath at 37 ℃ for 30min, and then transformed into E.coli competent DH 5. alpha. The single clone that grows out is divided into two parts by a carrier upstream primer DX 2181-F: TACGTCGCCGTCCAGCTCGA and a target sequence specific primer pBnaC05g 31880D-R: GGACTGACCACCCGGGGATCCAAAGAACTGTTGTTTTGCTC, carrying out positive clone detection, sending the positive single clone to Wuhan engine department biotechnology limited company for sequencing through PCR detection, and obtaining the rape BnaC05g31880D gene full-length promoter, wherein the sequence is the nucleotide sequence shown in SEQ ID NO. 1 and is named pBnaC05g 31880D.

Example 3: sequence analysis and function prediction of the rape promoter pBnaC05g 31880D:

the sequence pBnaC05G31880D cloned and sequenced was used for on-line predictive analysis of functional elements using the promoter core element prediction software PLATCARE (Lescot M, D hais P, Thijs G, et al. PLATCARE, a database of plant-activity assays and a port to tools for in silico analysis of promoter sequences [ J ]. Nucleic acids research,2002,30(1):325-327.http:// bio information. psb. element. be/web tools/PLATCARE/html /). The results showed that pBnaC05g31880D contains the core elements TATA box and CAAT box necessary for eukaryotic promoters, as shown in table 1 and fig. 2. Further analysis of the promoter sequence revealed that, in addition to the essential core elements, various promoter functional elements were present in the pBnaC05g31880D sequence: ARE: cis-acting element induced in light responsiveness, an optical compliance response regulating element; ACE: cis-acting elements necessary for the anaerobic induction; box 4: part of a conserved DNA module of photoresponsive regulatory elements; CGTCA-motif: cis-acting regulatory element exerted in the MeJA-responsiveness, methyl jasmonate responding to cis-acting elements; LAMP-element: part of a light responsive element, a light responsive regulatory element; o2-site: cis-acting regulatory element involved in zein metabolism regulation, a zein metabolism regulatory element; p-box: gibberellin-responsive element, gibberellin-responsive element.

Example 4: construction of plant expression vector DX2181G-pBnaC05g31880D and transformation of Agrobacterium tumefaciens strain GV3101

The construction method of the recombinant vector DX2181G-pBnaC05g31880D adopts a one-step seamless cloning method of a target fragment and a vector subjected to enzyme digestion (

II One Step Cloning Kit): a simple, fast and efficient DNA directional cloning technology can directionally clone the PCR product of the insert to any site of any vector. The vector is digested and linearized, and the terminal sequences of the linearized vector are introduced into the 5' end of the insert PCR primer, so that the 5' and 3' extreme ends of the PCR product respectively have sequences (15 bp-20 bp) consistent with the two terminals of the linearized vector. After the PCR product with the carrier terminal sequences at the two ends and the linearized carrier are mixed according to a certain proportion, the conversion can be carried out only by reaction for 30min under the catalysis of the Exnase, and the directional cloning is completed. The constructed recombinant vector is obtained by recombining and replacing the polyclonal enzyme cutting site at the upstream of the GUS gene on the plasmid DX2181G by a pBnaC05g31880D fragment obtained by cloning. The method comprises the following steps:

1) double enzyme digestion of plant expression vector DX2181G with Hind III and BamH I, detection and recovery by 1% agarose gel electrophoresis;

2) the recovered PCR product pBnaC05g31880D and the above recovered restriction enzyme plasmid were cloned by one-step cloning kit (

The instructions of Entry One Step Cloning Kit) are performed (5 × CE II Buffer 4 μ L, linearized Cloning vector 50-200 ng, insert amplification product 20-200 ng,

II 2μL，ddH₂o until the final volume is 20 mu L), water bath is carried out at 37 ℃ for 30min, and then escherichia coli competent DH5 alpha is transformed;

3) the single clone that grows out is divided into two parts by a carrier upstream primer DX 2181-F: TACGTCGCCGTCCAGCTCGA and a target sequence specific primer pBnaC05g 31880D-R: GGACTGACCACCCGGGGATCCaaagaactgttgttttgctc, carrying out positive clone detection, sending the positive single clone to Wuhan engine department biotechnology limited company for sequencing through PCR detection, and analyzing results show that the rape BnaC05g31880D gene full-length promoter is obtained, and the sequence of the promoter is SEQ ID NO:1 and the extracted recombinant plasmid is named as DX2181G-pBnaC05g 31880D.

