CN109439663B - Cabbage type rape promoter pBnUnng0942890 and application thereof - Google Patents
Cabbage type rape promoter pBnUnng0942890 and application thereof Download PDFInfo
- Publication number
- CN109439663B CN109439663B CN201811552149.5A CN201811552149A CN109439663B CN 109439663 B CN109439663 B CN 109439663B CN 201811552149 A CN201811552149 A CN 201811552149A CN 109439663 B CN109439663 B CN 109439663B
- Authority
- CN
- China
- Prior art keywords
- promoter
- expression
- plant
- gene
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
- C12N15/8223—Vegetative tissue-specific promoters
- C12N15/8227—Root-specific
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
- C12N15/823—Reproductive tissue-specific promoters
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
- C12N15/823—Reproductive tissue-specific promoters
- C12N15/8234—Seed-specific, e.g. embryo, endosperm
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Reproductive Health (AREA)
- Pregnancy & Childbirth (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Developmental Biology & Embryology (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a cabbage type rape promoter pBnUnng0942890 and application thereof, wherein the promoter of a gene BnUnng0942890 is cloned from cabbage type rape, a plant expression vector of a reporter gene GUS regulated and controlled by the promoter is constructed, Arabidopsis thaliana is transformed by adopting an agrobacterium-mediated inflorescence dip-staining method, and GUS histochemical method staining is carried out on a screened positive transgenic strain. The promoter has good application potential in the aspects of improving crop quality by rape transgenosis, artificially creating germplasm resources and the like.
Description
Technical Field
The invention belongs to the field of plant genetic engineering and biotechnology, and particularly relates to a promoter of a cabbage type rape BnUnng0942890 gene, which is named as pBnUnng0942890 (the same below), and the promoter can be used for preferentially expressing a target gene in roots, flowers and seeds of plants.
Background
The plant gene promoter plays a key role in the expression regulation of genes, is positioned in the upstream region of the 5' end of a structural gene, contains a DNA sequence of cis-acting elements and determines the specificity, direction and efficiency of the transcription of downstream genes. In addition, the promoter plays a key role in the process of constructing a vector capable of expressing heterologous genes at high levels, and determines the temporal and spatial sequence of expression of the foreign genes, the expression intensity, the transcription efficiency and the expression level of the genes. Therefore, the research on the functions of the promoter has very important scientific significance for gene expression regulation and control mechanisms and plant genetic engineering which matures day by day.
Analysis of promoter regions of various plant genes shows that the promoters of most functional protein genes have a common structural pattern, and generally consist of a promoter core element and an upstream element. The TATA box located AT-20 to-30 bp upstream of the transcription initiation site is a core element of a promoter, is an AT-rich conserved sequence region, is related to the melting of a DNA (deoxyribonucleic acid) double strand, and determines the selection of a transcription initiation point, and is necessary for the correct expression of most plant promoters. The conserved sequence upstream of TATA box is called promoter upstream element, and includes general upstream promoter elements such as CAAT box at-75 bp and GC box near-80 to-110 bp, and other special upstream elements such as Jasmonate Response Element (JRE), Ethylene Response Element (ERE) (Zhang Chun Xiao, Wang wen chess, Jianxiangning, etc.. plant gene promoter research progress [ J ]. Gen Xue, 2004,31(12): 1455. quick 1464; Loujing, Huayan, Haoyaku, etc.. higher plant promoter and its application research progress [ J ]. Natural science progress, 2004,8: 002.). Among them, the CAAT box is a relatively conserved sequence, which is involved in recognition and binding of RNA (ribonucleic acid) polymerase, and has a strong activation effect on gene transcription. If these conserved structural blocks are present, they may have a function of promoting the expression of downstream genes in response.
Promoters can be classified into 3 types according to their transcription patterns: constitutive promoters, tissue or organ specific promoters and inducible promoters.
Exogenous genes driven by constitutive promoters are stably expressed in transgenic plants at all developmental stages and tissues. For transformation of many dicotyledonous plants, plasmid vectors from the 35S promoter of the cauliflower virus (CaMV) or the nopaline synthase nos promoter of bacteria are commonly used, while in transformation of monocotyledonous plants the most common are plasmid vectors containing the rice actin Act promoter, the maize ubiquitin Ubi promoter and the 35S promoter (Guanili, Liuxianglin, Indian duckweed. efficient expression of foreign genes in transgenic plants and evaluation of their safety [ J ]. proceedings of the university of capital university: Nature science edition, 2002,23(2): 52-56).
