CN116103290A - Tomato root specific expression promoter pSlROOT2 and application thereof - Google Patents

Abstract

The invention discloses a tomato root specific expression promoter pSlROOT2 and application thereof. The promoter pSlROOT2 is one of the following nucleotide sequences: 1) A nucleotide sequence shown as SEQ ID NO.1 in the sequence table; 2) A nucleotide sequence which has more than 90 percent of homology with the nucleotide sequence shown as SEQ ID NO.1 in the sequence table and has the function of regulating and controlling the specific expression of a target gene in plant roots; 3) A nucleotide sequence which can be hybridized with the nucleotide sequence shown as SEQ ID NO.1 in the sequence table under high stringent conditions. The promoter can drive the specific expression of target genes in plant roots, and lays a theoretical foundation for improving the expression and accumulation level of exogenous genes in specific tissues of crops by a genetic engineering means and obtaining new varieties of disease-resistant or stress-resistant crops by applying a transgenic method.

Description

Tomato root specific expression promoter pSlROOT2 and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a tomato root specific expression promoter pSlROOT2 and application thereof.

Background

Plant gene expression is regulated at the transcriptional, posttranscriptional and translational levels. Wherein the transcription level is regulated by a promoter, and the promoter determines the expression position, expression mode, expression period, expression level and the like of the gene to a great extent. Promoters include three types, constitutive, tissue-specific and inducible. In recent years, strong constitutive promoters, such as tobacco mosaic virus, have been shown to be more efficient in dicotyledonous plants35S（ CaMV 35S) Promoters and maize commonly used in monocotsUbiquitin And riceActinPromoters are widely used in the field of plant genetic engineering (Battraw and Hall 1990; mcelroy et al 1990; christensen et al 1992). However, constitutive promoter expression is not generally affected by external environment, the promoter gene is continuously and stably expressed in all organs or tissues with high efficiency, the expression of a specific gene in a specific tissue cannot be satisfied, and the continuous high-level expression of some target genes in all tissues is likely to cause damage to host plants (anamine et al 2013). Along with the rapid development of science and technology, exogenous genes are expressed in organisms in specific periods, specific tissues and specific contents, so that the exogenous genes can be more economically and effectively exerted, and the exogenous genes become hot spots for genetic engineering research.

The tissue specific promoter drives the expression of exogenous gene only in the specific tissue of the acceptor plant and overcomes the shortcomings of constitutive promoter. In addition, expression of genes in different developmental stages and tissues is also a requirement for the growth of plants themselves. Specific expression of a gene depends on cis-acting elements present in the promoter, and tissue-specific promoters have elements necessary for controlling tissue-specific expression in addition to TATA box, CAAT box and GC box contained in general promoters, the kind, number and relative positions of these elements determining their expression specificity. Tissue-specific promoters are distributed throughout various tissues of plants, including promoters for vegetative organ-specific expression (green tissue, root) and reproductive organ-specific expression (pistil, pollen, flower, seed, embryo and endosperm, fruit). In the breeding research of transgenic crops, the utilization of efficient and tissue-specific expression promoters is the first choice for cultivating efficient and safe transgenic crops.

The root of the plant is the root for fixing the plant, is the only way for the plant to absorb moisture, inorganic salt and the like, is also an important organ for synthesizing and storing nutrient substances, and has important function for protecting the overground part of the plant under drought, saline-alkali and heavy metal soil conditions, so the root has important function in the whole life process of the plant. The root is an important nutrition organ, and the knowledge of the root-specific expression genes, especially the promoters thereof, are of great value for crop improvement. The root-specific expression system is mainly applied to researching transgenic plants, and has outstanding application values (Xu et al 2010) in the aspects of plant disease and insect resistance, improving the invasion capability of plants to soil pathogenic bacteria (Huang et al 2006), salt and alkali resistance, improving the adaptation capability of plants to severe environments (Gao et al 2011), changing plant metabolic pathways, improving and improving plant yield, nutritional ingredients and the like. Has been reported to utilizeAtWRKY6Root specific expression promoter drives cytokinin oxidase 3CKX3) The plant is specifically expressed in tobacco and Arabidopsis roots, the biomass of the root system is increased by 60%, and the drought resistance and heavy metal stress resistance of the plant are improved (Werner et al 2010). By using chickpeasWRKY31Root-specific expressed gene promoter-driven chickpeaCKX6The gene is specifically expressed in chickpeas, the chickpeas root system is more developed, drought tolerance is enhanced, and the mineral content in seeds is increased (Khandal et al 2020). Zhang et al (2016) utilize tobacco root-specific genesNtREL1The promoter drives the soybean resveratrol synthase geneAhRS) Is specifically expressed in tobacco roots. Therefore, the root-specific promoter can improve plant stress resistance, increase yield and improve quality, and has good development prospect. The above report uses transgenesThe technology performs promoter function analysis among different plants, which shows that the functions of promoters from other plants are widely accepted and accepted by using model plants such as arabidopsis thaliana, tobacco and the like as vectors and by heterologous transgene analysis.