The method for transforming the agrobacterium-infected cell GV3101 by using a freeze-thaw method comprises the following steps:

1) thawing Agrobacterium-infected competent cell GV3101 stored at-80 deg.C on ice;

2) taking 3 μ L (100ng) of expression vector plasmid DX2181G-pBnaC05g31880D with pipette tip, immersing the pipette tip into competent cells, standing on ice for 30min, rapidly freezing in liquid nitrogen for 1min, and water-bathing in 37 deg.C constant temperature water bath for 5 min;

3) 600 μ L of LB liquid medium (tryptone 10 g; 5g of yeast extract; NaCl 10g), at 28 ℃ and 200rpm, and carrying out shake culture for 4 h;

4) spread on solid LB medium supplemented with 50. mu.g/mL kanamycin, 50. mu.g/mL gentamicin and 50. mu.g/mL rifampicin (tryptone 10 g; 5g of yeast extract; 10g of NaCl; agar 1.5%), and performing inverted culture at 28 ℃ for 36-48 h;

5) growing a monoclonal antibody by using a plant expression vector upstream primer DX 2181-F: TACGTCGCCGTCCAGCTCGA and a target sequence specific primer pBnaC05g 31880D-R: GGACTGACCACCCGGGGATCCAAAGAACTGTTGTTTTGCTC and performing positive clone detection, shaking the monoclone bacteria which are detected to be positive by PCR until OD600 is 1.8-2.0 (detected by an ultraviolet spectrophotometer), and preserving the bacteria at the ultralow temperature of-80 ℃ by using equal volume of 50% glycerol for subsequent research.

Example 5: genetic transformation of plant expression vector DX2181G-pBnaC05g31880D in Arabidopsis thaliana and transgenic plant screening

1. Floral dip transformation of arabidopsis thaliana:

1) after the arabidopsis is bolting, cutting off the top end of the main flower wadding, and preparing a material for transformation when the lateral branches grow consistently and are in a bud period;

2) inoculating Agrobacterium DX2181G-pBnaC05g31880D carrying the gene of interest with 200mL LB liquid medium containing 50. mu.g/mL kanamycin, 50. mu.g/mL gentamicin and 100. mu.g/mL rifampicin, culturing at 28 deg.C and 200rpm for 12-18 h;

3) the bacterial liquid is filled in a centrifugal bottle, centrifuged at 5000rpm for 15min, and the supernatant is sucked away by a pipette and discarded;

4) resuspend Agrobacterium with 100mL resuspension (5% sucrose, 0.02% surfactant); soaking the arabidopsis thaliana flower wadding in the bacterial solution for 30s, and gently stirring;

5) after the dip dyeing is finished, covering the cotton cloth with a plastic film overnight, improving the conversion efficiency, and converting once again after 5-7 days;

6) after approximately one month, the seeds were ripe, harvested, placed in an oven at 37 ℃ for 7 days, threshed and vernalized at 4 ℃ for 3 days, labeled as T0 seed generation.

2. Screening positive transgenic plants:

1) taking a proper amount (not more than 1/5 of an EP tube) of clean arabidopsis seeds which are threshed and placed in a 1.5mL EP tube;

2) adding 1mL of 75% alcohol, washing for 1min by shaking, centrifuging at 8000rpm for 30s, sucking away the supernatant with a pipette and discarding;

3) adding 1mL of 10% sodium hypochlorite, washing for 5min by shaking, centrifuging at 8000rpm for 30s, sucking away the supernatant with a pipette and discarding;

4) add 1mL dd H₂O, washing with shaking for 1min at 8000Centrifuging at rpm for 30s, sucking the supernatant with a pipette and discarding;

5) repeat step 4) three times, add 1mL ddH₂O, vernalization is carried out for 3d at 4 ℃ under the dark condition;

6) plated on 1/2MS medium (MS powder 2.15 g; 10g of cane sugar; 0.8 percent of agar; pH5.8), containing 25mg/L hygromycin, culturing in a dark incubator for about 5 days, and converting to normal illumination culture;

7) when two true leaves are grown in equal length, transplanting the plantlets with the hypocotyls elongated and normal true leaf growth into a greenhouse culture pot (nutrient soil: vermiculite: perlite 3: 1: 1) (ii) a

8) Taking leaves before bolting of the plant which grows normally, and extracting genome DNA (deoxyribonucleic acid) by using upstream primers DX2181-F of a plant expression vector: TACGTCGCCGTCCAGCTCGA and a target sequence specific primer pBnaC05g 31880D-R: GGACTGACCACCCGGGGATCCAAAGAACTGTTGTTTTGCTC screening positive transgenic plants, detecting the transgenic material positive by PCR as T1 generation (see figure 5), harvesting the individual plants, and sequentially numbering and storing. The T1 generation transgenic material is identified as T2 generation by hygromycin resistant screening and PCR, and the individual plants are harvested, numbered and stored in turn. And then screening the T2 generation again to obtain a homozygous transgenic line.