However, many times, the efficient expression of foreign genes IN recipient Plants not only wastes energy IN the organism, but also the expression IN all tissues may have a toxic effect on the plant itself, even causing Transgenic safety problems (Shirong J. environmental and Food biological Association of Transgenic Plants [ J ]. PROGRESS IN BIOTECHNOLOGY,1997, 6). Therefore, the research and application of inducible promoters and tissue-specific promoters are increasingly receiving attention from breeding workers. Inducible promoters identified in transgenic plants mainly include abiotic stress inducible promoters, biotic stress inducible promoters, hormone inducible promoters, and the like (Ninelina, Charnan, Xumegashi, and the like. cloning of plant gene promoters and progress of functional research thereof [ J ] plant genetic resources, 2008,9(3): 385-391). However, the application of inducible promoters has certain limitations, and the external condition treatment, such as heat shock, hormone treatment and the like, performed on the recipient plants can cause a series of physiological and biochemical reactions in organisms and is not favorable for the normal growth of the plants. Furthermore, methyl dehydrocortisol, estradiol and tetracycline, which are used as inducers in chemical regulatory systems, are all harmful to the ecological environment and are not suitable for production practice.
This problem can be avoided by using the native tissue-specific promoters in plants, and the tissue-specific expression of foreign genes will effectively improve the biosafety of transgenic crops (Song Yang, Zhou Jun, Zhang Yong Qiang.plant tissue-specific promoter research [ J ] Biotech Comm ,2007(6): 21-24). In recent years, research on tissue-specific promoters has been greatly advanced, including organ-specific expression promoters such as leaf, phloem, vascular bundle, root, and the like, and reproductive organ-specific expression promoters such as pollen, stamen, pistil, fruit, seed, and the like (songyang, army society, tensing and tensing. plant tissue-specific promoter research [ J ] biotechnological expert ,2007, (6): 21-24). 3 anther-specific expression promoters were isolated from transgenic Arabidopsis thaliana (Arizumi T, Amagai M, Shibata D, et al. synthetic study of promoter activity of the gene-specific genes encoding promoter, xyloglucan/hydrolase and polylactonase in transgenic Arabidopsis thaliana [ J ] Plant Cell Reports,2002,21(1):90-96) by using GUS staining, as exemplified by Arizumi. Kim et al similarly detected GUS gene expression by transgenic Arabidopsis thaliana, screened to obtain sesame seed-specific expression promoter containing E box and G box elements related to triacylglycerol biosynthesis (Kim M J, Kim H, Shin J S, et al, seed-specific expression of the mutant enzyme and mutant enzyme controlled by binary promoter and protein gene specific promoters in the SeFAD2promoter and promoters in the 5' -UTR interron [ J ]. Molecular Genetics and Genomics,2006, 276: 351-. Gunn et al isolated 4 promoters from cabbage type rape, moss and olive and transformed tobacco, GUS staining analyzed them as flower organ-specific expressed promoters (Geng AQ, ZHao Z J, Nie X L, et al. expression analysis of four flower-specific promoters of Brassica spp. in the heterologous genes host of tobacaco [ J ]. African Journal of Biotechnology,2009,8 (20)). In addition, Mariani et al obtained male sterile tobacco and oilseed rape (Marian C, De Beuckeler M, Truettner J, et al. indication of male sterility in plants by a chimateric border gene [ J ] Nature,1990,347: 737-. At present, the TA29 promoter has been successfully applied to plants such as tobacco, corn, rape, Arabidopsis, rice, etc. (Song dynasty, Zhongjun, Zyongqiang. plant tissue-specific promoter research [ J ] biotechnological Comm ,2007(6): 21-24). It follows that even though the in vivo environment varies between different plant species and there are differences in the interaction between genes, the promoter can exert a biological function of promoting the expression of a downstream gene in other different plants as long as it has a conserved core promoter region and corresponding conserved regulatory elements.
These reports are examples of promoter function analysis among different plants using transgenic technology, and these examples show that the function of promoters from other plants is widely recognized and accepted through expression analysis of transgenic plants using model plants such as Arabidopsis thaliana, tobacco, etc. as vectors.
The seeds play a crucial role in agricultural production and national economy. Statistical data show that 80% of human grains are directly taken from seeds of plants, and seeds of rice, wheat and the like are rich in starch and are staple food for human survival; the oil content of the seeds of soybean, peanut, rape, sesame and the like is high, and the seeds are the main source of edible oil. The amount and composition of the stored material in the seeds directly affects the yield and quality of the crop. Therefore, the fundamental idea behind increasing the yield of food and oil crops and improving the quality of crops is to increase and improve the accumulation and composition of the storage material in their seeds. Although the excellent crop variety cultivated by the conventional breeding technology makes great contribution to solving the world food safety problem and improving the life of people. However, conventional breeding techniques have limited potential in continuing to improve crop yield and quality. Therefore, the method has great application value in digging new functional genes and improving crop yield and other related qualities of seeds by using a transgenic technology.
The root system is not only an important organ for nutrition absorption, transportation, storage and synthesis of plants, but also an indispensable component for pest resistance and survival under special ecological environment. The research of the specific expression of plant genes in roots is an effective way for explaining the generation, differentiation and development mechanism of plant roots, and has important significance in the research of plant nutrition utilization and plant disease and insect pest genetic engineering.