In recent years, the multiple gene transformation system, which constructs several genes simultaneously onto one expression vector, gradually replaced the traditional repeated transformation and hybridization approach to improve nutritional quality (Lin et al 2003; wakasa et al 2006). In such a multiple gene expression system, a specific promoter is required for each gene to drive expression, so as to avoid the phenomenon of transgene silencing due to excessive homology of the transferred sequence (Naqvi et al 2010). The promoters isolated in tomato so far are mostly specifically expressed in leaves and seeds, guan Fanjia root-specific expression promoters have been less studied, and most of the promoters are cloned from known root-specific expression genes, so that the isolation and identification of excellent root-specific promoters have an important role. The inventor previously clonesSlTIP、SlMT3Two root-specific promoters, but fewer alternative tomato root-specific promoters may be used, particularly those that are highly expressed and have smaller fragments. Therefore, the research on the influence of the tomato root specific promoter on the expression efficiency of the exogenous gene has important theoretical significance and application value on the directional expression of the exogenous gene in tomatoes.

Disclosure of Invention

The invention aims to provide a tomato root specific promoter pSlROOT2 and application thereof, wherein the promoter can drive target genes to specifically express in plant roots, and lays a theoretical foundation for improving the expression and accumulation level of exogenous genes in specific tissues of crops by a genetic engineering means and obtaining new varieties of disease-resistant or stress-resistant crops by applying a transgenic method.

In order to achieve the above purpose, the present invention adopts the following technical scheme:

a tomato root specific promoter, pSlROOT2, which is a nucleotide sequence having any one of:

1) A nucleotide sequence shown as SEQ ID NO.1 in the sequence table;

2) A nucleotide sequence which has more than 90 percent of homology with the nucleotide sequence shown as SEQ ID NO.1 in the sequence table and has the function of regulating and controlling the specific expression of a target gene in plant roots;

3) A nucleotide sequence which can be hybridized with the nucleotide sequence shown as SEQ ID NO.1 in the sequence table under high stringent conditions.

The high stringency conditions are hybridization and washing of the membranes in a solution of 0.1 XSSPE (or 0.1 XSSC), 0.1% SDS at 65 ℃.

And amplifying the primer pair of the tomato root specific promoter pSlROOT2, wherein the nucleotide sequences of the primer pair are shown as SEQ ID NO.2 and SEQ ID NO. 3.

A gene expression cassette comprising the tomato root specific promoter pSlROOT2 described above.

An expression vector comprising the tomato root specific promoter pSlROOT2.

Recombinant bacteria containing the tomato root specific promoter pSlROOT2.

The tomato root specific promoter pSlROOT2 is applied to the promotion of the expression of a target gene.

Further, the initiation of the expression of the gene of interest is to initiate expression of the gene of interest in a plant.

Still further, the expression is root-specific expression.

By using the plant expression vector, the promoter sequence of the invention is constructed to any target gene upstream and is led into plant cells, thus obtaining the root-specific expression transgenic plant. Plant expression vectors carrying the promoter sequences of the present invention can be transformed into plant cells or tissues by using Ti plasmids, direct DNA transformation, microinjection, agrobacterium-mediated methods, etc., and the transformed plant tissues are cultivated into plants. The transformed plant host is referred to as Arabidopsis thaliana.

Compared with the prior art, the invention has the following advantages:

1. the promoter is a tomato root specific expression promoter screened by a transcriptome sequencing technology, and the method is quick, convenient and high in accuracy.

2. The promoter can specifically drive the downstream target gene to express in roots of plants, but not in other tissues and organs, and has tissue expression specificity.

3. Plant roots are important vegetative organs and are available to breeding specialistsSlROOT2The promoter specifically expresses the target gene in roots to improve plant resistance to diseases and insect pests, salt and alkali resistance, change plant metabolic pathways, and increase and improve plant yield and nutrient components.SlROOT2The promoter lays a theoretical foundation for improving the expression and accumulation level of exogenous genes in specific tissues of tomatoes by a genetic engineering means and obtaining new varieties of disease-resistant or stress-resistant crops by applying a transgenic method.