Example 6: functional analysis of Brassica napus pBnaC05g31880D promoter

GUS expression in plant tissue cells was detected by histochemical staining. Different parts of the T2 generation transgenic arabidopsis prepared in example 5 are taken, and the specific steps are as follows: root, stem, leaf, flower, cuticle, ovule, seed coat and mature seed. After sampling, appropriate amount of GUS staining solution (50mmol/L PBS, pH 7.0; 0.5mol/L X-Gluc; 50mmol/L of potassiumtricyanide; 10mmol/L EDTA, 0.001% Triton X-100 and 20% methanol) was added to the small centrifuge tube or culture dish. Keeping the temperature at 37 ℃ for reaction for more than 1h or overnight; then, the mixture was decolorized in 70% ethanol and photographed by observation using a stereoscope (Olympus SZX 7). The blue-stained part of the plant is the GUS gene expression part, and the spatiotemporal expression pattern of pBnaC05g31880D is explored by detecting the expression part and the expression intensity of the GUS gene under different spatiotemporal conditions.

The results show (FIG. 6) that GUS gene driven by the promoter is highly expressed in root, stem, leaf, flower, horny pericarp, ovule, seed coat and mature seed of Arabidopsis thaliana. Thus, the promoter has the property of driving constitutive expression of downstream genes in plants. The promoter with constitutive expression has good application value in plant genetic engineering. Such as: by constructing a vector containing the promoter driving target gene, an anti-biotic or abiotic stress functional gene, such as a functional gene for improving photosynthesis and the like, the arabidopsis thaliana or the rape of a receptor plant is transformed, the resistance of the receptor plant is improved, the biomass is increased and the like, and a high-quality high-yield high-oil material is artificially created and applied to agricultural production.

Sequence listing

<110> institute of oil crop of academy of agricultural sciences of China

<120> constitutive promoter pBnaC05g31880D of Brassica napus and application thereof

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1525

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tatcagacat ggagaagaac ttaggtgcat tattacttta acattttcta aaacattatc 60

atagtatgtt gctcatcaaa tctaacagtt tctcatctat gctactttta ttttgttttg 120

tttcagacga aactgaagag gattagcttt cttgtctgtt aggaaagatg gagtgaagcc 180

atttctggag tctttagttt gcttaagcta accttattaa tgaataatat tgtgtataca 240

tccttgtttt tatttgtaaa gaagaaaaca atgattaagt ttgtgctaat tcctccactt 300

tacgtaaatt ctgcttttga tatgtaataa gacgagattt agaccgcaca attactaatt 360

gataatttgt tgattctaat taacttctga atggagcaat attgatgagt ttaatcttac 420

aaaaaaggct tttagcagtt tcaacagttt ggttttatcc gcaattgtta aatgaaaaat 480

gcttctgatg caggatgaaa tgagcgtaac ctcagatgga tcgaatacac attcaagtac 540

tttatcagac attgagaaga aattaggtgc attattactc tgcatttttc taaaacattt 600

tcatgtttgt tgctaatcag aatctcactg tttctcatct atgctacttt tactttgttt 660

tgtttcagac gaaactgaag aggattagta ttcttgtttg gtgaaggaaa gatggagtga 720

agctatttct ggtgtcttta gttttgctta agctaatctt attaatgaat atatttgtgt 780

atacaacctt gtttatattc tttaagaaga aaacactgat taagttggtg ctaattcctc 840

cactagacgt aaattctgtt tttgatatgt aataagacga gatttagacc gcacaattac 900

taattgataa tttggtgatt ctaattaact tctgaatgga gcaaattgat gagtatttat 960

agtctaaagt ctaaacagct cactagtttc aatgaattgt ctaattattt atgaaaagta 1020

atactactac ttttagttaa attagatatt tgtgacaagc ctaattatat aactctaaat 1080

gtgagtaata gtattatcaa attcattaac aaaaaaaatc tattaactgc tattttactt 1140

tatatctaac aattaaagaa aagtgaaagt tatatataat tattaattag ttttctcttc 1200

atattaatca ctgattaata tgcattcata gatagttaga tacatcaaag gctggtcaaa 1260

agacatctaa agatgataat aaataaagga aaaaactcag aagctaacaa acaaaaccaa 1320

ttaacatttc aaggcagtta gttaatatat catgcagtgc gcttaggtgt gacaacgtca 1380

tgcgttactt tttgcatcca cacactcaaa actctaatac gcaaattcct tttgttatat 1440

aaacatgcta tatactaatg tattttcctc acaatcatca gattcaataa cattttacac 1500

agagagagca aaacaacagt tcttt 1525

Claims

1. The application of the promoter or the recombinant vector containing the promoter in constitutive drive of target gene expression in plants is characterized in that the nucleotide sequence of the promoter is shown as SEQ ID NO. 1.

2. The use of claim 1, wherein said plant comprises Arabidopsis thaliana and Brassica napus.