Rape is an important edible oil source, and the related characters of rape seeds relate to the quality of edible rape seed oil, and are more related to the yield and the oil content in agricultural characters. Meanwhile, in recent years, the pollution of agricultural land resources in China is serious, diseases and insect pests occur frequently, and the defense capability of roots is a necessary condition for ensuring the normal growth of overground parts. These are very popular problems for researchers, and it is necessary to select promoters for specific expression or preferential expression of roots and seeds. According to experimental analysis, the promoter pBnNNg 0942890 shows strong advantageous expression characteristics of roots, flowers and seeds, in pBnUnng0942890 transgenic arabidopsis thaliana, the reporter gene GUS driven by the promoter shows strong expression levels in roots, flowers and seeds of transgenic arabidopsis thaliana, and the data fully indicate that the promoter pBnUnng0942890 is a strong specific expression promoter for roots, flowers and seeds, and has good application prospects in plant transgenic breeding.
Disclosure of Invention
One of the purposes of the present invention is to provide a brassica napus promoter pBnUnng0942890, which has the advantages of two aspects: firstly, the specific tissue dominant expression promoter derived from rape endogenous can accurately position the regulated and controlled gene, drive the expression of the target gene in the specific tissue or period of the transgenic plant, and avoid the waste of the energy and substances of the plant; secondly, the expression efficiency of the exogenous gene in the transgenic plant is improved, and the expression part is limited. Therefore, the promoter can be applied to genetic engineering research and germplasm resource improvement research of plants.
The other purpose of the invention is to provide an amplification primer of the promoter of the Brassica napus pBnUnng 0942890. The cabbage type rape promoter pBnUnng0942890 sequence is obtained by taking cabbage type rape genome DNA as a template and adopting the specific primer for PCR amplification, and the method is simple to operate, specific in product and stable and reliable in result.
The invention also aims to provide a recombinant vector containing a plant high-efficiency expression promoter pBnUnng 0942890. The recombinant vector can be specifically inserted into a promoter pBnUnng0942890 in a plant expression vector DX2181G, is suitable in size, is easy to transform in plants, and is high in expression intensity of a carried marker gene GUS and easy to detect.
The fourth purpose of the invention is to provide the application of the Brassica napus promoter pBnUnng0942890 in the preferential expression of target genes in plant roots, flowers and seeds. Under the drive of the promoter, the target gene is predominantly expressed in roots, flowers and seeds of plants, and is not expressed or is low expressed in other parts. The promoter with tissue specificity dominant expression has good application value in gene engineering and transgenic safety such as establishment of excellent germplasm resources and the like.
In order to achieve the purpose, the invention adopts the following technical scheme:
cloning of the promoter pBnUnng 0942890: PCR amplification is carried out by taking genome DNA of the cabbage type rape as a template, a forward primer pBnUnng0942890-F is 5'-GAGATCTACAGCGCTAAGCTTggaag gacaaaaccaaagctct-3', a reverse primer pBnUnng0942890-R is 5'-GGACTGACCACCCGG GGATCCcttccttaactttctacacata-3' (in the primer pBnUnng0942890-F, a sequence GAGATCTA CAGCGCT is an upstream sequence of a fusion site of a vector DX2181, a sequence AAGCTT is an enzyme digestion site of Hind III, in the primer pBnUnng0942890-R, a sequence GGACTGACCACCCGG is a downstream sequence of the fusion site of the vector DX2181, and a sequence GGATCC is an enzyme digestion site of BamH I), and the sequence of the cabbage type rape pBnUnng0942890 is obtained and is shown as SEQ ID NO: 1.
The construction method of the recombinant vector DX2181G-pBnUnng0942890 comprises the following steps:
double enzyme digestion of plant expression vector DX2181G with Hind III and BamH I, detection and recovery by 1% agarose gel electrophoresis; the promoter pBnUnng0942890 and the recovered enzyme cutting plasmid were cloned in one step (kit)
Entry One Step Cloning Kit), transforming E.coli competent DH5 alpha after 30min water bath at 37 ℃; the single clone that grew out was purified with the vector upstream primer DX 2181G-F: TACGTCGCCGTCCAGCTCGA and a target sequence specific primer pBnUnng 0942890-R: GGACTGACCACCCGGGGATCCcttccttaactttctacacata and carrying out positive clone detection, and extracting expression vector plasmid of the positive clone, wherein the plasmid is the recombinant vector DX2181G-pBnUnng 0942890.
Functional analysis of the promoter pBnUnng0942890 and its use for preferential expression in roots, flowers and seeds:
the promoter cis-acting element is subjected to online prediction analysis by promoter functional element prediction software plantarCARE, and the result shows that the cloned promoter sequence contains TATA box core promoter sequence, upstream promoter elements such as CAAT box and the like and endosperm specific expression elements; on the basis, a plant expression vector DX2181G-pBnUnng0942890 of a reporter gene GUS regulated and controlled by the promoter is constructed; transforming arabidopsis thaliana by adopting an agrobacterium-mediated inflorescence dip-dyeing method, and obtaining a transgenic positive plant by double screening of hygromycin and PCR; GUS histochemical staining is carried out on positive transgenic lines, and the result shows that the GUS gene driven by the promoter is dominantly expressed in roots, flowers and seeds of arabidopsis thaliana. Therefore, the GUS gene driven by the promoter has certain space-time expression specificity, and has the functions of driving the preferential expression of downstream genes in roots, flowers and seeds, and no expression or low expression of other organs and the like; the promoter with tissue specific expression has good application value in the aspects of artificially creating excellent germplasm resources, plant genetic engineering and the like; if the promoter is used for driving grease synthesis related genes and root system lodging-resistant stress-resistant related genes, an overexpression vector of a pBnUnng0942890 driving target genes is firstly constructed, and a receptor plant is transformed, so that the expression quantity of the target genes in the tissue parts can be improved under the driving of the pBnUnng0942890 promoter, and the purpose of improving the related quality of seeds or root systems is achieved.