Drawings

FIG. 1 shows tomato root specific genesSlROOT2(Solyc 03g 096540) transcriptome data analysis results of expression levels in different organs of tomato.

Fig. 2 is tomatoSlROOT2Electropherograms of promoter PCR amplification.

Fig. 3 is tomatoSlROOT2Promoter fusionGUSThe structure of the gene expression vector p1300GN-pSlROOT2 is schematically shown.

FIG. 4 is a double restriction map of the p1300GN-pSlROOT2 vector.

FIG. 5 is a PCR amplification electropherogram of transgenic p1300GN-pSlROOT2 vector T1 generation Arabidopsis plants.

FIG. 6 shows the results of GUS staining on roots and the ground of Arabidopsis plants transformed with the p1300GN-pSlROOT2 vector T1.

Detailed Description

Tomato is a typical model plant, and 'Micro-Tom' is a tomato dwarfing mutant, which has the basic characteristics of tomato, has the advantages of shorter plant and shorter growth cycle, and is more suitable for functional genomics research. The invention screens the promoter of tomato root specific expression according to the transcriptome sequencing analysis of different tissue parts of tomato, clones the promoter of tomato root specific expression gene by using the PCR technology, and replaces the promoter in pCAMBIA1300GN (p 1300 GN)35SPromoters and methods of useGUSThe reporter gene is fused, the transgenic positive plant of arabidopsis is obtained through agrobacterium-mediated transgenic experiments, and the expression part and the activation activity of the promoter are analyzed through GUS histochemical staining and GUS enzyme activity detection, and the combination of the activation is realizedThe promoter pSlROOT2 with strong activity and stable action is screened out by analyzing the cis-acting elements of the promoter, an effective way is provided for searching the specific expression promoter of the tomato root, and a theoretical basis is laid for improving the expression and accumulation level of exogenous genes in specific tissues of crops by a genetic engineering means and obtaining new varieties of disease-resistant or stress-resistant crops by applying a transgenic method.

The invention will now be described in further detail with reference to the drawings and specific examples, which should not be construed as limiting the invention. Modifications and substitutions to methods, procedures, or conditions of the present invention without departing from the spirit and nature of the invention are intended to be within the scope of the present invention.

The methods used in the following examples were all conventional methods, and the primers and sequencing used were all performed by Beijing grade Sino biosciences, inc., with the rapid endonucleases purchased from Thermo Fisher Scientific, DNA gel recovery kit, DNA Marker, etc., purchased from Dalianbao biosystems; tomato 'Micro-Tom', wild type Arabidopsis Col-0, escherichia coli competent strain TOP10, agrobacterium competent strain GV3101, transformed plant genetic expression vector p1300GN and the like used in the experiment are all preserved in the laboratory of the inventor.

Example 1

Tomato (tomato)SlROOT2Obtaining the full-Length sequence of the promoter

By analyzing the gene expression transcriptome data of tomato variety Heinz flower bud, flower, root, leaf and fruit of different period, one specific expression in root is screenedSlROOT2(Solyc 03g 096540) (shown in FIG. 1). According to Solyc03g096540 sequence predicted by tomato whole genome sequence, selecting upstream 2000bp fragment of said gene locus (nucleotide sequence is shown as SEQ ID NO. 1) as promoter sequence of said gene, and designing primer, and using upstream primer F as acgacggccagtgccaagcttTTTGTGCTCTGCTGTAGAGG (SEQ ID NO. 2), the downstream primer R being GGACTGACCACCCGGGGATCCGGCTGGTTCTTTTGTTCTCC (SEQ ID NO. 3). In the upstream primer F, the first 15 bases acgacggccagtgcc are p1300GN vector homologous recombination arms, and the subsequent AAGCTT isHindIII cleavage site, the rest sequence isSlROOT2Upstream expansionIncreasing a primer sequence; in the downstream primer R, the first 15 bases GGACTGACCACCCGG are p1300GN vector homologous recombination arms, and the subsequent GGATCC isBamH I cleavage site and the rest sequences areSlROOT2And amplifying the primer sequence downstream.