Compared with the prior art, the invention has the following advantages and beneficial effects:
1. the promoter can specifically drive the preferential expression of downstream target genes in plant roots, flowers and seeds, but not express or express in other tissues and organs at a low level, and has space-time expression specificity.
2. Seeds and roots are important organs of plants, and breeding experts can use the specific superiority to express target genes to change the properties of the plants, such as oil content, yield, abiotic and biotic stress resistance and the like, so that the plant breeding method has good application potential for modern agriculture. The pBnUnng0942890 promoter has good application potential in the aspects of improving crop quality by utilizing transgenes in rape, artificially creating excellent germplasm resources and the like.
Drawings
FIG. 1 is the electrophoresis picture of the promoter fragment of the cabbage type rape BnUnng0942890 gene
FIG. 2 is a diagram showing the results of sequence analysis of pBnUnng0942890 promoter
TATA-box: a promoter core element; CAAT-box: cis-acting elements of promoters and enhancers; G-Box: a light signal-regulated cis-acting element; GT 1-motif: an optical signal responsive element; MRE: a MYB binding site to which an optical signal is responsive; p-box: a gibberellin-responsive element; ABRE: abscisic acid-responsive cis-acting elements; ARE: anaerobic induction is a necessary cis-form regulatory element; TC-rich repeats: stress response cis-acting elements; TCCC-motif: an optical signal responsive element; TGACG-motif: jasmonic acid signal response cis regulatory elements.
FIG. 3 is a map of plant expression vector DX 2181G.
FIG. 4 is a T-DNA region map of construction vector DX2181G-pBnUnng 0942890.
FIG. 5 is the PCR identification result chart of transgenic plant
FIG. 6 is a diagram showing the histochemical staining result of transgenic Arabidopsis GUS
A: 5 days for seedling; b: 15 days for seedling; c: seedlings are grown for 25 days; d: flower; e: ovules (young seeds); f: seed coat; g: and (3) an embryo.
Detailed Description
The methods used in the following examples are conventional methods unless otherwise specified, the primers used are synthesized by Wuhan Optimalaceae Biotech, Inc., and the sequencing is performed by Wuhan Optimalaceae Biotech, Inc.,
the Entry One Step Cloning Kit is purchased from Nanjing Novozam Biotechnology Co., Ltd, the rapid endonuclease is purchased from Thermo Fisher Scientific, the DNA gel recovery Kit, the DNA Marker and the like are purchased from Dalibao biological, the cabbage type rape varieties used in the experiment are Darmor, Columbia wild type Arabidopsis Thaliana Thaliana, Escherichia coli susceptible strain DH5 alpha, Agrobacterium susceptible strain GV3101, the modified plant genetic expression vector DX2181G and the like, and are stored in the laboratory.
Example 1: primer sequence design of rape promoter pBnUnng0942890
Designing a pair of primers according to 1525bp of a gene interval sequence at the upstream of a BnUnng0942890 gene obtained by sequencing a whole genome of rape for PCR amplification to obtain a 5' upstream promoter sequence of the BnUnng0942890 gene, wherein the primers are pBnUnng 0942890-F: 5'-GAGATCTACAGCGCTAAG CTTggaaggacaaaaccaaagctct-3' and pBnUnng 0942890-R: 5'-GGACTGACCACCCGG GGATCCcttccttaactttctacacata-3' are provided. In the primer pBnUnng0942890-F, the sequence GAGATCTA CAGCGCT is an upstream sequence of a fusion site of the vector DX2181G, and the sequence AAGCTT is a restriction enzyme cutting site of Hind III; in the primer pBnUnng0942890-R, the sequence GGACTGACCACCCGG is the downstream sequence of the fusion site of the vector DX2181G, and the sequence GGATCC is the enzyme cutting site of BamH I.
Example 2: preparation of rape promoter pBnUnng0942890
The rape used in the invention is cabbage type rape (Brassica napus L.) Darmor, and the rape is sowed in a field and normally managed in the field. Extracting genome DNA of rape leaves by using a CTAB method, and carrying out Polymerase Chain Reaction (PCR) by using the extracted whole genome DNA of the rape as a template. The PCR system is as follows: 2 XMix buffer 25. mu.L, pBnUnng 0942890-F: 1 μ L, pBnUnng 0942890-R: 1 μ L, DNA 1 μ L, ddH2O22. mu.L. The PCR procedure was: 5min at 94 ℃; 30s at 94 ℃,30 s at 56 ℃, 1min at 72 ℃ and 35 cycles; 10min at 72 ℃; infinity at 4 ℃. The size of the PCR product is 1525bp (see figure 1), and the PCR product is identified by 1.0% agarose gel electrophoresis and purified, recovered and tested for concentration according to the kit instructions.
The DX2181G vector plasmid was digested with Hind III and BamH I and recovered by 1% agarose gel electrophoresis. The recovered PCR product and the digested plasmid were cloned in one step (kit)
Entry One Step Cloning Kit) instructions (5 × CE II Buffer 4. mu.L, linearized Cloning vector 50-200 ng, insert amplification product 20-200 ng,
II 2μL，ddH2o is supplemented to 20. mu.L), water bath at 37 ℃ for 30min, and then transformed into Escherichia coli competent DH 5. alpha. The single clone that grew out was purified with the vector upstream primer DX 2181G-F: TACGTCGCCGTCCAGCTCGA and a target sequence specific primer pBnUnng 0942890-R: GGACTGACCACCCGGGGATCCcttccttaactttctacacata, carrying out positive clone detection, sending the positive single clone to Wuhan engine department biotechnology limited company for sequencing through PCR detection, and the analysis result shows that the rape BnUnng0942890 gene full-length promoter is obtained, the sequence of the promoter is the nucleotide sequence shown in SEQ ID NO.1 and is named as pBnUnng 0942890.
Example 3: sequence analysis and function prediction of rape promoter pBnUnng0942890
The sequence pBnUnng0942890 cloned and sequenced was analyzed for functional element prediction on-line using promoter core element prediction software PLATCARE (Lescot M, D é hais P, Thijs G, et al, PLANTCARE, a database of plant circuits and a port to tools for in silico analysis of promoter sequences [ J ]. Nucleic acids research,2002,30(1):325-327.http:// bio information. psb.g. be/b tools/PLANTCARE/html). The results showed that pBnUnng0942890 contained the core elements TATA box and CAAT box essential for eukaryotic promoters as shown in table 1 and fig. 2. Further analysis of the promoter sequence revealed that, in addition to the essential core elements, various promoter functional elements are present in the sequence pBnUnng 0942890: G-Box: cis-acting regulatory element involved in light responsiveness light signal regulation cis-acting element; GT 1-motif: a light responsive element optical signal responsive element; MRE: a MYB binding site involved in light signaling response by MYB binding site; p-box: gibberellin-responsive element gibberellin response element; ABRE: cis-acting element encapsulated in the abscisic acid responsive cis-acting element; ARE: cis-acting regulatory element essential for the anaerobic induction; TC-rich repeats: cis-acting element involved in stress response cis-acting element and stress response cis-acting element; TCCC-motif: part of a light responsive element optical signal responsive element; TGACG-motif: cis-acting regulatory element involved in the MeJA-responsive jasmonic acid signal response cis-regulatory element. The applicant predicts that pBnUnng0942890 may be a promoter involved in hormone regulation and stress response, and is a promoter worthy of intensive research and excavation.
Example 4: construction of plant expression vector DX2181G-pBnUnng0942890 and transformation of Agrobacterium tumefaciens strain GV3101
The construction method of recombinant vector DX2181G-pBnUnng0942890 adopts one-step seamless cloning method of target fragment and enzyme-digested vector (
II One Step Cloning Kit): a simple, fast and efficient DNA directional cloning technology can directionally clone the PCR product of the insert to any site of any vector. The vector is digested and linearized, and the terminal sequences of the linearized vector are introduced into the 5' end of the insert PCR primer, so that the 5' and 3' extreme ends of the PCR product respectively have sequences (15 bp-20 bp) consistent with the two terminals of the linearized vector. After the PCR product with the carrier terminal sequences at the two ends and the linearized carrier are mixed according to a certain proportion, the conversion can be carried out only by reacting for 30min under the catalysis of the Exnase, and the directional cloning is completed. The constructed recombinant vector is obtained by recombining and replacing the polyclonal enzyme cutting site at the upstream of GUS gene on the plasmid DX2181G by the pBnUnng0942890 fragment obtained by cloning. The method comprises the following steps:
1) double enzyme digestion of plant expression vector DX2181G with Hind III and BamH I, detection and recovery by 1% agarose gel electrophoresis;
2) the recovered PCR product pBnUnng0942890 and the above recovered digested plasmid were cloned in one step (kit)
Entry One Step Cloning Kit) instructions (5 × CE II Buffer4 μ L, 50-200 ng of linearized Cloning vector, 20-200 ng of insert amplification product,
II2μL，ddH2o until the final volume is 20 mu L), water bath is carried out at 37 ℃ for 30min, and then escherichia coli competent DH5 alpha is transformed;
3) the single clone that grew out was purified with the vector upstream primer DX 2181G-F: TACGTCGCCGTCCAGCTCGA and a target sequence specific primer pBnUnng 0942890-R: GGACTGACCACCCGGGGATCCcttccttaactttctacacata, carrying out positive clone detection, sending the positive single clone to Wuhan engine department biotechnology limited company for sequencing through PCR detection, and the analysis result shows that the rape BnUnng0942890 gene full-length promoter is obtained and is the nucleotide sequence shown in SEQ ID NO.1, and the extracted recombinant plasmid is named as DX2181G-pBnUnng 0942890.