The CTAB method is adopted to extract the genome DNA of the tomato variety Micro-Tom', and the DNA is used as a template, and the reaction system is as follows: 5. mu L10 Xbuffer, 2 mu L dNTPs,2 mu L DNA template, 1 mu L DMSO, 1.5 mu L each of upstream primer F and downstream primer R, 0.5 mu L Kod Plus-Neo polymerase, ddH ₂ And O36.5 mu L. The reaction conditions are as follows: pre-denaturation at 94℃for 3 min; denaturation at 94℃for 30 s, annealing at 56℃for 30 s, elongation at 68℃for 2min, 35 cycles; the temperature is kept at 68 ℃ for 5 min. After the PCR was completed, 5. Mu.L of the reaction solution was subjected to agarose gel electrophoresis, and the results showed that: the PCR product had only 1 DNA band of 2000bp in size, as shown in FIG. 2. In FIG. 2, lane 1 is a DL5000 Marker, and the bands are 5000 bp, 3000 bp, 2000bp, 1000 bp, 750 bp, 500 bp, 250bp, 100 bp from top to bottom, respectively. Lane 2 isSlROOT2The promoter, and the fragment is recovered and purified.

Example 2

SlROOT2Construction of promoter plant expression vectors

Using Thermo Fisher ScientificHindIIIBamH I double enzyme cutting p1300GN, the double enzyme cutting system is: Hin d III 2 µL，Bamh I2 [ mu ] L, p1300GN plasmid 20 [ mu ] L, fastDigest green buffer 4 [ mu ] L, ddH ₂ O12 [ mu ] L. Enzyme digestion 1 h at 37 deg.C, enzyme digestion product purification (DP 214) is carried out by referring to the specification of a Universal DNA purification recovery kit of radix et rhizoma Nardostachyos after agarose gel electrophoresis of enzyme digestion products, and the purified PCR fragment is connected with an empty carrier recovered by enzyme digestion by a homologous recombination method to construct a kit containingGUSThe plant expression vector p1300GN-pSlROOT2 (FIG. 3) of the gene. The connection system is as follows: 2.5 mu L of carrier skeleton, 2.5 mu L of purified PCR fragment, 2X EasyGeno Assembly Mix mu L and water bath at 50 ℃ for 30min. Afterwards, 10 mu L of connection product is added into a centrifuge tube containing 50 mu L of competent cells TOP10, the mixture is gently mixed, an ice bath is carried out for 30min, heat shock is carried out for 90s at 42 ℃ and 2min, 800 mu L of LB liquid culture medium is added, the mixture is cultured for 45min at 37 ℃, 200 mu L of bacterial liquid is taken and coated on an LB culture medium plate containing 50 mu g/L of kanamycinAnd (3) culturing for 12-16 hours at 37 ℃ in an inverted mode, and observing the result. Colony PCR amplification response system: 1. mu.L of primer F,1 mu.L of primer R,10 mu.L of 2 XA 8 Mixture, single colony, ddH ₂ O8. Mu.L. The PCR reaction conditions were: pre-denaturation at 95 ℃ for 5 min; denaturation at 95℃for 30 s, annealing at 56℃for 30 s, extension at 72℃for 2min, and cycling for 35 times; the temperature is kept at 72 ℃ for 5 min. Positive clones were used to extract plasmidsHindIIIBamH I the recombinant with the complete correct result of enzyme digestion identification and sequencing is named as p1300GN-pSlROOT2. The double restriction enzyme map is shown in FIG. 4, lane 1 is DL5000 Marker, lane 2 is p1300GN-pSlROOT2 plasmid, and lane 3 is p1300GN-pSlROOT2 plasmidHindIIIBamH I double enzyme digestion.

Example 3

Genetic transformation of arabidopsis thaliana and positive plant detection

And (3) introducing the constructed binary expression vector p1300GN-pSlROOT2 and the p1300GN empty vector into agrobacterium GV3101 by adopting a heat shock method. And removing the top of the arabidopsis plant to be transformed, cutting off the bud, and transforming. 20 mu L of agrobacterium GV3101 bacterial liquid containing p1300GN-pSlROOT2 plasmid and p1300GN plasmid is added into 3 mL of LB (50 mu g/mL Kan) liquid culture medium, and the temperature is 28 ℃ and the speed is 180 r/min for culturing 36-48 h; placing the bacterial liquid into a centrifuge tube, centrifuging at room temperature of 12000 r/min for 1 min to collect bacterial cells, and discarding the supernatant; adding 1 mL of 1/2MS+5% sucrose solution for suspension precipitation, centrifuging for 1 min at 12000/r/min, and discarding the supernatant; adding 1 mL of 1/2MS+5% sucrose solution again for suspension precipitation, adding 0.2 mu L of 0.02% Silwet-L77, and stirring and mixing uniformly; the cells were pipetted onto unopened buds using a 200. Mu.L pipette and marked, covered overnight with plastic film, and the conversion was increased. The seeds ripen after about one month, and are dried after harvesting. Sterilizing with 10% NaClO for 10 min T ₀ The seeds of Arabidopsis thaliana are washed 5 times with sterile water, dibble planted on the surface of MS culture medium containing 40 mug/mL hygromycin, spring-treated for 2 days at 4 ℃ in a refrigerator, and then cultured in a culture room at 23 ℃.