The method for transforming the agrobacterium-infected cells GV3101 by using a freeze-thaw method comprises the following steps:
1) thawing Agrobacterium-infected competent cell GV3101 stored at-80 deg.C on ice;
2) taking 3 μ L (100ng) of expression vector plasmid DX2181G-pBnUnng0942890 with pipette tip, immersing the pipette tip into competent cells, standing on ice for 30min, rapidly freezing in liquid nitrogen for 1min, and water-bathing in 37 deg.C constant temperature water bath for 5 min;
3) 600 μ L of LB liquid medium (tryptone 10 g; 5g of yeast extract; NaCl 10g), at 28 ℃ and 200rpm, and carrying out shake culture for 4 h;
4) spread on solid LB medium supplemented with 50. mu.g/mL kanamycin, 50. mu.g/mL gentamicin and 50. mu.g/mL rifampicin (tryptone 10 g; 5g of yeast extract; 10g of NaCl; agar 1.5%), and performing inverted culture at 28 ℃ for 36-48 h;
5) the single clone grows up to the upstream primer DX2181G-F of the plant expression vector: TACGTCGCCGTCCAGCTCGA and a target sequence specific primer pBnUnng 0942890-R: GGACTGACCACCCGGGGATCCcttccttaactttctacacata and performing positive clone detection, shaking the monoclone bacteria which are detected to be positive by PCR until OD600 is 1.8-2.0 (detected by an ultraviolet spectrophotometer), and preserving the bacteria at the ultralow temperature of-80 ℃ by using equal volume of 50% glycerol for subsequent research.
Example 5: genetic transformation of plant expression vector DX2181G-pBnUnng0942890 in Arabidopsis thaliana and transgenic plant screening
1. Floral dip transformation of arabidopsis thaliana:
1) after the arabidopsis is bolting, cutting off the top end of the main flower wadding, and preparing a material for transformation when the lateral branches grow consistently and are in a bud period;
2) inoculating Agrobacterium DX2181G-pBnUnng0942890 carrying the gene of interest with 200mL of LB liquid medium containing 50. mu.g/mL kanamycin, 50. mu.g/mL gentamicin and 100. mu.g/mL rifampicin, culturing at 28 ℃ and 200rpm for 12-18 h;
3) the bacterial liquid is filled in a centrifugal bottle, centrifuged at 5000rpm for 15min, and the supernatant is sucked away by a pipette and discarded;
4) resuspend Agrobacterium with 100mL resuspension (5% sucrose, 0.02% surfactant); soaking arabidopsis thaliana flower floc in the bacterial liquid for 30s, and gently stirring;
5) after the dip dyeing is finished, covering the cotton cloth with a plastic film overnight, improving the conversion efficiency, and converting once again after 5-7 days;
6) after approximately one month, the seeds were ripe, harvested, placed in an oven at 37 ℃ for 7 days, threshed and vernalized at 4 ℃ for 3 days, labeled as T0 seed generation.
2. Screening positive transgenic plants:
1) taking a proper amount (not exceeding 1/5 of an EP tube) of threshed clean Arabidopsis seeds and putting the seeds in a 1.5mL EP tube;
2) adding 1mL of 75% alcohol, washing for 1min by shaking, centrifuging at 8000rpm for 30s, sucking the supernatant with a pipette and discarding;
3) adding 1mL of 10% sodium hypochlorite, washing for 5min by shaking, centrifuging at 8000rpm for 30s, sucking away the supernatant with a pipette and discarding;
4) add 1mL dd H2O, washing for 1min by shaking, centrifuging at 8000rpm for 30s, sucking the supernatant with a pipette and discarding;
5) repeat step 4 three times, add 1mL ddH2O, vernalization is carried out for 3d at 4 ℃ under the dark condition;
6) plated on 1/2MS medium (MS powder 2.15 g; 10g of cane sugar; 0.8 percent of agar; pH5.8), containing 25mg/L hygromycin, culturing in a dark incubator for about 5 days, and converting to normal illumination culture;
7) when two true leaves are grown in equal length, the hypocotyl is elongated, and the normal true leaf growth is transplanted into a greenhouse culture pot (nutrient soil: vermiculite: perlite: 3:1: 1);
8) and (3) taking leaves before bolting of the plant which grows normally, extracting genome DNA, and performing amplification by using a plant expression vector upstream primer DX 2181G-F: TACGTCGCCGTCCAGCTCGA and a target sequence specific primer pBnUnng 0942890-R: GGACTGACCACCCGGGGATCCcttccttaactttctacacata screening positive transgenic plants, detecting the transgenic material positive by PCR as T1 generation (see figure 5), harvesting the individual plants, and sequentially numbering and storing. The T1 generation transgenic material is identified as T2 generation by hygromycin resistant screening and PCR, and the individual plants are harvested, numbered and stored in turn. And then screening the T2 generation again to obtain a homozygous transgenic line.
Example 6: functional analysis of the Brassica napus pBnUnng0942890 promoter
GUS expression in plant tissue cells was detected by histochemical staining. Different parts of the T2 generation transgenic arabidopsis prepared in example 5 are taken, and the specific steps are as follows: a: 5 days for seedling; b: 15 days for seedling; c: seedlings are grown for 25 days; d: flower; e: ovules (young seeds); f: seed coat; g: and (3) an embryo. After sampling, appropriate amount of GUS staining solution (50mmol/L PBS, pH 7.0; 0.5mol/L X-Gluc; 50mmol/L of potassiumtricyanide; 10mmol/L EDTA, 0.001% Triton X-100 and 20% methanol) was added to the small centrifuge tube or culture dish. Keeping the temperature at 37 ℃ for reaction for more than 1h or overnight; then, the mixture was decolorized in 70% ethanol and photographed by observation using a stereoscope (Olympus SZX 7). The blue-stained part of the plant is the GUS gene expression part, and the spatiotemporal expression mode of pBnUnng0942890 is explored by detecting the expression part and the expression intensity of the GUS gene under different spatiotemporal conditions.
The results show (FIG. 6) that GUS gene driven by the promoter is highly expressed in roots, flowers and seeds of Arabidopsis thaliana, and is not expressed or is low expressed in other tissues and organs. Therefore, the promoter locally drives the downstream gene to be preferentially and efficiently expressed in roots, flowers and seeds of the plants, and does not express or expresses in low positions. The promoter with tissue-specific dominant expression has good application value in plant genetic engineering. Such as: by constructing a vector containing the promoter for driving to improve the oil content of seeds and improve the stress resistance genes of root systems, the receptor plant Arabidopsis or rape can be transformed, and a high-quality high-yield high-oil material can be artificially created and applied to agricultural production.
Sequence listing
<110> institute of oil crop of academy of agricultural sciences of China
<120> cabbage type rape promoter pBnUnng0942890 and application thereof
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1525
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
ggaaggacaa aaccaaagct ctaatctact accttagctt tcatacttgg caagcagtct 60
cgtagaagaa tacttcctca agcttttgag tttggagagt tgaagcaaag attatttggg 120
tgaaccaaag ctgtagaaaa aatagagaag caaagagagt cacgatcaaa aacctaacat 180
agttttcaag ctcacaaaca ttagttgacc atagagtaga acatgaaaag aacaaataaa 240
ctttactaga cttgcttata ctcttcagga ttaaaaggtt tgttgtcaaa atattctctg 300
tcttttgtgt ataacatggg attttaaaaa cagaaccaaa acagagaaga ttttgacaac 360
agaccttttg acagaacacc aaaggaacaa atcaatcgac gtgtgcctta gctcaacctc 420
agattcttca gagcacaaaa cctttttctc ggatccaacg aaaagctcga gacgaaatca 480
aatctaacaa tcaaagggct cccttcaggt ttgagagact ccaaaatcga atctttggct 540
tccaaaattg tcgacttggg tattgattca tgaacaagag ggaatcgaaa gttcagtact 600
tttctggaaa gcttcgtctc tgatctctcg cttccttgtt ctctctctgt tctcataggt 660
gtggtcaatt ttttatttga ttttgggtat ttccaaataa caggtacaat ggtgggattt 720
gtgtaacgat agttttgact gaaaataaca aaaaaaatag tttcaaatcc atttcataaa 780
gtttttcttt taaaattgtt tatcattgaa taacagtaga tttgatttac ttttggtaaa 840
ttgttaatta aataacagtg gattacaagt gattttaagc tactttagat aaatgtcata 900
ttcaatgaag aaaaaaaaat aaatcattag ttgaataaca gaaaatttta aaaaaatacc 960
aaaacactat aaaatcctct attcaataca cccccttaat cactaaatag aagtatcagg 1020
gaaagaaaga agcagatttg gtaaaagggt agaatcgaca atggaagcaa aaactgggtt 1080
aataaagtga cggagagatt ctctcactct tctgatctct caactctccc aagctaagac 1140
tctctctctc tctctctctc tctctctctc tctctctctc tctctatccg tttgatcatc 1200
atcctcgtcg ctcgtcggct tgttcggaaa atctccgatc cgttcgagtc tcgctctctg 1260
actgttcccg ccatctgcga tcatctgatc cgtcgatctc cctcgcgaaa ttgtaggtga 1320
ctcagaaaaa cgcactcttc ctagctactg atcaccattt tcgctatata cgtgtgaaaa 1380
tctgatgaat aaacgataat caaagcgacg aacacaccga tcgttgattg ttttgacctt 1440
tgtggtagaa tctttcattt tcagttgtag attgatgcta aacagtcacg tttgtgtgat 1500
tggtatgtgt agaaagttaa ggaag 1525
Claims (5)
1. The Brassica napus promoter is characterized in that the promoter is a nucleotide sequence shown as SEQ ID NO. 1.
2. A recombinant vector comprising the promoter of claim 1.
3. The amplification primer for the promoter according to claim 1, wherein: the forward primer was 5'-GAGATCTACAGCGCTAAGCTTGGAAGGACAAAACCAAAGCTCT-3' and the reverse primer was 5'-GGACTGACCACCCGGGGATCCCTTCCTTAACTTTCTACACATA-3'.