Extracting wild type, p1300GN-pSlROOT2 plasmid and p1300GN Arabidopsis genome DNA, and selectingGUSAmplifying the target gene. The plant expression vector primer GUS F: ATGTTACGTCCTGTAGAAACC (SEQ ID NO. 4) and GUS R: CGGCAATAACATACGGCGTGACATC (SEQ ID NO. 5)Screening positive transgenic plants, wherein a PCR amplification reaction system is as follows: 1. mu.L template, 0.5. Mu.L GUS F, 0.5. Mu.L GUS R, 10. Mu.L 2 XA 8 mix, ddH ₂ O8. Mu.L. The target band obtained by PCR amplification is positive in detection, and the result shows that 16 plants detected by PCR are positive (shown in figure 5). In FIG. 5, lane 1 shows the molecular weight standard, DL2000 Marker, with molecular weights of 2000bp, 1000 bp, 750 bp, 500 bp, 250bp, 100 bp, respectively. Lanes 2-17 are regenerated plants of the partially transgenic plant expression vector.

The seed of T0 generation transgenic plant and the plant grown from the seed are T ₁ Instead, and so on, T ₂ 、T ₃ The 2 nd and 3 rd generations of transgenic plants are indicated, respectively.

Example 4

GUS histochemical staining of transgenic plants

Detection by histochemical stainingGUSExpression of genes in plant tissue cells. Taking T obtained in example 3 ₁ Transgenic Arabidopsis seedlings were subjected to GUS histochemical staining with wild type and transgenic p1300GN (containing35sPromoter) control vector arabidopsis thaliana served as negative and positive control. Washing the Arabidopsis plants to be detected with sterile water, absorbing surface moisture, respectively placing the Arabidopsis plants into a 2 mL centrifuge tube, adding a proper amount of GUS staining solution (GUS staining kit SL7160-2 is purchased from Coolaber) into each tube, incubating for 1 h to overnight at 37 ℃, removing the staining solution, decoloring with 70% ethanol until leaves of negative control materials are white, and scanning and photographing with Stereo Discovery V.12. Blue in white background is GUS expression site. The results showed that the root and aerial parts of wild type Arabidopsis were not blue, containing35SBoth roots and aerial parts of the transformed plants of the promoter control vector are blue, whereas the aerial parts of the transformed recombinant vector p1300GN-pSlROOT2 plants always have no GUS expression, and only strong specific expression is found in roots (FIG. 6). Thus the promoter drivesGUSThe gene is only efficiently expressed in Arabidopsis roots, and is not expressed in other tissues and organs, namely the promoter is a root-specific promoter, and has good application value in plant genetic engineering. Such as can be driven by constructing a promoter containing the promoterThe vector for improving stress resistance and lodging resistance of plants, transforming receptor plants, artificially creating high-quality high-yield materials with strong resistance, and being applied to agricultural production.

Claims (8)

1. The tomato root specific promoter pSlROOT2 is characterized in that: is one of the following nucleotide sequences:

1) A nucleotide sequence shown as SEQ ID NO.1 in the sequence table;

2) A nucleotide sequence which has more than 90 percent of homology with the nucleotide sequence shown as SEQ ID NO.1 in the sequence table and has the function of regulating and controlling the specific expression of a target gene in plant roots;

3) A nucleotide sequence which can be hybridized with the nucleotide sequence shown as SEQ ID NO.1 in the sequence table under high stringent conditions.

2. A primer pair for amplifying the tomato root specific promoter pSlROOT2 of claim 1, characterized in that: the nucleotide sequences of the primer pairs are shown as SEQ ID NO.2 and SEQ ID NO. 3.

3. A gene expression cassette comprising the tomato root specific promoter pSlROOT2 of claim 1.

4. An expression vector comprising the tomato root specific promoter pSlROOT2 of claim 1.

5. A recombinant bacterium comprising the tomato root specific promoter pSlROOT2 of claim 1.

6. Use of the tomato root specific promoter pSlROOT2 of claim 1 for promoting expression of a gene of interest.

7. The use according to claim 6, characterized in that: the initiation of the expression of the gene of interest is to initiate expression of the gene of interest in the plant.

8. The use according to claim 7, characterized in that: the expression is root-specific expression.

Images