4. Use of the promoter of claim 1 or the recombinant vector of claim 2 for preferential expression of a gene of interest in roots, flowers and seeds of plants.
5. The use of claim 4, wherein said plant comprises Arabidopsis and Brassica napus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811552149.5A CN109439663B (en) | 2018-12-18 | 2018-12-18 | Cabbage type rape promoter pBnUnng0942890 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811552149.5A CN109439663B (en) | 2018-12-18 | 2018-12-18 | Cabbage type rape promoter pBnUnng0942890 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109439663A CN109439663A (en) | 2019-03-08 |
| CN109439663B true CN109439663B (en) | 2021-07-30 |
Family
ID=65559936
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811552149.5A Active CN109439663B (en) | 2018-12-18 | 2018-12-18 | Cabbage type rape promoter pBnUnng0942890 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109439663B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111893118B (en) * | 2020-07-31 | 2022-10-21 | 四川大学 | Bidirectional promoter from brassica napus and application thereof |
| CN112011541B (en) * | 2020-09-11 | 2021-09-28 | 西南大学 | Brassica napus Bna.A08IDD7 gene promoter and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107099532A (en) * | 2017-06-05 | 2017-08-29 | 中国农业科学院油料作物研究所 | Cabbage type rape embryo's specificity promoter pBnaA09g21960D and its application |
-
2018
- 2018-12-18 CN CN201811552149.5A patent/CN109439663B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107099532A (en) * | 2017-06-05 | 2017-08-29 | 中国农业科学院油料作物研究所 | Cabbage type rape embryo's specificity promoter pBnaA09g21960D and its application |
Non-Patent Citations (2)
| Title |
|---|
| Piriformospora indica promotes growth, seed yield and quality of Brassica napus L.;Zhen-zhu Su等;《MICROBIOLOGICAL RESEARCH》;20170227;第199卷;第29-39页 * |
| 甘蓝型油菜胚胎特异启动子pBnaA09921960D的分析;范世航 等;《中国油料作物学报》;20171231;第39卷(第6期);第721-728页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109439663A (en) | 2019-03-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112779234B (en) | Phyllostachys pubescens PeAPX5 gene and application thereof | |
| CN109439663B (en) | Cabbage type rape promoter pBnUnng0942890 and application thereof | |
| CN107012147B (en) | Drought and/or high-salt induction promoter SlWRKY8P from tomato and application thereof | |
| CN114214358A (en) | Inducible expression vector and application thereof in cultivation of sentinel crops | |
| CN107099532B (en) | cabbage type rape embryo specific promoter pBnaA09g21960D and application thereof | |
| CN106967720B (en) | Cloning and application of stress-induced promoter SlWRKY31P | |
| CN109536501B (en) | Constitutive promoter pBnaC05g31880D of brassica napus and application thereof | |
| CN114703199B (en) | Plant drought resistance related gene TaCML46 and application thereof | |
| CN107973844B (en) | Wheat heading period related protein Ta-Hd4A and application thereof | |
| Kumar et al. | Genetic transformation of Jatropha curcas: Current status and future prospects | |
| CN102226181B (en) | Method for preparing promoter of Brassica napus BnPABP2 and application thereof | |
| CN115807006A (en) | Application of gene fragment B in cultivation of new plant material | |
| CN103320450A (en) | Blade ageing and stress resistance related gene and application thereof | |
| CN107488664B (en) | Cabbage type rape root-specific promoter pBn21194 and its application | |
| CN112011541A (en) | Brassica napus Bna.A08IDD7 gene promoter and application thereof | |
| CN113061172B (en) | Plant salt tolerance related LIP1 protein and related biological material and application thereof | |
| CN117327702A (en) | Salt-inducible promoter proBnaC09G0087500ZS and application thereof | |
| CN110229824B (en) | Salt mustard TsHKT1; cloning and application of 3 promoter | |
| CN112321693B (en) | Application of wheat TaCCT1-6A protein in regulation and control of crop heading period | |
| CN112662670B (en) | Peanut fatty acyl-acyl carrier protein thioesterase AhFATB2 gene promoter, and preparation method and application thereof | |
| CN111718938B (en) | High-temperature inducible promoter specifically expressed by plant green tissue and application thereof | |
| KR101494191B1 (en) | Promoter for directing the guard-cell specific expression | |
| CN110656110B (en) | Cotton fiber specific expression promoter 8DP2 and application thereof | |
| KR101437606B1 (en) | Promoter from brassica and plant transformed with the same | |
| CN105254728B (en) | Improve GAP-associated protein GAP TaMOR-D and its encoding gene and the application of root system of plant and yield |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |